Homologs in group_2626

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03435 FBDBKF_03435 93.0 Morganella morganii S1 kdpB potassium-transporting ATPase subunit KdpB
EHELCC_07100 EHELCC_07100 93.0 Morganella morganii S2 kdpB potassium-transporting ATPase subunit KdpB
NLDBIP_07425 NLDBIP_07425 93.0 Morganella morganii S4 kdpB potassium-transporting ATPase subunit KdpB
LHKJJB_06960 LHKJJB_06960 93.0 Morganella morganii S3 kdpB potassium-transporting ATPase subunit KdpB
HKOGLL_03970 HKOGLL_03970 93.0 Morganella morganii S5 kdpB potassium-transporting ATPase subunit KdpB

Distribution of the homologs in the orthogroup group_2626

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2626

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5YQN9 0.0 1115 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 0.0 1115 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
A4W860 0.0 1094 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
Q57RN0 0.0 1094 80 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
B7M5L3 0.0 1092 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 0.0 1092 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
Q3Z4A6 0.0 1091 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
A7ZXV8 0.0 1091 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B7LKR7 0.0 1090 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLE1 0.0 1090 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
B7NMQ0 0.0 1090 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6HYQ5 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
Q324L0 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
Q8FJV4 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MPK0 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
B7UKX6 0.0 1089 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N9U0 0.0 1086 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P03960 0.0 1086 81 0 682 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 0.0 1086 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 0.0 1086 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B4TQ22 0.0 1085 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
A9MUE0 0.0 1084 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TBA6 0.0 1084 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 0.0 1084 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B4SZB1 0.0 1084 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B5FNE0 0.0 1084 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
Q1REM0 0.0 1084 80 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 0.0 1084 80 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 0.0 1084 80 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B2TTJ7 0.0 1083 80 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IY32 0.0 1083 80 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5BCA4 0.0 1083 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 0.0 1083 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQW2 0.0 1082 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5EZE3 0.0 1080 81 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B5XZE9 0.0 1074 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
A6T6D8 0.0 1074 81 0 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5R670 0.0 1073 81 0 674 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
B1JR96 0.0 1060 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667S4 0.0 1060 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FFQ9 0.0 1060 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TL06 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 0.0 1059 79 1 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A1JQS2 0.0 1058 78 1 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7N6W6 0.0 1056 77 1 674 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GB61 0.0 1045 77 1 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
B2VJK3 0.0 1041 78 0 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4LDL7 0.0 990 73 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q47H39 0.0 966 71 1 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
A4SZG8 0.0 953 71 2 678 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8XU11 0.0 938 69 4 692 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0TRT3 0.0 889 63 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q927G0 0.0 888 66 1 681 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y3Z7 0.0 882 66 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AM16 0.0 877 66 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B2V2P3 0.0 867 62 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B2TMJ2 0.0 861 62 1 688 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q8U9D9 0.0 858 63 7 697 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
B8DAW1 0.0 852 66 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q71W90 0.0 850 66 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 0.0 850 66 1 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
Q98GX6 0.0 838 63 6 696 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9X8Z9 0.0 832 63 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q93MV5 0.0 825 64 3 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
