Homologs in group_1534

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09910 FBDBKF_09910 100.0 Morganella morganii S1 glnS glutamine--tRNA ligase
EHELCC_04710 EHELCC_04710 100.0 Morganella morganii S2 glnS glutamine--tRNA ligase
LHKJJB_13920 LHKJJB_13920 100.0 Morganella morganii S3 glnS glutamine--tRNA ligase
HKOGLL_12615 HKOGLL_12615 100.0 Morganella morganii S5 glnS glutamine--tRNA ligase
F4V73_RS00440 F4V73_RS00440 93.0 Morganella psychrotolerans glnS glutamine--tRNA ligase
PMI_RS02660 PMI_RS02660 87.0 Proteus mirabilis HI4320 glnS glutamine--tRNA ligase

Distribution of the homologs in the orthogroup group_1534

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1534

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EV71 0.0 1025 86 1 555 3 glnS Glutamine--tRNA ligase Proteus mirabilis (strain HI4320)
B5XZG7 0.0 1014 85 1 553 3 glnS Glutamine--tRNA ligase Klebsiella pneumoniae (strain 342)
Q7N743 0.0 1011 85 0 552 3 glnS Glutamine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6T6C3 0.0 1010 85 1 552 3 glnS Glutamine--tRNA ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8Z8F8 0.0 1003 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella typhi
Q8ZQX5 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BCC3 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
C0PWA7 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
Q5PCH8 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TB84 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella heidelberg (strain SL476)
B5R651 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWD0 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FNC1 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella dublin (strain CT_02021853)
B5EZC3 0.0 1002 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella agona (strain SL483)
A8AJD6 0.0 1002 84 1 552 3 glnS Glutamine--tRNA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TQ00 0.0 1001 85 1 552 3 glnS Glutamine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B4SYN9 0.0 1000 84 1 552 3 glnS Glutamine--tRNA ligase Salmonella newport (strain SL254)
B2TU51 0.0 999 84 0 552 3 glnS Glutamine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MUG5 0.0 999 84 1 552 3 glnS Glutamine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A4W846 0.0 999 84 1 552 3 glnS Glutamine--tRNA ligase Enterobacter sp. (strain 638)
Q3Z4C0 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Shigella sonnei (strain Ss046)
B7LKT3 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1REN7 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LLC4 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
B6HYN9 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain SE11)
B7N9S6 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P00962 0.0 998 84 0 552 1 glnS Glutamine--tRNA ligase Escherichia coli (strain K12)
B1IY48 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FJW4 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TK03 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8U7 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O1:K1 / APEC
A7ZXU0 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1X6L3 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZWF6 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5J8 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MPI5 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7L9L7 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
B7MFU7 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UKW1 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJ63 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q57RP8 0.0 998 84 1 552 3 glnS Glutamine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
Q66DC5 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNX8 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CKN4 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7G5 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDD9 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pestis
B2K8A4 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C540 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FKU1 0.0 998 85 0 550 3 glnS Glutamine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q324M4 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
B7NMN1 0.0 998 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQM4 0.0 997 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9H8 0.0 997 84 0 552 3 glnS Glutamine--tRNA ligase Escherichia coli O157:H7
B1JG85 0.0 996 84 0 550 3 glnS Glutamine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q83LY4 0.0 996 84 0 552 3 glnS Glutamine--tRNA ligase Shigella flexneri
Q0T6S8 0.0 996 84 0 552 3 glnS Glutamine--tRNA ligase Shigella flexneri serotype 5b (strain 8401)
