Homologs in group_2602

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03435 FBDBKF_03435 100.0 Morganella morganii S1 kdpB potassium-transporting ATPase subunit KdpB
EHELCC_07100 EHELCC_07100 100.0 Morganella morganii S2 kdpB potassium-transporting ATPase subunit KdpB
LHKJJB_06960 LHKJJB_06960 100.0 Morganella morganii S3 kdpB potassium-transporting ATPase subunit KdpB
HKOGLL_03970 HKOGLL_03970 100.0 Morganella morganii S5 kdpB potassium-transporting ATPase subunit KdpB
F4V73_RS11465 F4V73_RS11465 93.0 Morganella psychrotolerans kdpB potassium-transporting ATPase subunit KdpB

Distribution of the homologs in the orthogroup group_2602

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2602

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5YQN9 0.0 1120 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 0.0 1120 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
A4W860 0.0 1105 82 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
Q57RN0 0.0 1102 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
Q3Z4A6 0.0 1097 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
B7M5L3 0.0 1097 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 0.0 1097 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B7NMQ0 0.0 1096 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q324L0 0.0 1096 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
B7LKR7 0.0 1095 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLE1 0.0 1095 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
B6HYQ5 0.0 1095 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZXV8 0.0 1095 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
A7ZJ80 0.0 1095 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FJV4 0.0 1094 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 0.0 1094 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MPK0 0.0 1094 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
B7UKX6 0.0 1094 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A6T6D8 0.0 1093 83 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZE9 0.0 1093 82 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
B7N9U0 0.0 1093 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TQ22 0.0 1092 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
A9MUE0 0.0 1092 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZB1 0.0 1092 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B4TBA6 0.0 1092 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 0.0 1092 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
P03960 0.0 1092 81 0 682 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 0.0 1092 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 0.0 1092 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B5FNE0 0.0 1091 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B5BCA4 0.0 1090 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 0.0 1090 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQW2 0.0 1090 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1REM0 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B1IY32 0.0 1088 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B2TTJ7 0.0 1087 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5EZE3 0.0 1087 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B5R670 0.0 1082 81 0 674 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q667S4 0.0 1078 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TL06 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 0.0 1077 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A1JQS2 0.0 1077 80 1 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JR96 0.0 1076 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 0.0 1076 80 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N6W6 0.0 1063 78 1 674 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GB61 0.0 1054 78 1 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
B2VJK3 0.0 1053 78 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4LDL7 0.0 998 74 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q47H39 0.0 981 72 1 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
A4SZG8 0.0 964 71 2 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8XU11 0.0 947 70 3 691 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0TRT3 0.0 889 63 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q927G0 0.0 880 65 1 681 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AM16 0.0 872 65 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y3Z7 0.0 870 65 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B2V2P3 0.0 868 62 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B2TMJ2 0.0 864 61 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q8U9D9 0.0 846 62 7 697 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
B8DAW1 0.0 841 64 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q71W90 0.0 840 64 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 0.0 840 64 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9X8Z9 0.0 840 64 5 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q98GX6 0.0 835 63 6 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q93MV5 0.0 826 64 4 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q8KU73 0.0 811 61 3 659 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