P59219 0.0 822 59 6 699 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8KU73 0.0 821 62 4 667 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q72TM6 0.0 818 59 6 699 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9RZP0 0.0 811 63 5 672 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P9WPU3 0.0 801 62 7 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 0.0 801 62 7 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 0.0 801 62 7 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q92XJ0 0.0 791 62 5 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
P57698 0.0 772 61 5 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9A7X7 0.0 764 59 4 675 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C1EYK0 0.0 762 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
A9VFM1 0.0 760 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
B7HWG1 0.0 757 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
A0RA13 0.0 756 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
B7HDF9 0.0 756 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
Q6HN78 0.0 756 56 6 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7II09 0.0 756 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
C3LF99 0.0 754 57 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q81HQ0 0.0 753 56 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7JRB8 0.0 753 56 6 682 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
Q63FR0 0.0 749 56 5 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
O32328 0.0 748 55 6 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8R8I6 0.0 744 56 6 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GLG4 0.0 741 56 6 681 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q4LAI2 0.0 739 55 5 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q8YPE9 0.0 735 57 8 687 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9R6X1 0.0 734 56 8 687 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q5HK64 0.0 733 55 5 679 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 0.0 733 55 5 679 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 0.0 733 55 5 679 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 0.0 733 55 5 679 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8YSD5 0.0 727 56 8 690 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q926K7 0.0 724 55 7 685 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B4U8E4 0.0 715 55 6 683 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
P73867 0.0 708 58 9 686 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8PCM1 0.0 696 58 3 677 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PPC9 0.0 688 57 3 669 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q6GEZ7 0.0 678 54 4 676 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
P63684 0.0 676 53 4 676 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 0.0 676 53 4 676 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUH7 0.0 674 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NVI2 0.0 672 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 0.0 672 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
A8Z4X9 0.0 672 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 0.0 672 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 0.0 672 53 4 676 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
P57699 0.0 656 49 10 711 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 0.0 656 49 10 711 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q8Z8E5 0.0 645 86 0 392 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 1.48e-75 256 68 0 179 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P57700 0.0 578 45 9 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q97BF6 0.0 574 44 10 668 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P9WPS3 8.2e-55 203 31 13 548 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 8.2e-55 203 31 13 548 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32220 1.5e-54 203 33 15 491 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
O30085 3.12e-51 192 31 20 542 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P58341 2.4e-50 191 28 17 610 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58342 9.69e-50 189 29 12 531 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
Q8CN02 6.72e-49 187 31 14 485 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 6.72e-49 187 31 14 485 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9X5X3 8.52e-49 187 29 22 601 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q7A3E6 1.19e-48 186 29 13 495 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 1.19e-48 186 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 1.19e-48 186 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 1.19e-48 186 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 1.19e-48 186 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDP1 2.63e-48 185 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A6QK47 3.34e-48 185 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 3.34e-48 185 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 3.34e-48 185 29 13 495 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
A8Z3F8 3.6e-48 185 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 3.6e-48 185 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
P32113 4.1e-48 184 30 17 511 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q8NUQ9 8.7e-48 184 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 8.7e-48 184 29 13 495 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q4A0G1 9.63e-48 183 30 17 506 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YWA3 9.93e-48 183 29 13 492 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