Q32IQ0 0.0 996 84 0 552 3 glnS Glutamine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
A1JQH0 0.0 994 84 0 550 3 glnS Glutamine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GB43 0.0 993 83 0 552 3 glnS Glutamine--tRNA ligase Serratia proteamaculans (strain 568)
A9MKA7 0.0 993 84 1 552 3 glnS Glutamine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MQT2 0.0 988 84 1 553 3 glnS Glutamine--tRNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
C6DBY6 0.0 974 83 1 550 3 glnS Glutamine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D7J7 0.0 973 83 1 550 3 glnS Glutamine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87RG4 0.0 972 81 1 556 3 glnS Glutamine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MT45 0.0 972 81 1 556 3 glnS Glutamine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q7MMQ4 0.0 970 81 1 556 3 glnS Glutamine--tRNA ligase Vibrio vulnificus (strain YJ016)
C5BGA4 0.0 969 81 1 552 3 glnS Glutamine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
B7VIH6 0.0 967 81 1 555 3 glnS Glutamine--tRNA ligase Vibrio atlanticus (strain LGP32)
B5FC12 0.0 950 79 1 551 3 glnS Glutamine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E6P2 0.0 950 79 1 551 3 glnS Glutamine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B2VBN3 0.0 949 80 1 552 3 glnS Glutamine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C3LTP5 0.0 945 79 1 556 3 glnS Glutamine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTA6 0.0 945 79 1 556 3 glnS Glutamine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2T1 0.0 944 79 1 556 3 glnS Glutamine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q2NUP0 0.0 943 80 1 552 3 glnS Glutamine--tRNA ligase Sodalis glossinidius (strain morsitans)
Q6LTD1 0.0 933 78 0 552 3 glnS Glutamine--tRNA ligase Photobacterium profundum (strain SS9)
B6EHL7 0.0 933 78 1 550 3 glnS Glutamine--tRNA ligase Aliivibrio salmonicida (strain LFI1238)
C4L887 0.0 919 78 2 551 3 glnS Glutamine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q4QK64 0.0 880 76 2 550 3 glnS Glutamine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
P43831 0.0 880 75 2 550 3 glnS Glutamine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57847 0.0 874 76 2 547 3 glnS Glutamine--tRNA ligase Pasteurella multocida (strain Pm70)
Q15TT6 0.0 872 73 3 557 3 glnS Glutamine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3IGW8 0.0 865 72 3 555 3 glnS Glutamine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
A6VP11 0.0 863 74 2 548 3 glnS Glutamine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q5QXQ2 0.0 852 71 1 556 3 glnS Glutamine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C4K4J9 0.0 846 72 2 546 3 glnS Glutamine--tRNA ligase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7VLM3 0.0 843 73 2 542 3 glnS Glutamine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8EG26 0.0 840 73 2 551 3 glnS Glutamine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4RYH7 0.0 813 69 3 554 3 glnS Glutamine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q47Z40 0.0 812 67 3 556 3 glnS Glutamine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1SS83 0.0 781 66 2 552 3 glnS Glutamine--tRNA ligase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q88IU5 0.0 709 61 5 552 3 glnS Glutamine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8K9E1 0.0 703 57 3 557 3 glnS Glutamine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87YQ1 0.0 702 61 5 550 3 glnS Glutamine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9I2U8 0.0 690 60 6 554 1 glnS Glutamine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02KT5 0.0 690 60 6 554 3 glnS Glutamine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VB85 0.0 690 60 6 554 3 glnS Glutamine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
B8D7U5 0.0 687 55 4 564 3 glnS Glutamine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57490 0.0 686 55 4 564 3 glnS Glutamine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9J3 0.0 686 55 4 564 3 glnS Glutamine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
C1DHE5 0.0 684 60 5 548 3 glnS Glutamine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q89AD4 0.0 681 56 2 548 3 glnS Glutamine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A4XVG2 0.0 680 59 5 550 3 glnS Glutamine--tRNA ligase Pseudomonas mendocina (strain ymp)
A4VL72 0.0 678 59 5 548 3 glnS Glutamine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