P9WPU3 0.0 810 63 5 686 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 0.0 810 63 5 686 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 0.0 810 63 5 686 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P59219 0.0 807 58 6 699 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q9RZP0 0.0 804 62 4 672 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q72TM6 0.0 804 58 6 699 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P57698 0.0 773 61 4 673 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92XJ0 0.0 772 61 6 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
C1EYK0 0.0 766 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
A9VFM1 0.0 764 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
Q9A7X7 0.0 763 59 4 671 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B7HWG1 0.0 762 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
B7HDF9 0.0 760 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
B7II09 0.0 759 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
A0RA13 0.0 759 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q6HN78 0.0 758 58 5 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81HQ0 0.0 757 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7JRB8 0.0 755 57 5 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
C3LF99 0.0 755 58 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
O32328 0.0 753 55 6 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q63FR0 0.0 752 57 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
A7GLG4 0.0 747 58 6 670 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9R6X1 0.0 747 57 8 685 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q8R8I6 0.0 746 56 6 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8YPE9 0.0 744 56 8 695 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q4LAI2 0.0 744 55 5 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q5HK64 0.0 737 55 5 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 0.0 737 55 5 679 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 0.0 737 55 5 679 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 0.0 737 55 5 679 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8YSD5 0.0 729 55 9 702 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q926K7 0.0 728 55 7 686 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P73867 0.0 724 58 7 680 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B4U8E4 0.0 706 54 6 680 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q8PCM1 0.0 700 58 5 680 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PPC9 0.0 691 57 4 671 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q6GEZ7 0.0 681 53 6 678 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
P63684 0.0 679 53 6 678 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 0.0 679 53 6 678 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NVI2 0.0 676 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 0.0 676 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
Q2YUH7 0.0 676 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z4X9 0.0 675 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 0.0 675 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 0.0 675 53 6 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
Q8Z8E5 0.0 649 86 0 392 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 4.36e-77 260 70 0 179 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P57699 0.0 645 48 8 712 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 0.0 645 48 8 712 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P57700 0.0 581 45 9 666 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q97BF6 0.0 578 45 8 664 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P9WPS3 1.02e-53 200 31 15 544 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 1.02e-53 200 31 15 544 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32220 2.82e-52 197 34 16 485 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
P58341 4.05e-52 196 29 21 617 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
O30085 7.41e-50 188 32 16 465 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8CN02 2.52e-49 188 32 15 483 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 2.52e-49 188 32 15 483 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9X5X3 2.83e-49 188 28 19 609 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P58342 5.01e-49 187 29 18 613 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
Q9S7J8 5.44e-49 188 30 16 560 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q7A3E6 5.31e-48 184 30 16 484 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 5.31e-48 184 30 16 484 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 5.31e-48 184 30 16 484 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 5.31e-48 184 30 16 484 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 5.31e-48 184 30 16 484 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDP1 7.19e-48 184 30 16 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A8Z3F8 1.32e-47 183 30 15 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 1.32e-47 183 30 15 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
A6QK47 1.46e-47 183 30 15 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 1.46e-47 183 30 15 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 1.46e-47 183 30 15 489 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8NUQ9 2.33e-47 182 30 16 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 2.33e-47 182 30 16 489 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