O29777 2.52e-47 182 29 10 492 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9S7J8 4.78e-46 179 29 15 561 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q9ZHC7 5.68e-46 179 30 12 500 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q4L970 7.01e-46 178 28 11 494 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
A3AWA4 1.72e-45 178 26 11 547 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9KPZ7 3.8e-45 177 30 14 492 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0P0X004 9.02e-45 176 27 16 586 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A8YZ02 1.8e-44 172 28 16 507 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.8e-44 172 28 16 507 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
P77871 3e-44 173 27 15 495 3 copA Copper-transporting ATPase Helicobacter pylori
O31688 6.62e-44 171 28 8 478 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q8CQF7 1.4e-43 170 27 14 509 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKB0 1.45e-43 170 28 16 503 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O08462 5.69e-43 169 27 16 498 3 copA Copper-transporting ATPase Helicobacter pylori
Q4LAB1 1.27e-42 167 28 16 503 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
O32619 5.6e-42 166 26 15 535 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
P55989 9.88e-42 165 26 14 494 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
P37386 6.54e-41 163 29 12 495 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
Q6GIX1 6.75e-41 162 29 12 491 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
Q69HU0 8.56e-41 162 26 16 531 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
P37279 9.09e-41 162 27 16 543 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9SH30 1.12e-40 163 27 13 544 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q6GIX4 1.14e-40 161 26 16 529 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
Q59467 1.25e-40 162 26 15 503 3 copA Copper-transporting ATPase Helicobacter pylori
Q9ZM69 1.27e-40 162 27 16 490 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q5ZWR1 4.6e-40 160 29 12 475 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P20021 1.41e-39 159 28 14 538 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P73241 3.12e-39 158 28 23 627 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P30336 3.25e-39 157 29 14 491 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9CCL1 4.56e-39 157 28 16 514 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
P05425 9.26e-39 156 27 13 470 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q8Z8S4 3.81e-38 155 27 18 562 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q59385 4.71e-38 155 27 18 562 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
P37617 8.29e-38 153 29 14 532 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q3YW59 1.04e-37 153 29 14 532 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
Q9X5V3 1.1e-37 154 27 16 619 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
Q64430 1.32e-37 154 26 14 550 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q04656 1.44e-37 154 27 13 503 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
P58414 1.65e-37 152 27 16 523 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q64446 1.78e-37 154 27 12 513 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q8ZR95 1.83e-37 153 27 18 562 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B9DFX7 1.86e-37 153 28 17 522 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
Q6H7M3 2.21e-37 153 26 17 542 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q8XD24 2.39e-37 152 27 18 562 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
B2HEM2 2.54e-37 152 28 18 532 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
P70705 4.25e-37 152 26 14 550 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P9WPT5 4.99e-37 151 28 19 545 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 4.99e-37 151 28 19 545 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 4.99e-37 151 28 19 545 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q64535 5.62e-37 152 27 12 500 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q8ZCA7 5.91e-37 152 29 18 533 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q9CFU9 7.2e-37 151 26 25 666 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
P35670 8.6e-37 152 27 12 510 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P9WPU1 1.67e-36 150 29 14 527 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 1.67e-36 150 29 14 527 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9XT50 4.29e-36 149 27 11 506 2 ATP7B Copper-transporting ATPase 2 Ovis aries
A0R3A7 1.22e-35 146 32 13 434 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WPT7 1.59e-35 146 32 16 480 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 1.59e-35 146 32 16 480 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P49015 2.03e-35 147 27 14 503 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
O32219 4.65e-35 145 27 13 493 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
Q73E41 1.18e-34 144 24 18 631 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P46840 2.03e-34 143 29 12 478 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q60048 1.81e-33 140 27 15 498 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