Q7NX86 0.0 661 57 6 552 3 glnS Glutamine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7UX42 0.0 654 57 5 550 3 glnS Glutamine--tRNA ligase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5F7G0 0.0 654 58 5 559 3 glnS Glutamine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P57000 0.0 651 57 5 559 3 glnS Glutamine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P56927 0.0 650 58 5 559 3 glnS Glutamine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5N6Y3 0.0 648 56 3 550 3 glnS Glutamine--tRNA ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q1LQ72 0.0 645 55 6 569 3 glnS Glutamine--tRNA ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R5N3 0.0 644 55 6 571 3 glnS Glutamine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q81ZS7 0.0 643 57 5 552 3 glnS1 Glutamine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3BX52 0.0 640 54 4 570 3 glnS Glutamine--tRNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q0K808 0.0 640 55 6 571 3 glnS Glutamine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2U846 0.0 639 55 6 573 3 glnS Glutamine--tRNA ligase Ralstonia pickettii (strain 12J)
Q8PCB3 0.0 637 54 4 570 3 glnS Glutamine--tRNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UR70 0.0 637 54 4 570 3 glnS Glutamine--tRNA ligase Xanthomonas campestris pv. campestris (strain 8004)
Q8PNZ5 0.0 636 54 4 570 3 glnS Glutamine--tRNA ligase Xanthomonas axonopodis pv. citri (strain 306)
Q5GWF4 0.0 632 53 4 568 3 glnS Glutamine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZL7 0.0 632 53 4 568 3 glnS Glutamine--tRNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q0SVB1 0.0 631 56 4 545 3 glnS Glutamine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
Q8XMP3 0.0 631 56 4 545 3 glnS Glutamine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q0TTG1 0.0 631 56 4 545 3 glnS Glutamine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8Y199 0.0 624 54 7 565 3 glnS Glutamine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1QMM1 0.0 622 54 3 546 3 glnS Glutamine--tRNA ligase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B0U6D0 0.0 619 52 5 574 3 glnS Glutamine--tRNA ligase Xylella fastidiosa (strain M12)
Q3SRI8 0.0 616 54 4 547 3 glnS Glutamine--tRNA ligase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q87DU6 0.0 615 52 5 574 3 glnS Glutamine--tRNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PDP1 0.0 614 52 5 574 3 glnS Glutamine--tRNA ligase Xylella fastidiosa (strain 9a5c)
B1XW11 0.0 614 53 8 577 3 glnS Glutamine--tRNA ligase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q89KR6 0.0 613 54 4 548 3 glnS Glutamine--tRNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A4SZM1 0.0 612 52 7 576 3 glnS Glutamine--tRNA ligase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q188C8 0.0 608 54 4 544 3 glnS Glutamine--tRNA ligase Clostridioides difficile (strain 630)
Q2KVX0 0.0 598 51 7 576 3 glnS Glutamine--tRNA ligase Bordetella avium (strain 197N)
Q7VU94 0.0 579 49 8 585 3 glnS Glutamine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4T0 0.0 579 49 8 585 3 glnS Glutamine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGA6 0.0 578 49 8 585 3 glnS Glutamine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P56926 3.14e-174 517 45 7 594 1 glnS Glutamine--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P14325 9.73e-167 495 49 11 534 2 glnS Probable glutamine--tRNA ligase Dictyostelium discoideum
Q8W4F3 2.04e-160 479 47 14 554 2 OVA9 Glutamine--tRNA ligase, cytoplasmic Arabidopsis thaliana
Q66H61 1.12e-154 464 46 12 535 1 Qars1 Glutamine--tRNA ligase Rattus norvegicus
P52780 3.1e-154 464 47 10 535 2 None Glutamine--tRNA ligase Lupinus luteus
Q8BML9 5.96e-154 462 47 12 535 1 Qars1 Glutamine--tRNA ligase Mus musculus
Q3MHH4 4.06e-153 460 46 13 544 2 QARS1 Glutamine--tRNA ligase Bos taurus
P47897 4.74e-152 457 46 12 532 1 QARS1 Glutamine--tRNA ligase Homo sapiens
Q9Y105 9.35e-151 454 43 13 552 2 GlnRS Probable glutamine--tRNA ligase Drosophila melanogaster
O62431 2e-143 436 43 14 535 3 qars-1 Probable glutamine--tRNA ligase Caenorhabditis elegans
Q9Y7Y8 1.27e-136 419 41 11 572 3 qrs1 Probable glutamine--tRNA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P13188 1.29e-135 416 42 15 565 1 GLN4 Glutamine--tRNA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8SR10 2.2e-117 365 40 11 525 3 ECU10_1460 Probable glutamine--tRNA ligase Encephalitozoon cuniculi (strain GB-M1)
G9N4A3 8.2e-112 350 40 18 570 3 virJ Glutamine--tRNA ligase protein virJ Hypocrea virens (strain Gv29-8 / FGSC 10586)
C4V819 1.02e-108 343 39 12 532 3 NCER_100619 Probable glutamine--tRNA ligase Vairimorpha ceranae (strain BRL01)
A9CSU5 1.14e-95 309 37 14 547 3 EBI_22570 Probable glutamine--tRNA ligase Enterocytozoon bieneusi (strain H348)
P46655 2.4e-93 303 35 11 528 1 GUS1 Glutamate--tRNA ligase, cytoplasmic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O13775 1.72e-87 288 34 11 517 1 gus1 Probable glutamate--tRNA ligase, cytoplasmic Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8SSE4 5.81e-87 285 35 10 508 3 ECU02_1210 Probable glutamate--tRNA ligase, cytoplasmic Encephalitozoon cuniculi (strain GB-M1)