O29777 2.34e-47 182 29 11 531 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q2YWA3 2.87e-47 182 30 16 486 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZHC7 1.58e-46 180 28 14 572 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q4L970 3.43e-46 179 29 15 497 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
A3AWA4 5.35e-46 179 27 12 528 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q4A0G1 9.59e-46 177 30 15 480 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P32113 2.16e-45 176 30 16 499 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
A0A0P0X004 2.46e-45 177 28 14 561 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9KPZ7 6.55e-45 176 30 16 499 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O31688 8.15e-45 173 28 10 529 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
A8YZ02 1.19e-44 173 28 13 499 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.19e-44 173 28 13 499 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
O32619 7.56e-44 171 27 16 537 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q8CQF7 7.74e-44 171 28 13 499 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKB0 8.35e-44 171 28 15 499 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P77871 1.14e-43 171 27 14 495 3 copA Copper-transporting ATPase Helicobacter pylori
Q5ZWR1 5.58e-43 169 30 11 457 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q4LAB1 7.8e-43 168 28 15 499 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
O08462 2.45e-42 167 27 15 495 3 copA Copper-transporting ATPase Helicobacter pylori
Q9SH30 5.45e-42 167 27 11 527 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
P37386 1.64e-41 165 29 12 492 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
Q6GIX1 1.74e-41 164 29 12 492 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P37279 6.51e-41 163 28 13 537 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q59467 7.27e-41 162 26 14 496 3 copA Copper-transporting ATPase Helicobacter pylori
Q8ZCA7 1.51e-40 163 28 17 532 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q9ZM69 1.57e-40 162 26 13 496 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q6GIX4 3.47e-40 160 26 12 506 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
P55989 4e-40 160 26 14 494 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q69HU0 4.07e-40 160 26 12 506 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
P58414 2.07e-39 158 28 17 527 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9CCL1 2.21e-39 158 30 13 455 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
P30336 2.7e-39 158 28 13 499 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P05425 2.84e-39 158 27 13 465 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
P20021 7.53e-39 157 28 12 495 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P73241 1.08e-38 156 29 18 536 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WPU1 1.12e-38 156 31 14 490 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 1.12e-38 156 31 14 490 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8Z8S4 1.91e-38 156 29 14 498 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q9X5V3 2.14e-38 156 29 14 534 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P37617 4.95e-38 154 28 9 495 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q6H7M3 5.63e-38 155 26 10 528 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q04656 5.93e-38 155 27 14 509 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q8ZR95 7.06e-38 154 29 14 498 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3YW59 9e-38 153 28 9 495 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
Q59385 1.71e-37 153 28 19 562 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q64535 3.4e-37 153 27 10 502 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64446 5.07e-37 152 26 9 499 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q8XD24 5.9e-37 151 28 14 495 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
P9WPT5 1.05e-36 150 29 20 539 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 1.05e-36 150 29 20 539 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 1.05e-36 150 29 20 539 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3A7 1.08e-36 149 32 12 434 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B9DFX7 1.15e-36 150 28 18 523 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P70705 1.32e-36 151 26 12 502 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
Q64430 1.46e-36 151 26 10 502 1 Atp7a Copper-transporting ATPase 1 Mus musculus
B2HEM2 1.56e-36 149 28 17 528 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9CFU9 1.89e-36 150 26 22 620 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
P35670 2.75e-36 150 26 11 506 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
Q9XT50 3.92e-36 150 27 11 505 2 ATP7B Copper-transporting ATPase 2 Ovis aries
O32219 4.86e-36 148 27 11 468 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
Q60048 1.12e-35 147 28 16 500 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
O59666 3.23e-35 146 27 13 459 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P49015 4.21e-35 146 26 13 509 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P46840 6.44e-35 145 29 12 478 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q73E41 1.59e-34 144 24 18 631 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P9WPT7 2.22e-33 139 32 17 482 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 2.22e-33 139 32 17 482 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT8 3.31e-32 136 29 16 488 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 3.31e-32 136 29 16 488 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT9 3.34e-32 136 29 16 488 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q59998 4.36e-32 136 28 18 515 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O64474 3.32e-31 134 29 18 461 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
