Homologs in group_2686

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04635 FBDBKF_04635 100.0 Morganella morganii S1 mtnK S-methyl-5-thioribose kinase
EHELCC_05925 EHELCC_05925 100.0 Morganella morganii S2 mtnK S-methyl-5-thioribose kinase
LHKJJB_03125 LHKJJB_03125 100.0 Morganella morganii S3 mtnK S-methyl-5-thioribose kinase
HKOGLL_06600 HKOGLL_06600 100.0 Morganella morganii S5 mtnK S-methyl-5-thioribose kinase
F4V73_RS09085 F4V73_RS09085 84.8 Morganella psychrotolerans mtnK S-methyl-5-thioribose kinase

Distribution of the homologs in the orthogroup group_2686

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2686

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B7MMH5 0.0 534 60 2 415 1 mtnK Methylthioribose kinase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q7XR61 3.09e-111 336 42 3 409 1 MTK1 Methylthioribose kinase 1 Oryza sativa subsp. japonica
Q9C6D2 3.04e-110 333 43 4 410 1 MTK Methylthioribose kinase Arabidopsis thaliana
Q7XR60 1.02e-106 325 41 3 409 2 MTK2 Methylthioribose kinase 2 Oryza sativa subsp. japonica
C5D7U6 4.38e-84 265 38 8 421 3 mtnK Methylthioribose kinase Geobacillus sp. (strain WCH70)
Q5L1E5 8.19e-84 265 39 10 417 3 mtnK Methylthioribose kinase Geobacillus kaustophilus (strain HTA426)
B1JIK2 6.6e-83 263 40 8 386 3 mtnK Methylthioribose kinase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLL0 1e-82 262 39 7 385 3 mtnK Methylthioribose kinase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPM8 1.96e-82 261 39 7 385 3 mtnK Methylthioribose kinase Yersinia pestis (strain Pestoides F)
A9R2Z4 1.96e-82 261 39 7 385 3 mtnK Methylthioribose kinase Yersinia pestis bv. Antiqua (strain Angola)
A4ILL2 3.11e-82 261 40 11 401 3 mtnK Methylthioribose kinase Geobacillus thermodenitrificans (strain NG80-2)
Q66E15 4.24e-82 261 39 7 385 3 mtnK Methylthioribose kinase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K634 4.24e-82 261 39 7 385 3 mtnK Methylthioribose kinase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JP08 1.28e-79 254 39 6 379 3 mtnK Methylthioribose kinase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q6D1H0 1.3e-78 251 38 9 389 3 mtnK Methylthioribose kinase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4W7Z0 5.17e-78 250 38 7 370 3 mtnK Methylthioribose kinase Enterobacter sp. (strain 638)
C6DCZ0 5.61e-78 249 38 7 382 3 mtnK Methylthioribose kinase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7GS57 5.81e-78 249 35 7 380 3 mtnK Methylthioribose kinase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q731R6 6.13e-78 249 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1EQQ8 1.53e-77 248 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain 03BB102)
B9IWP6 2.53e-77 248 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain Q1)
B7HN10 2.53e-77 248 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain AH187)
Q81MJ5 1.1e-76 246 37 7 376 3 mtnK Methylthioribose kinase Bacillus anthracis
A0RI39 1.1e-76 246 37 7 376 3 mtnK Methylthioribose kinase Bacillus thuringiensis (strain Al Hakam)
C3LIA3 1.1e-76 246 37 7 376 3 mtnK Methylthioribose kinase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P742 1.1e-76 246 37 7 376 3 mtnK Methylthioribose kinase Bacillus anthracis (strain A0248)
A8ANI4 1.88e-76 246 37 7 384 3 mtnK Methylthioribose kinase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7H924 2.65e-76 245 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain B4264)
B7IWE5 2.65e-76 245 36 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain G9842)
Q819F1 2.92e-76 245 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A9VFD6 4.46e-76 244 37 7 376 3 mtnK Methylthioribose kinase Bacillus mycoides (strain KBAB4)
B5XZW3 5.44e-76 244 38 6 373 3 mtnK Methylthioribose kinase Klebsiella pneumoniae (strain 342)
Q635P6 5.93e-76 244 36 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain ZK / E33L)
Q9F0P1 1.31e-75 244 38 6 373 1 mtnK Methylthioribose kinase Klebsiella pneumoniae
A6T655 1.31e-75 244 38 6 373 3 mtnK Methylthioribose kinase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8GAB2 4.26e-75 242 38 5 368 3 mtnK Methylthioribose kinase Serratia proteamaculans (strain 568)
A7MKY0 7.21e-75 242 37 7 375 3 mtnK Methylthioribose kinase Cronobacter sakazakii (strain ATCC BAA-894)
B2VIQ9 9.03e-75 241 38 7 381 3 mtnK Methylthioribose kinase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6HED2 1.84e-74 240 36 7 376 3 mtnK Methylthioribose kinase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B1YIY3 2.26e-74 240 37 8 388 3 mtnK Methylthioribose kinase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B7JL13 3.57e-73 237 37 7 376 3 mtnK Methylthioribose kinase Bacillus cereus (strain AH820)
O31663 1.54e-72 236 35 8 380 1 mtnK Methylthioribose kinase Bacillus subtilis (strain 168)
P0DTQ2 1.23e-71 234 36 7 376 1 drdK 5-deoxyribose kinase Bacillus thuringiensis serovar kurstaki (strain ATCC 35866 / NRRL B-4488 / HD73)
A8FCG6 7.81e-71 231 36 8 371 3 mtnK Methylthioribose kinase Bacillus pumilus (strain SAFR-032)
Q65KK1 1.56e-68 225 34 12 422 3 mtnK Methylthioribose kinase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7Z3X1 8.06e-65 215 34 7 377 3 mtnK Methylthioribose kinase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_06245
Feature type CDS
Gene mtnK
Product S-methyl-5-thioribose kinase
Location 226901 - 228166 (strand: 1)
Length 1266 (nucleotides) / 421 (amino acids)
In genomic island -