Q54KB8 9.85e-84 279 32 7 513 2 gluS Probable glutamate--tRNA ligase, cytoplasmic Dictyostelium discoideum
Q7SIA2 1.52e-82 284 34 8 513 1 EPRS1 Bifunctional glutamate/proline--tRNA ligase Cricetulus griseus
Q8CGC7 5.51e-82 283 33 6 512 1 Eprs1 Bifunctional glutamate/proline--tRNA ligase Mus musculus
P07814 4.3e-81 280 33 8 513 1 EPRS1 Bifunctional glutamate/proline--tRNA ligase Homo sapiens
O82462 3.88e-78 263 32 7 521 1 At5g26710 Glutamate--tRNA ligase, cytoplasmic Arabidopsis thaliana
B1L5U2 1.74e-73 247 33 15 537 3 gltX Glutamate--tRNA ligase Korarchaeum cryptofilum (strain OPF8)
A9CSZ1 3.42e-72 245 31 9 509 3 EBI_22577 Probable glutamate--tRNA ligase, cytoplasmic Enterocytozoon bieneusi (strain H348)
P28668 4.6e-72 254 34 11 515 1 GluProRS Bifunctional glutamate/proline--tRNA ligase Drosophila melanogaster
C4VBI7 3.17e-71 242 33 14 512 3 NCER_102160 Probable glutamate--tRNA ligase, cytoplasmic Vairimorpha ceranae (strain BRL01)
A9A423 7.55e-68 232 32 13 519 3 gltX Glutamate--tRNA ligase Nitrosopumilus maritimus (strain SCM1)
A0RY20 5.04e-67 230 31 12 499 3 gltX Glutamate--tRNA ligase Cenarchaeum symbiosum (strain A)
Q58772 7.2e-61 213 30 10 503 3 gltX Glutamate--tRNA ligase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9V1E3 4.12e-60 211 29 14 515 3 gltX Glutamate--tRNA ligase Pyrococcus abyssi (strain GE5 / Orsay)
Q6LYI0 4.55e-59 208 30 12 506 3 gltX Glutamate--tRNA ligase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
O59314 5.51e-59 208 29 14 515 3 gltX Glutamate--tRNA ligase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q50543 1.34e-58 207 29 11 513 3 gltX Glutamate--tRNA ligase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
A9AAT7 3.86e-58 206 30 12 504 3 gltX Glutamate--tRNA ligase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A4FXG8 1.51e-57 204 30 13 508 3 gltX Glutamate--tRNA ligase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q74MU5 2.38e-57 204 34 8 388 3 gltX Glutamate--tRNA ligase Nanoarchaeum equitans (strain Kin4-M)
Q4J8P2 5.32e-57 203 37 10 349 3 gltX Glutamate--tRNA ligase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
B6YSY7 5.95e-57 203 32 7 379 3 gltX Glutamate--tRNA ligase Thermococcus onnurineus (strain NA1)
A2BK91 6.53e-57 203 29 13 522 3 gltX Glutamate--tRNA ligase Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q8U064 7.17e-57 203 32 7 379 3 gltX Glutamate--tRNA ligase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A6VFU7 1.03e-56 202 29 10 503 3 gltX Glutamate--tRNA ligase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
O26157 2.14e-56 201 30 8 454 1 gltX Glutamate--tRNA ligase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A3MV95 1.21e-55 199 34 8 382 3 gltX Glutamate--tRNA ligase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q971D0 2.52e-55 199 31 17 517 3 gltX Glutamate--tRNA ligase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8TXB7 4.37e-55 198 30 12 516 3 gltX Glutamate--tRNA ligase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
O29979 5.98e-55 197 29 11 456 3 gltX Glutamate--tRNA ligase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A8ABI5 1.5e-54 196 31 12 435 3 gltX Glutamate--tRNA ligase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q2NFU2 1.53e-54 196 29 8 458 3 gltX Glutamate--tRNA ligase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q5JH16 2.61e-54 196 32 6 367 3 gltX Glutamate--tRNA ligase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A6UP25 7.03e-54 194 29 14 517 3 gltX Glutamate--tRNA ligase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A5UN79 1.74e-53 193 31 4 373 3 gltX Glutamate--tRNA ligase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A0B966 2.98e-53 193 31 8 403 3 gltX Glutamate--tRNA ligase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A6UW15 7.2e-53 192 29 12 503 3 gltX Glutamate--tRNA ligase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A3CWJ3 8.31e-53 191 29 15 514 3 gltX Glutamate--tRNA ligase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A1RRG7 1.79e-52 191 32 8 382 3 gltX Glutamate--tRNA ligase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
P95968 4.66e-52 190 30 19 523 3 gltX Glutamate--tRNA ligase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A4WKI4 1.09e-51 189 32 8 382 3 gltX Glutamate--tRNA ligase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q2FTH6 1.95e-51 188 27 13 503 3 gltX Glutamate--tRNA ligase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q8ZU33 2.25e-51 188 32 9 411 3 gltX Glutamate--tRNA ligase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A4YIL8 2.82e-51 187 35 12 380 3 gltX Glutamate--tRNA ligase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q8TT52 2.64e-50 185 28 13 515 3 gltX Glutamate--tRNA ligase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A3DMR5 3.01e-50 185 27 11 473 3 gltX Glutamate--tRNA ligase Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