P37278 3.72e-31 134 26 19 677 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8Y8Q5 9.76e-31 132 24 23 643 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9SZW4 4.22e-30 130 28 15 466 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
P46839 4.6e-30 130 29 10 462 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q9SZC9 6.91e-30 130 27 14 522 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
Q58623 1.85e-29 128 24 10 522 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9RQB4 6.3e-29 126 24 16 539 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q59465 1.1e-28 125 24 14 520 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
P57709 1.91e-28 125 22 19 685 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P78036 2.6e-28 125 24 16 565 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9ZL53 5.76e-28 123 24 14 520 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q43128 7.57e-28 123 24 11 524 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
P98194 7.6e-28 123 22 20 685 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q9LV11 8.42e-28 123 24 12 525 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q64566 9.39e-28 123 22 21 685 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q5R5K5 1.32e-27 122 22 20 684 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
P35597 1.39e-27 122 26 24 576 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9SU58 2.41e-27 122 24 12 525 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
P12522 3.89e-27 121 25 16 558 2 H1B Probable proton ATPase 1B Leishmania donovani
P54679 5.67e-27 120 24 16 575 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
Q08436 7.12e-27 120 23 12 521 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P47317 7.32e-27 120 24 19 572 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q80XR2 8.74e-27 120 23 17 601 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
P22180 1.24e-26 119 23 12 521 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
P9WPT3 1.41e-26 119 29 16 464 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 1.41e-26 119 29 16 464 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 1.41e-26 119 29 16 464 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P83970 1.88e-26 119 23 12 521 2 ha1 Plasma membrane ATPase Triticum aestivum
P38995 2.13e-26 119 27 17 462 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P11718 2.92e-26 118 24 15 556 2 H1A Probable proton ATPase 1A Leishmania donovani
O59868 5.21e-26 117 23 16 596 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P77868 7.6e-26 117 24 8 491 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34431 1.03e-25 117 25 20 626 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q7XPY2 1.16e-25 116 23 12 525 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
A3BF39 1.17e-25 117 27 17 493 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q9SH76 1.28e-25 116 23 12 524 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q03194 1.3e-25 116 24 12 543 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q08435 1.76e-25 116 23 12 521 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P20649 2.19e-25 115 23 11 536 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P18398 2.32e-25 115 24 11 482 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P07038 2.47e-25 115 24 12 519 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9LY32 2.55e-25 115 24 15 526 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
P0CW78 3.5e-25 114 25 16 474 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
A7L9Z8 4.06e-25 115 23 16 596 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P19456 4.78e-25 114 24 12 531 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
Q9SJB3 6.96e-25 114 22 12 531 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
Q42556 4.19e-24 112 22 11 525 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P13586 5.77e-24 111 23 23 697 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P20431 1.17e-23 110 22 11 540 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
Q9M2A0 1.95e-23 109 23 12 525 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
P37367 1.96e-23 109 25 23 665 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O33533 2.11e-23 109 26 11 441 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
Q8R4C1 2.12e-23 109 24 19 598 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q9M2L4 3.1e-23 109 22 17 596 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
P37385 3.38e-23 108 25 14 470 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7X8B5 5.99e-23 108 22 20 615 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q9Z1W8 6.05e-23 108 23 20 621 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9LIK7 6.13e-23 108 23 18 590 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
O75185 9.19e-23 107 24 19 600 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
P9WPS9 1.25e-22 107 27 22 641 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.25e-22 107 27 22 641 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.25e-22 107 27 22 641 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C1L360 1.85e-22 106 22 18 654 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