Contig

Accession ZDB_521
Length 325332 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2686
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01636 Phosphotransferase enzyme family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4857 Amino acid transport and metabolism (E) E 5-Methylthioribose/5-deoxyribose kinase, methionine salvage pathway

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00899 5-methylthioribose kinase [EC:2.7.1.100] Cysteine and methionine metabolism
Metabolic pathways
Methionine salvage pathway

Protein Sequence

MTQKTPAGYTPLTCGTLPAYLSAHLPDDILPGGTPESWQTEEVGDGNLNLVFIVRGSERTLVVKQSLPYVRAAGESWELSLQRNYFEYHALSQEKRFAPDSVPDVYFYDEAMALFAMEYLADHIILRKALIAGEYVPHLAEKIGLFMAQTLFHTSDIGMAAQEKKALTAQFSANHELCKITEDLIFTEPYFPAPRNNHTSPQLDRDAKAVMLDREMVQVAMRYKYKFMTQSQALLHGDLHSGSVMIGTDSVQVIDPEFSFMGPMAFDTGNYAGNLYMAWFSQPGHRKTEEETARYQQWLLSQISQTWNTFETEFRRLWAEKSQGDAWPRELYQDGLFDDKFLKAAQDSFFAELFQDTLVNAGLEINRRLLGFAGVADFKTIADADKRAALERKALKLARELIVNARHYHSFADVEAFLSYC

Flanking regions ( +/- flanking 50bp)

AGTTATAATTTACATATGTAGCCATTTATCTCTGTTTCTGAGGTTATCTTATGACGCAAAAAACCCCTGCCGGATATACCCCGCTAACCTGTGGCACCCTTCCCGCTTACCTGTCCGCACATTTACCGGATGACATTTTACCAGGCGGCACGCCGGAATCCTGGCAGACAGAGGAAGTCGGTGACGGTAATCTCAATCTGGTGTTTATTGTCAGAGGCAGTGAGCGGACTCTCGTGGTCAAGCAATCACTGCCGTATGTCCGTGCAGCCGGTGAATCCTGGGAACTCTCTTTGCAGCGTAATTATTTCGAATACCATGCGTTGTCACAGGAGAAACGTTTCGCACCTGATAGTGTGCCGGATGTCTATTTCTATGACGAAGCCATGGCGCTGTTTGCCATGGAATACCTCGCTGATCATATCATTCTGCGTAAAGCACTGATTGCAGGAGAATATGTCCCTCATCTGGCGGAGAAAATCGGCCTGTTTATGGCGCAAACTCTGTTCCATACCTCGGATATCGGCATGGCGGCACAGGAGAAAAAAGCCCTGACCGCACAGTTCTCCGCCAACCATGAATTATGCAAAATCACCGAAGATCTGATTTTTACCGAGCCTTACTTCCCGGCGCCGCGCAATAATCACACCTCTCCGCAGCTCGATCGCGATGCAAAAGCCGTGATGCTGGACAGAGAAATGGTGCAGGTCGCGATGCGCTATAAGTACAAATTTATGACACAGTCACAGGCGCTGCTGCACGGGGACTTGCACTCCGGATCCGTCATGATTGGCACTGACTCTGTTCAGGTTATTGATCCTGAATTCAGTTTTATGGGGCCGATGGCGTTTGATACCGGCAACTATGCCGGTAACTTATATATGGCCTGGTTTTCTCAGCCCGGACACCGGAAGACAGAGGAAGAGACCGCGCGCTATCAGCAATGGCTGTTATCGCAGATAAGCCAGACCTGGAATACGTTTGAGACTGAATTCCGCCGCCTGTGGGCCGAAAAATCACAGGGCGATGCCTGGCCGCGTGAGCTGTACCAGGACGGCCTGTTTGATGACAAATTCCTGAAAGCCGCCCAGGACAGCTTCTTCGCAGAACTGTTTCAGGACACGCTGGTCAATGCCGGGCTGGAGATCAACCGCCGCCTGCTCGGGTTTGCCGGTGTTGCTGATTTCAAAACCATTGCTGATGCGGACAAACGCGCGGCACTTGAGCGCAAAGCACTGAAACTGGCGCGGGAACTGATTGTCAACGCGCGCCATTATCACAGCTTTGCCGATGTCGAAGCCTTTCTTTCTTATTGTTAAGCGTCACCTGCACACGAGGTTATATAATGAAAATTAACGGAAAACATTAC