Homologs in group_2628

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03445 FBDBKF_03445 100.0 Morganella morganii S1 - K(+)-transporting ATPase subunit F
EHELCC_07090 EHELCC_07090 100.0 Morganella morganii S2 - K(+)-transporting ATPase subunit F
NLDBIP_07415 NLDBIP_07415 100.0 Morganella morganii S4 - K(+)-transporting ATPase subunit F
HKOGLL_03980 HKOGLL_03980 100.0 Morganella morganii S5 - K(+)-transporting ATPase subunit F
F4V73_RS11455 F4V73_RS11455 86.2 Morganella psychrotolerans kdpF K(+)-transporting ATPase subunit F

Distribution of the homologs in the orthogroup group_2628

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2628

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_06950
Feature type CDS
Gene -
Product K(+)-transporting ATPase subunit F
Location 114466 - 114555 (strand: 1)
Length 90 (nucleotides) / 29 (amino acids)
In genomic island -

Contig

Accession ZDB_363
Length 233386 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2628
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF09604 F subunit of K+-transporting ATPase (Potass_KdpF)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01545 potassium-transporting ATPase KdpF subunit Two-component system -

Protein Sequence

MSLALIAGIAGTLLLLAYLLYALINAEKF

Flanking regions ( +/- flanking 50bp)

CCGTTTTTCTAGACTCAATGATGAATACCTCACACATGTAAGGACAAGTTATGAGTCTGGCTCTTATTGCAGGCATCGCCGGTACATTACTGCTGCTGGCATACCTCCTTTATGCCCTGATTAATGCGGAGAAATTCTGATGGCCGCGAATGCCTTTTTACTTATCGCCGGGTTTCTGATTGTTTTGCTG