Q9SZR1 3.01e-22 105 22 21 670 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
P07893 4.81e-22 105 24 16 527 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P05030 8.53e-22 104 23 17 526 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q07421 5.19e-21 102 24 13 518 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P28877 7.8e-21 101 24 17 524 1 PMA1 Plasma membrane ATPase 1 Candida albicans
P35317 1.17e-20 100 22 22 632 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P19657 1.18e-20 100 23 17 526 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54678 2.7e-20 99 23 20 588 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P38360 3.73e-20 99 25 13 475 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54211 9.3e-20 98 25 18 565 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
Q9LF79 9.68e-20 98 23 25 654 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
P24545 1.04e-19 97 23 14 522 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
Q7XB51 1.52e-19 97 21 19 662 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
P92939 2.53e-19 96 28 4 259 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P09627 3.43e-19 96 23 13 534 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0ABB8 3.68e-19 95 23 21 612 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 3.68e-19 95 23 21 612 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
B9QMJ0 3.84e-19 96 33 6 220 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
P49380 4.3e-19 95 24 15 523 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9XES1 5.28e-19 95 28 5 259 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q37145 1.31e-18 94 33 4 177 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q65X71 1.87e-18 94 23 22 586 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 2.04e-18 94 34 5 194 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q9LU41 2.6e-18 93 30 2 207 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
P9WPS7 1.11e-17 91 29 16 462 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.11e-17 91 29 16 462 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.11e-17 91 29 16 462 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O64806 1.16e-17 91 34 4 175 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q6ATV4 1.43e-17 91 32 5 194 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
O81108 1.92e-17 90 32 4 175 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
P54209 3.64e-17 89 31 2 195 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
O22218 5.83e-17 89 30 4 193 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 0.000135 49 22 9 280 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q4WHC8 8.65e-17 88 29 2 177 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9LY77 1.1e-16 88 30 2 180 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
P22036 1.12e-16 88 26 11 420 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q42883 1.12e-16 88 30 3 189 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
P54210 1.37e-16 87 23 18 584 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
P36640 1.44e-16 87 22 17 601 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 1.44e-16 87 22 17 601 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
P23980 1.49e-16 87 22 9 405 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
O53114 2.03e-16 87 24 14 576 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
Q8RUN1 2.33e-16 87 32 5 194 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q9SY55 3.59e-16 86 29 1 186 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
P35315 3.68e-16 86 29 1 183 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
O23087 3.89e-16 86 29 3 189 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
Q7XEK4 5.26e-16 85 31 3 180 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 0.000104 49 25 6 215 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
A0A143ZZK9 7.95e-16 85 28 3 216 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
O77696 1.01e-15 85 30 2 183 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
P28876 1.24e-15 84 23 12 517 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59207 1.64e-15 84 24 15 501 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P35316 1.74e-15 84 25 9 346 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
Q4WND5 1.85e-15 84 31 2 183 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9HDW7 2.27e-15 84 31 2 187 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0R3Y2 3.62e-15 83 23 15 510 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P22700 4.72e-15 82 28 2 183 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q292Q0 5.42e-15 82 28 2 183 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q7PPA5 5.56e-15 82 28 2 183 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q9M3H5 5.97e-15 82 23 21 543 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
P38929 7.85e-15 82 28 10 255 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2RAS0 1.07e-14 81 32 4 175 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q9YGL9 1.23e-14 81 28 2 182 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 2.34e-06 54 26 8 305 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P20647 1.42e-14 81 26 10 311 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
