Homologs in group_3226

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03445 FBDBKF_03445 100.0 Morganella morganii S1 - K(+)-transporting ATPase subunit F
EHELCC_07090 EHELCC_07090 100.0 Morganella morganii S2 - K(+)-transporting ATPase subunit F
LHKJJB_06950 LHKJJB_06950 100.0 Morganella morganii S3 - K(+)-transporting ATPase subunit F
HKOGLL_03980 HKOGLL_03980 100.0 Morganella morganii S5 - K(+)-transporting ATPase subunit F

Distribution of the homologs in the orthogroup group_3226

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3226

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07415
Feature type CDS
Gene -
Product K(+)-transporting ATPase subunit F
Location 150720 - 150809 (strand: 1)
Length 90 (nucleotides) / 29 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3226
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF09604 F subunit of K+-transporting ATPase (Potass_KdpF)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01545 potassium-transporting ATPase KdpF subunit Two-component system -

Protein Sequence

MSLALIAGIAGTLLLLAYLLYALINAEKF

Flanking regions ( +/- flanking 50bp)

CCGTTTTTCTAGACTCAATGATGAATACCTCACACATGTAAGGACAAGTTATGAGTCTGGCTCTTATTGCAGGCATCGCCGGTACATTACTGCTGCTGGCATACCTCCTTTATGCCCTGATTAATGCGGAGAAATTCTGATGGCCGCGAATGCCTTTTTACTTATCGCCGGGTTTCTGATTGTTTTGCTG