O59666 2.16e-33 140 24 13 506 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8Y8Q5 2.48e-33 140 25 20 599 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P37278 2.69e-32 137 26 18 672 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q59998 2.65e-31 134 27 18 518 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q59465 1.33e-30 131 24 14 519 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9SZW4 5.13e-30 130 28 14 464 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
Q9RQB4 5.77e-30 129 25 14 520 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
P13586 6.56e-30 130 24 22 691 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O64474 9.5e-30 129 29 18 456 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
P78036 1.23e-29 129 23 18 627 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9SZC9 1.48e-29 129 27 14 501 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
P54679 1.62e-29 129 24 14 557 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
P9WPT9 1.65e-29 128 28 15 489 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT8 1.82e-29 128 28 15 489 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 1.82e-29 128 28 15 489 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P57709 2.9e-29 128 22 18 689 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P46839 3.87e-29 127 29 10 470 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q9ZL53 7.02e-29 126 24 15 523 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q64566 8.18e-29 126 23 21 692 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P98194 1.03e-28 126 22 20 692 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q58623 1.51e-28 125 24 11 523 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5R5K5 2.03e-28 125 22 20 691 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q43128 2.83e-28 125 23 13 526 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
Q80XR2 5.02e-28 124 24 17 601 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
P12522 8.13e-28 123 25 17 560 2 H1B Probable proton ATPase 1B Leishmania donovani
P47317 9.51e-28 123 24 16 569 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P11718 1.32e-27 122 24 17 555 2 H1A Probable proton ATPase 1A Leishmania donovani
P35597 1.51e-27 122 25 20 581 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9LV11 1.57e-27 122 24 17 526 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9SU58 4.22e-27 121 24 15 529 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q08436 5.62e-27 120 23 16 526 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P18398 7.82e-27 120 25 13 483 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P83970 1.48e-26 119 23 17 526 2 ha1 Plasma membrane ATPase Triticum aestivum
A7L9Z8 3.1e-26 118 23 23 687 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
Q9LY32 6.63e-26 117 24 16 529 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
P22180 9.7e-26 117 23 17 526 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q08435 1.04e-25 117 23 16 526 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P77868 1.43e-25 115 24 10 497 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9SH76 1.47e-25 116 23 15 528 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q7XPY2 1.62e-25 116 23 17 530 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P9WPT3 2e-25 115 28 14 463 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 2e-25 115 28 14 463 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 2e-25 115 28 14 463 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q03194 2.36e-25 115 24 17 548 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
A3BF39 2.91e-25 115 26 14 489 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
P0CW78 3.32e-25 115 24 13 466 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
P20649 3.91e-25 115 24 18 540 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P19456 3.97e-25 115 23 16 536 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
Q9SJB3 6.66e-25 114 22 17 536 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P9WPS9 9.44e-25 114 27 22 635 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 9.44e-25 114 27 22 635 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 9.44e-25 114 27 22 635 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P38995 1.44e-24 113 26 17 506 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O75185 2.57e-24 112 24 18 606 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q8R4C1 2.75e-24 112 23 22 682 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
P07038 3.53e-24 112 23 12 518 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q42556 5.94e-24 111 22 16 530 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
Q9LIK7 2.18e-23 109 22 19 622 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9M2A0 2.19e-23 109 22 15 531 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
P20431 2.84e-23 109 23 14 537 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
O43108 5.09e-23 108 25 23 649 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P37367 6.18e-23 108 25 23 665 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P05030 7.79e-23 107 25 19 525 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P37385 9.39e-23 107 25 14 472 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O33533 2.11e-22 106 25 11 440 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
P54211 2.98e-22 106 25 20 573 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
Q92123 5.91e-22 105 21 21 711 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
C1L360 1.66e-21 103 21 18 657 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