Q64578 2e-14 80 28 2 183 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 0.000405 47 25 9 315 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q8R429 2.08e-14 80 28 2 183 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 0.000412 47 25 9 315 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
P04191 2.13e-14 80 29 2 182 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 0.000283 48 26 9 315 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
O43108 2.17e-14 80 30 3 175 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 2.71e-06 54 26 11 326 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O14983 2.18e-14 80 29 2 182 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 0.00057 47 26 9 315 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
Q93084 2.2e-14 80 28 2 183 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q2QY12 2.64e-14 80 31 4 176 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
J9VQQ3 2.71e-14 80 28 2 184 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9T0E0 3.48e-14 80 22 13 487 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P16615 3.66e-14 80 28 3 193 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
Q03669 4.61e-14 79 26 5 235 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P30714 4.62e-14 79 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 2.66e-07 57 26 16 304 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
Q0VCY0 4.75e-14 79 29 2 182 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 0.000675 47 26 9 315 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
P17326 5.37e-14 79 27 3 183 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 6.96e-06 53 26 13 306 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
Q92105 5.55e-14 79 25 8 320 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
P11607 7.47e-14 79 27 3 193 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11507 8.28e-14 79 27 3 193 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
Q9YH26 8.57e-14 79 25 4 232 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 2.52e-06 54 25 11 299 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
O55143 8.65e-14 79 27 3 193 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
Q00779 9.39e-14 79 27 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
O46674 9.47e-14 79 27 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q64518 9.89e-14 78 28 2 183 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P18596 1.02e-13 78 28 2 183 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P70083 1.02e-13 78 27 3 204 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 5.64e-05 50 26 9 336 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
Q9N0Z6 2.46e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 2.07e-06 55 27 16 306 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P28774 2.46e-13 77 25 3 203 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 4.38e-07 57 27 13 309 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q5RDR3 2.83e-13 77 25 3 201 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 2.18e-05 51 29 11 219 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P13585 2.89e-13 77 28 2 182 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P05023 3e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 2.11e-05 51 29 11 219 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P04074 3.44e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 6.06e-06 53 26 14 302 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P18907 3.5e-13 77 25 3 201 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 9.61e-06 52 26 14 302 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
Q64392 3.52e-13 77 26 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 4.96e-09 63 27 11 303 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q92123 3.57e-13 77 25 3 201 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 2.05e-06 55 24 13 309 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q08DA1 3.62e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 7.5e-06 53 26 14 302 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q92126 4e-13 76 27 4 211 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 2.97e-09 64 29 11 229 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
P23634 4.55e-13 76 29 4 192 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
Q9TV52 5.25e-13 76 25 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 4.05e-11 70 30 7 221 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P13607 5.42e-13 76 25 3 203 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 8.87e-06 53 28 9 220 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P54707 5.8e-13 76 26 3 201 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 8.38e-09 62 28 6 221 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
Q8VDN2 5.92e-13 76 25 3 201 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 9.83e-07 56 27 14 302 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P06685 6.07e-13 76 25 3 201 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 9.67e-07 56 27 14 302 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P05025 6.23e-13 76 25 3 201 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 2.68e-07 57 24 10 298 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
D3K0R6 6.63e-13 76 29 4 192 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P09572 7.85e-13 75 25 3 206 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 4.92e-07 57 27 14 305 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P54708 8.6e-13 75 25 3 201 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 3.03e-10 67 28 7 221 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q92030 9.16e-13 75 25 3 201 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 2.79e-06 54 25 11 299 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P20648 9.61e-13 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 1.05e-10 68 28 6 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P27112 1.03e-12 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 7.88e-11 69 28 7 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P09626 1.08e-12 75 26 3 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.1e-10 67 28 7 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P50996 1.11e-12 75 26 3 200 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 2.16e-11 71 29 6 211 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
Q9WV27 1.17e-12 75 25 3 200 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q64436 1.22e-12 75 26 3 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 3.08e-10 67 28 7 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q5RCD8 1.23e-12 75 24 3 206 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 4.65e-06 53 24 11 299 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
P19156 1.3e-12 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 4.75e-11 70 28 7 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P58312 1.33e-12 75 25 4 212 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 2.2e-07 58 24 10 301 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P06686 1.35e-12 75 24 3 206 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 1.52e-06 55 24 11 299 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 1.35e-12 75 24 3 206 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 1.52e-06 55 24 11 299 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
P50993 1.42e-12 75 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 6.95e-06 53 24 11 299 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
Q6Q477 1.45e-12 75 28 4 189 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
P06687 1.48e-12 75 24 3 201 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 5.7e-08 60 25 11 298 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 1.48e-12 75 24 3 201 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 5.7e-08 60 25 11 298 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 1.53e-12 74 24 3 201 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 5.36e-08 60 25 10 298 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P25489 1.94e-12 74 25 4 212 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 1.54e-05 52 24 11 300 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q92036 2e-12 74 25 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 1.03e-06 55 27 10 243 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
P05024 2.03e-12 74 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 5.2e-06 53 26 14 302 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
Q6RWA9 2.56e-12 74 26 4 201 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q64568 2.65e-12 74 28 4 189 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q64542 3.04e-12 73 28 4 189 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
A2VDL6 3.26e-12 73 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 7.07e-06 53 23 9 299 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
P11505 3.42e-12 73 28 4 189 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
G5E829 3.54e-12 73 28 4 189 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P24797 3.58e-12 73 24 3 201 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 4.04e-07 57 25 11 304 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
Q16720 3.6e-12 73 28 4 189 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
D2WKD8 3.77e-12 73 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 5.56e-06 53 24 11 299 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
Q64541 3.91e-12 73 25 3 200 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 1.38e-07 58 24 9 301 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
P24798 4.34e-12 73 24 3 201 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 8.92e-07 56 24 10 298 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
O13397 5.87e-12 73 29 3 167 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
P11506 6.88e-12 72 27 4 195 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q9R0K7 7.04e-12 72 27 4 195 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q01814 7.89e-12 72 27 4 195 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
P50997 9.28e-12 72 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 7.25e-06 53 26 14 303 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
G5EFR6 1.53e-11 71 23 6 289 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
P20020 1.56e-11 71 27 4 189 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
P23220 1.75e-11 71 27 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
O13398 1.9e-11 71 28 3 166 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