P07893 1.84e-21 103 25 14 472 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P35317 3.22e-21 102 22 21 630 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P19657 1.05e-20 100 23 17 526 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28877 2.17e-20 100 24 18 537 1 PMA1 Plasma membrane ATPase 1 Candida albicans
P09627 2.5e-20 99 24 16 537 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7X8B5 3.06e-20 99 22 21 644 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q7XB51 7.49e-20 98 22 20 649 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q07421 8.71e-20 98 24 14 518 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P38360 1.91e-19 97 25 14 476 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9QMJ0 2.31e-19 97 33 6 220 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
P92939 2.4e-19 96 28 4 259 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P0ABB8 2.43e-19 96 23 21 650 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 2.43e-19 96 23 21 650 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P24545 2.77e-19 96 23 14 533 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
Q9XES1 6.72e-19 95 27 4 259 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
O34431 1.06e-18 94 31 5 197 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 1.25e-06 55 25 8 283 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q37145 1.59e-18 94 33 4 177 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
P54210 1.85e-18 94 24 22 612 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
Q2QMX9 2.2e-18 93 34 5 194 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q9SZR1 2.69e-18 93 28 2 203 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
P36640 2.82e-18 93 22 17 615 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 2.82e-18 93 22 17 615 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q9LU41 3.09e-18 93 29 2 207 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
P22036 3.91e-18 92 24 19 614 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LF79 3.97e-18 92 30 3 191 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q6ATV4 9.3e-18 91 31 9 242 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q9M2L4 1.04e-17 91 31 4 193 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2L4 0.001 46 20 8 301 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
P49380 1.09e-17 91 24 15 523 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O64806 1.28e-17 91 32 4 175 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O81108 1.77e-17 90 32 4 175 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
Q65X71 1.94e-17 90 22 25 592 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P54678 2.08e-17 90 23 20 588 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
Q9M3H5 3.8e-17 89 24 16 464 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
P54209 4.55e-17 89 30 2 195 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
O22218 6.03e-17 89 30 4 193 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 0.000181 48 21 10 302 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q9LY77 9.14e-17 88 30 2 180 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
P28876 1.23e-16 88 24 16 543 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O53114 1.36e-16 88 24 18 580 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
Q4WHC8 1.37e-16 87 29 2 177 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0R3Y2 1.6e-16 87 24 19 564 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q42883 1.63e-16 87 29 3 189 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q59207 2e-16 87 25 15 504 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8RUN1 2.74e-16 87 32 5 194 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
A0A143ZZK9 3.64e-16 86 28 3 216 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
O23087 5.63e-16 85 29 3 189 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
Q7XEK4 5.88e-16 85 31 3 180 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 0.0003 48 25 6 215 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q9SY55 7.4e-16 85 27 1 186 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9T0E0 8.51e-16 85 22 13 483 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
O59868 8.95e-16 85 30 5 204 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 5.55e-10 66 27 4 215 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23980 1.38e-15 84 24 12 381 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
O77696 1.48e-15 84 29 2 183 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
P35315 1.59e-15 84 28 1 183 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P9WPS7 1.91e-15 84 28 15 465 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.91e-15 84 28 15 465 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.91e-15 84 28 15 465 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9HDW7 2.19e-15 84 31 2 187 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38929 2.95e-15 83 29 8 230 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WND5 4.34e-15 83 29 2 184 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P35316 5.42e-15 82 29 2 183 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P22700 5.71e-15 82 28 2 183 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q292Q0 6.22e-15 82 28 2 183 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q7PPA5 6.77e-15 82 28 2 183 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q2RAS0 1.6e-14 81 32 4 175 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q64578 2.43e-14 80 28 2 183 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q8R429 2.63e-14 80 28 2 183 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
O14983 2.66e-14 80 28 2 183 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
P04191 2.78e-14 80 28 2 183 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
Q9YGL9 2.94e-14 80 27 2 183 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 2.1e-05 51 26 6 231 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q2QY12 3.08e-14 80 31 4 176 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
P17326 3.23e-14 80 27 3 183 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 8.12e-06 53 26 10 295 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P20647 3.27e-14 80 28 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
Q93084 3.5e-14 80 28 2 183 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
J9VQQ3 3.82e-14 80 27 2 184 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P16615 4.82e-14 79 27 3 193 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P30714 5.12e-14 79 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 7.15e-09 63 26 14 293 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
Q0VCY0 5.69e-14 79 28 2 183 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
P70083 7.19e-14 79 27 3 204 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 7.87e-05 50 25 6 288 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
O55143 1.02e-13 78 27 3 193 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
Q03669 1.03e-13 78 27 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P11607 1.03e-13 78 27 3 193 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11507 1.04e-13 78 27 3 193 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
O46674 1.08e-13 78 27 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q00779 1.16e-13 78 27 3 193 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q64518 1.41e-13 78 27 2 183 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P18596 1.46e-13 78 27 2 183 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
Q92105 2.18e-13 77 27 2 183 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q9N0Z6 2.26e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 1.49e-07 58 25 13 297 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P28774 2.34e-13 77 25 3 203 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 4.67e-08 60 28 14 299 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q5RDR3 2.53e-13 77 25 3 201 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 1.57e-06 55 24 13 297 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P05023 2.8e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 1.43e-06 55 24 13 297 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
Q08DA1 3.13e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 2.57e-07 58 25 13 297 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P18907 3.16e-13 77 25 3 201 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 2.87e-07 57 25 13 297 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
Q9YH26 3.22e-13 77 25 3 201 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 2.97e-07 57 25 10 289 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P04074 3.3e-13 77 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 2.5e-07 58 25 13 297 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P13585 3.52e-13 77 27 2 183 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P23634 3.87e-13 77 29 4 192 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
Q64392 4.11e-13 76 26 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 4.68e-10 67 27 13 302 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q92126 5e-13 76 27 4 211 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 1.03e-09 65 27 7 213 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
D3K0R6 5.17e-13 76 29 4 192 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P06685 5.48e-13 76 25 3 201 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 1.29e-07 58 26 15 297 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
Q8VDN2 5.77e-13 76 25 3 201 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 1.31e-07 58 26 15 297 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q9TV52 5.87e-13 76 25 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 4.22e-12 73 29 8 219 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P13607 6.01e-13 76 25 3 203 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 7.68e-08 59 25 10 295 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P05025 6.02e-13 76 25 3 201 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 1.82e-08 61 25 10 288 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P54707 6.11e-13 76 26 3 201 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 3.56e-11 70 29 8 219 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54708 7.31e-13 75 25 3 201 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 2.75e-10 67 27 6 211 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P09572 8.05e-13 75 25 3 206 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 6.73e-09 63 27 15 300 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
Q92030 8.34e-13 75 25 3 201 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 4.23e-08 60 26 10 289 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q9Z1W8 9.61e-13 75 25 3 201 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 3.47e-09 63 28 9 221 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q5RCD8 1.01e-12 75 24 3 206 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 6.71e-08 59 24 11 289 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q9WV27 1.1e-12 75 25 3 200 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 9.67e-09 62 27 12 292 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q6Q477 1.19e-12 75 28 4 189 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