Q08853 2.37e-11 71 29 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P9WPT0 3.47e-11 70 22 11 472 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 3.53e-11 70 22 11 472 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 3.53e-11 70 22 11 472 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q13733 4.59e-11 70 26 4 201 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 7.14e-06 53 27 9 208 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q58378 6e-11 67 33 2 119 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q98SH2 6.3e-11 69 27 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q12691 6.48e-11 69 29 3 167 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 7e-11 69 29 3 167 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P22189 1.5e-10 68 30 3 143 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P13587 1.89e-10 68 28 3 167 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CW77 1.72e-09 64 26 6 222 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q00804 2.67e-09 64 25 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
P58165 3.58e-09 63 26 4 186 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
Q9NQ11 3.83e-09 63 25 14 282 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
P9WPS4 8.42e-09 62 26 3 191 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 8.7e-06 53 28 7 244 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS5 9.41e-09 62 26 3 191 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 6.09e-06 53 28 7 244 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O14022 1.59e-08 62 26 14 326 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8H384 1.67e-08 61 35 2 129 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q9EPE9 1.14e-07 59 22 21 516 1 Atp13a1 Endoplasmic reticulum transmembrane helix translocase Mus musculus
Q9CTG6 1.34e-07 58 25 11 280 2 Atp13a2 Polyamine-transporting ATPase 13A2 Mus musculus
P90747 1.82e-05 52 23 12 383 3 catp-8 Probable manganese-transporting ATPase catp-8 Caenorhabditis elegans
O14072 6.03e-05 50 19 15 509 1 cta4 Endoplasmic reticulum transmembrane helix translocase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q21286 0.000267 48 21 10 286 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
Q5ZKB7 0.000323 48 18 3 227 2 ATP13A4 Probable cation-transporting ATPase 13A4 Gallus gallus

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07425
Feature type CDS
Gene kdpB
Product potassium-transporting ATPase subunit KdpB
Location 152508 - 154556 (strand: 1)
Length 2049 (nucleotides) / 682 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2602
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2216 Inorganic ion transport and metabolism (P) P K+ transport ATPase, ATPase subunit KdpB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01547 potassium-transporting ATPase ATP-binding subunit [EC:7.2.2.6] Two-component system -

Protein Sequence

MSRQTQRLFEPALVRRALPDAFRKLSPVVQWQNPVMFIVWCGSLLTTLLAAGMFSGFISGNGGFTLTVALWLWFTVLFANFAEALAEGRSKAQADSLKGMKKTSRARRLHAAQRDSGFDMVSADTLRKGDLVLVEAGDLIPCDGTVLEGGASVDESAITGESAPVIRESGGDFASVTGGTRILSDWLIIECSANPGDSFLDRMISMVEGAKRSKTPNEIALTILLAALSIVFLLAVATLWPFTAYTGHPVTLTVMIALLVCLIPTTISGLLSAIGVAGMSRMLAANVIATSGRAVEAAGDVDVLLLDKTGTITLGNRQASAFLAASGVDERTLADAAQLSSLADETPEGRSIVVLAKQRFSLRARDLESLNATFIPFTAQTRMSGINVDGRTIRKGSVDAIRRYIEANHGHFPAQVDKLVEEVARSGGTPLVVAEEHRVLGVIALKDIVKGGIRERFAQLRQMGIKTVMITGDNRLTAAAIAAEAGVDDFLAEATPEAKLALIRQYQKEGRLVAMTGDGTNDAPALAQADVAVAMNSGTQAAKEAGNMVDLDSNPTKLIEVVHIGKQMLMTRGSLTTFSISNDIAKYFAIIPAAFAVTYPQLDALNIMRLHSPDSAMLSAVIFNALIIVFLIPLALKGVPYHALSAAQMLRRNLWIYGLGGLVVPFIGIKLIDMLLTLTGLV

Flanking regions ( +/- flanking 50bp)

GCCGGTGGCGGAATTTCTTGATTTACTTAAGTGATTGACGGGAGAACACCATGAGTCGTCAGACACAGCGATTATTTGAACCCGCACTGGTGCGCCGCGCACTGCCGGATGCATTCCGCAAGCTCTCGCCGGTGGTGCAGTGGCAGAACCCGGTGATGTTTATTGTCTGGTGCGGCAGCCTGCTGACCACACTGCTGGCCGCCGGGATGTTCAGCGGATTTATCAGCGGTAACGGCGGATTTACCCTCACCGTCGCCCTGTGGCTGTGGTTTACCGTGCTGTTTGCCAACTTCGCCGAAGCGCTGGCGGAAGGGCGCAGCAAAGCGCAGGCCGACAGCCTGAAAGGAATGAAAAAAACCAGCCGCGCACGGCGTCTGCATGCGGCACAGCGCGACAGCGGTTTTGATATGGTCTCCGCTGATACCCTGCGCAAAGGGGATTTGGTACTGGTGGAAGCAGGGGATCTGATCCCGTGTGACGGTACCGTGCTGGAAGGCGGTGCATCTGTGGATGAGAGCGCCATTACCGGTGAATCCGCGCCGGTGATCCGCGAATCCGGCGGCGATTTTGCTTCTGTTACCGGCGGTACCCGGATTCTGTCCGACTGGCTGATTATTGAGTGCAGTGCCAACCCGGGTGACAGCTTCCTTGACCGCATGATCAGCATGGTCGAAGGTGCGAAACGCAGCAAAACGCCGAATGAGATTGCCCTGACCATCCTGCTGGCCGCACTGAGTATTGTGTTCCTGCTGGCGGTGGCGACACTCTGGCCGTTTACCGCCTATACCGGCCATCCGGTCACTCTGACAGTGATGATTGCCCTGCTGGTCTGTCTGATCCCGACTACCATCAGCGGCCTGCTTTCAGCTATTGGTGTGGCAGGGATGAGCCGTATGCTGGCCGCCAATGTCATCGCCACCAGCGGCCGTGCCGTGGAAGCTGCCGGGGATGTGGACGTGCTGTTGCTGGACAAAACCGGCACCATCACACTGGGTAACCGCCAGGCCTCTGCTTTCCTGGCTGCATCCGGTGTGGATGAAAGAACGCTGGCAGATGCAGCTCAGTTGTCATCACTGGCGGATGAAACCCCGGAAGGACGCAGTATCGTGGTGCTGGCAAAACAGCGTTTCAGCCTGCGGGCGCGTGATCTGGAAAGCCTGAATGCGACTTTTATCCCGTTTACCGCCCAGACCCGCATGAGCGGCATCAATGTGGACGGGCGCACTATCCGTAAAGGTTCCGTCGATGCTATCCGCCGCTATATTGAGGCTAACCACGGTCATTTTCCGGCACAGGTCGACAAACTGGTGGAAGAGGTTGCACGCAGCGGCGGAACCCCGCTGGTAGTGGCCGAAGAGCATCGCGTGCTCGGGGTGATCGCCCTGAAAGATATCGTAAAAGGCGGGATCCGCGAACGCTTTGCACAACTGCGCCAGATGGGGATCAAAACTGTGATGATCACAGGGGATAACCGGCTGACGGCTGCGGCGATTGCTGCCGAGGCCGGTGTGGATGATTTCCTGGCGGAAGCCACCCCGGAAGCCAAACTGGCGCTGATCCGTCAGTATCAGAAAGAAGGGCGGTTGGTGGCAATGACCGGCGACGGCACCAATGATGCGCCGGCACTGGCACAGGCGGATGTCGCGGTGGCGATGAACTCGGGCACCCAGGCGGCGAAAGAGGCGGGGAATATGGTCGATCTGGACTCCAACCCGACCAAGCTGATTGAGGTGGTGCATATCGGTAAACAGATGCTGATGACACGCGGCTCGCTGACCACGTTCAGTATCTCCAATGATATCGCCAAGTATTTTGCCATTATCCCGGCGGCGTTTGCGGTGACCTATCCGCAGCTGGATGCACTCAATATCATGCGTCTGCACTCGCCGGATTCCGCCATGTTAAGTGCGGTTATCTTCAACGCCCTGATTATTGTCTTTCTGATCCCGCTGGCGCTGAAAGGGGTGCCGTACCATGCCCTGAGCGCCGCACAGATGTTACGCCGTAATCTGTGGATCTACGGACTGGGTGGCCTGGTTGTGCCGTTTATCGGTATAAAATTGATAGATATGTTACTGACCCTGACAGGGTTAGTATAAGGATAAACAATGAGTCAGATACGTCCCGCAATCATAATATTTCTGGTTCT