P06686 1.2e-12 75 24 3 206 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 3.03e-08 60 24 11 289 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 1.2e-12 75 24 3 206 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 3.03e-08 60 24 11 289 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
P58312 1.23e-12 75 25 4 212 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 7.05e-08 59 24 9 289 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P50996 1.24e-12 75 26 3 200 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 2.6e-12 74 28 7 221 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
Q64436 1.32e-12 75 26 3 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 5.05e-11 70 28 7 213 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
P09626 1.33e-12 75 26 3 200 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 5.22e-11 70 28 7 213 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P27112 1.34e-12 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 1.5e-11 71 29 7 213 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P19156 1.35e-12 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 8.27e-12 72 29 7 213 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P50993 1.36e-12 75 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 1.23e-07 58 24 11 289 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P20648 1.4e-12 75 26 3 200 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 2.09e-11 71 28 6 213 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P25489 1.65e-12 74 25 4 212 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 4.37e-07 57 25 10 290 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q92036 1.65e-12 74 25 3 201 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 1.07e-06 55 27 10 250 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
P06687 1.75e-12 74 24 3 201 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 1.02e-08 62 25 10 288 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 1.75e-12 74 24 3 201 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 1.02e-08 62 25 10 288 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 1.75e-12 74 24 3 201 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 1.01e-08 62 25 10 288 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P05024 1.92e-12 74 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 2.5e-07 58 25 13 297 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
Q6RWA9 2.65e-12 73 26 4 201 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 0.000431 47 28 8 205 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q64568 2.96e-12 73 28 4 189 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
P9WPT0 3.01e-12 73 23 11 471 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q64542 3.04e-12 73 28 4 189 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
P9WPT1 3.12e-12 73 23 11 471 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 3.12e-12 73 23 11 471 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q16720 3.19e-12 73 28 4 189 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
P11505 3.27e-12 73 28 4 189 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
D2WKD8 3.29e-12 73 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 1.35e-07 58 24 11 289 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
Q64541 3.41e-12 73 25 3 200 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 2.1e-08 61 24 8 291 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
O13397 3.42e-12 73 29 3 167 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
G5E829 3.48e-12 73 28 4 189 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
A2VDL6 3.61e-12 73 24 3 206 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 2.13e-07 58 24 11 289 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
P24797 4.1e-12 73 24 3 201 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 7.89e-08 59 24 11 289 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24798 4.38e-12 73 24 3 201 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 6.64e-08 59 25 10 288 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
Q8H384 6.06e-12 72 26 18 539 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q9R0K7 6.29e-12 72 27 4 195 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q01814 6.7e-12 72 27 4 195 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
P11506 6.88e-12 72 27 4 195 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
P50997 9.05e-12 72 25 3 201 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 3.5e-07 57 24 13 298 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
O13398 1.06e-11 72 28 3 166 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P23220 1.64e-11 71 27 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P20020 1.75e-11 71 27 4 189 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
Q08853 3.45e-11 70 28 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 6.05e-06 53 23 9 255 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
G5EFR6 3.72e-11 70 25 4 212 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
Q12691 3.78e-11 70 29 3 167 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 3.78e-11 70 29 3 167 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q13733 4.79e-11 70 26 4 201 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 1.56e-06 55 27 8 198 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q98SH2 6.3e-11 69 27 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
P22189 9.05e-11 69 30 3 146 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q58378 1.06e-10 66 32 2 119 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P13587 1.16e-10 68 28 3 167 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9NQ11 2.24e-10 67 25 12 291 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
Q9EPE9 3.12e-10 67 21 16 523 1 Atp13a1 Endoplasmic reticulum transmembrane helix translocase Mus musculus
Q9HD20 5.39e-10 66 21 16 518 1 ATP13A1 Endoplasmic reticulum transmembrane helix translocase Homo sapiens
Q00804 2.27e-09 64 25 4 189 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
P0CW77 2.47e-09 63 25 6 229 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q9CTG6 3.36e-09 64 25 13 290 2 Atp13a2 Polyamine-transporting ATPase 13A2 Mus musculus
P58165 3.67e-09 63 26 4 186 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P9WPS4 5.05e-09 63 26 3 191 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS5 5.94e-09 63 26 3 191 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O14022 3.2e-08 60 28 10 247 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q21286 2.32e-07 58 22 9 288 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
O14072 3.16e-06 54 19 16 511 1 cta4 Endoplasmic reticulum transmembrane helix translocase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P90747 4.77e-06 53 22 8 295 3 catp-8 Probable manganese-transporting ATPase catp-8 Caenorhabditis elegans
Q12697 1.29e-05 52 22 8 257 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5XF89 0.00015 48 32 1 78 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
Q9H7F0 0.000184 48 22 7 253 1 ATP13A3 Polyamine-transporting ATPase 13A3 Homo sapiens
Q95JN5 0.000191 48 22 7 253 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11465
Feature type CDS
Gene kdpB
Product potassium-transporting ATPase subunit KdpB
Location 435659 - 437707 (strand: 1)
Length 2049 (nucleotides) / 682 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2626
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2216 Inorganic ion transport and metabolism (P) P K+ transport ATPase, ATPase subunit KdpB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01547 potassium-transporting ATPase ATP-binding subunit [EC:7.2.2.6] Two-component system -

Protein Sequence

MSRQTQRLFEPKLVKQALPETFRKLSPVVQWQNPVMFIVWCGSLLTTLLAAGMMTGLFSGNGAFTLTIALWLWFTVLFANFAEALAEGRSRAQADSLKGMKKTSRARKLRSAERDSEYETVAADTLRKGDLVLVEAGDLIPCDATVLEGGASVDESAITGESAPVIRESGGDFSSVTGGTRILSDWLIIECSANPGDSFLDRMISMVEGAKRSKTPNEIALTILLSALSIVFLLAVATLWPFTEFAGHAVSLTVMIALLVCLIPTTISGLLSAIGVAGMSRMLAANVIATSGRAVEAAGDVDVLLLDKTGTITLGNRQASDFLAAPGVDERTLADAAQLASLADETPEGRSIVVLAKQRFNMRARDLAGLKATFIPFTAQTRMSGINVDGRTIRKGSVDAIRRYIEVNHGQFPAQVDKLVEEVARQGGTPLVVAEEHRVLGVIALKDIVKGGIRERFAQLRQMGIKTVMITGDNRLTAAAIAAEAGVDDFLAQATPEAKLALIRQYQKEGRLVAMTGDGTNDAPALAQADVAVAMNSGTQAAKEAGNMVDLDSNPTKLIEVVHIGKQMLMTRGSLTTFSIANDIAKYFAIIPAAFAVTYPQLDALNIMRLHSPDSAILSAVIFNALIIIALIPLALKGVPYHALSAAAMLRRNLWIYGTGGLIVPFIGIKLIDMLLTLTGLV

Flanking regions ( +/- flanking 50bp)

TCCGGTGGCGGAATTTCTGGCTGTATTTAAGTGATTGACGGGAGAAGACAATGAGTCGTCAGACACAGCGTTTATTTGAACCAAAACTGGTGAAACAGGCGTTACCGGAGACATTCAGAAAACTATCCCCGGTGGTGCAGTGGCAGAATCCGGTGATGTTTATTGTCTGGTGCGGCAGTCTGTTAACCACACTGCTTGCCGCCGGTATGATGACCGGGCTTTTCAGCGGCAACGGGGCATTCACACTGACTATCGCCCTGTGGTTATGGTTTACCGTGTTGTTTGCGAATTTTGCGGAAGCGCTGGCGGAAGGGCGCAGCAGAGCACAGGCTGACAGCCTGAAAGGCATGAAAAAAACCAGCCGGGCACGAAAGCTGCGTTCCGCTGAGCGCGACAGTGAATATGAAACTGTCGCGGCAGATACGTTACGCAAAGGGGATTTGGTGCTGGTGGAAGCCGGTGATTTGATCCCGTGCGACGCTACGGTACTGGAGGGCGGCGCATCCGTGGATGAGAGTGCGATCACCGGTGAATCTGCGCCGGTGATCCGCGAGTCCGGCGGGGATTTTTCTTCTGTCACCGGTGGTACGCGGATCTTATCGGACTGGTTGATCATTGAGTGCAGCGCAAACCCGGGAGACAGTTTTCTGGATCGCATGATAAGCATGGTGGAAGGCGCGAAGCGCAGTAAAACGCCGAATGAAATCGCTCTGACTATTCTGCTGTCGGCACTGAGTATTGTCTTTTTGCTGGCGGTGGCAACATTGTGGCCGTTTACTGAATTTGCCGGTCATGCCGTCAGTCTGACAGTGATGATTGCGCTGCTGGTGTGTCTGATCCCGACCACGATCAGCGGGCTGTTATCTGCCATTGGTGTGGCGGGTATGAGCCGGATGCTGGCGGCGAATGTGATTGCCACCAGCGGGCGCGCTGTGGAAGCCGCCGGGGATGTGGATGTGCTGCTGCTGGATAAAACCGGGACCATTACCCTGGGAAACCGCCAGGCGTCAGACTTTCTGGCAGCACCGGGTGTGGATGAACGCACACTGGCGGATGCGGCACAACTGGCATCGCTGGCAGATGAAACCCCGGAAGGGCGCAGTATTGTGGTACTGGCAAAGCAGCGTTTTAATATGCGGGCGCGTGATCTTGCCGGTCTGAAAGCCACCTTTATTCCGTTTACCGCACAAACGCGCATGAGCGGGATCAATGTGGACGGACGAACTATCCGCAAGGGCTCTGTGGATGCTATCCGCCGCTATATCGAGGTCAATCACGGTCAATTCCCGGCGCAGGTCGACAAACTGGTGGAAGAGGTTGCCCGCCAGGGCGGTACGCCACTGGTGGTGGCAGAAGAGCACCGTGTGCTGGGTGTTATCGCGCTGAAAGATATCGTCAAAGGCGGGATCCGCGAACGCTTTGCGCAATTACGCCAGATGGGGATCAAAACGGTGATGATCACCGGTGATAACCGGCTGACAGCGGCGGCGATTGCGGCAGAAGCAGGTGTTGATGATTTTCTTGCGCAGGCGACGCCGGAAGCTAAACTGGCGCTGATCCGCCAATATCAGAAAGAAGGGCGGCTGGTGGCAATGACCGGGGACGGCACCAATGATGCCCCGGCACTGGCGCAGGCAGATGTGGCGGTTGCCATGAACTCGGGAACACAGGCGGCAAAAGAAGCCGGTAATATGGTGGATCTGGACTCCAACCCGACCAAACTGATTGAAGTGGTTCATATTGGTAAGCAGATGCTGATGACGCGCGGCTCGCTGACAACATTCAGTATTGCCAATGATATCGCCAAGTATTTTGCGATTATCCCGGCGGCATTTGCGGTGACTTATCCGCAACTGGATGCGCTCAATATTATGCGTCTGCATTCGCCGGATTCAGCCATATTAAGCGCGGTGATATTCAATGCCCTGATTATTATTGCGCTGATCCCGCTGGCACTGAAAGGTGTGCCGTATCATGCCCTGAGTGCAGCGGCAATGCTGCGCCGCAATCTGTGGATCTATGGAACGGGCGGATTAATCGTGCCTTTTATCGGTATTAAATTGATTGATATGTTGCTGACCCTGACAGGGTTAGTATAAGGATATGCAATGAGTCAGATACGTCCTGCAATCGTTATTTTTCTGGTTCT