B1YAX4 1.6e-49 183 31 8 382 3 gltX Glutamate--tRNA ligase Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
Q9Y9H1 4.2e-48 179 34 8 367 3 gltX Glutamate--tRNA ligase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q46CG5 4.21e-48 179 30 7 374 3 gltX Glutamate--tRNA ligase Methanosarcina barkeri (strain Fusaro / DSM 804)
A7IAG1 1.07e-47 179 30 5 375 3 gltX Glutamate--tRNA ligase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A2SRG2 2.27e-47 177 27 12 505 3 gltX Glutamate--tRNA ligase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q5V5N9 6.3e-47 176 29 9 390 3 gltX Glutamate--tRNA ligase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9HJM5 1.3e-46 174 31 6 386 3 gltX Glutamate--tRNA ligase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9HQI1 2.43e-46 174 25 13 532 3 gltX Glutamate--tRNA ligase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Z6 2.43e-46 174 25 13 532 3 gltX Glutamate--tRNA ligase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q18GA5 3.84e-46 174 29 9 450 3 gltX Glutamate--tRNA ligase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A1RYD7 4.42e-46 173 32 8 364 3 gltX Glutamate--tRNA ligase Thermofilum pendens (strain DSM 2475 / Hrk 5)
Q8PW52 1.7e-44 169 29 10 457 3 gltX Glutamate--tRNA ligase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q979Q0 2.59e-44 168 29 5 383 3 gltX Glutamate--tRNA ligase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A8M9D7 1.26e-42 164 31 8 373 3 gltX Glutamate--tRNA ligase Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
Q0W8L2 5.89e-42 162 31 9 382 3 gltX Glutamate--tRNA ligase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q3IPL2 1.48e-40 158 26 13 503 3 gltX Glutamate--tRNA ligase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q12TN7 2.84e-40 157 30 7 335 3 gltX Glutamate--tRNA ligase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q6L0N9 3.46e-37 148 29 5 340 3 gltX Glutamate--tRNA ligase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q728Q1 4.89e-21 99 30 3 208 3 gltX Glutamate--tRNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VBA3 5.41e-21 99 30 3 208 3 gltX Glutamate--tRNA ligase Nitratidesulfovibrio vulgaris (strain DP4)
Q30Y02 3.04e-20 97 32 6 209 3 gltX Glutamate--tRNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B2IYI1 3.3e-19 94 27 11 344 3 gltX Glutamate--tRNA ligase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1CU52 3.53e-19 94 26 11 325 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain HPAG1)
B6JL62 5.44e-19 93 25 10 328 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain P12)
A5GMU7 8.28e-19 92 24 6 323 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain WH7803)
Q5NL22 1.29e-18 92 35 2 135 3 gltX2 Glutamate--tRNA ligase 2 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A8EY39 1.3e-18 92 37 1 130 3 gltX1 Glutamate--tRNA ligase 1 Rickettsia canadensis (strain McKiel)
P96551 2.53e-18 91 29 6 213 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q5HTB9 3.79e-18 90 31 6 207 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter jejuni (strain RM1221)
A7H295 3.79e-18 90 31 6 207 3 gltX1 Glutamate--tRNA ligase 1 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q3M3H8 4.86e-18 90 25 10 347 3 gltX Glutamate--tRNA ligase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YS86 5.59e-18 90 25 10 347 3 gltX Glutamate--tRNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A9LZH6 7.55e-18 89 36 1 135 3 gltX Glutamate--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
A1W0S2 8.29e-18 89 31 6 207 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMZ3 8.29e-18 89 31 6 207 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
O52914 8.44e-18 89 31 6 207 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ZLZ7 8.6e-18 89 29 6 213 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain J99 / ATCC 700824)
Q6N5R5 1.06e-17 89 24 8 311 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A8F2B0 1.37e-17 89 36 1 128 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia massiliae (strain Mtu5)
B5Z6J9 1.49e-17 89 28 6 213 1 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain G27)
Q17WW9 2.13e-17 88 30 7 210 3 gltX2 Glutamate--tRNA ligase 2 Helicobacter acinonychis (strain Sheeba)
A5VB94 2.3e-17 88 35 2 137 3 gltX2 Glutamate--tRNA ligase 2 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B3Q6P5 2.35e-17 88 24 8 311 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain TIE-1)
Q8DLI5 2.47e-17 88 32 8 215 1 gltX Glutamate--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B1LUJ9 2.69e-17 88 25 8 313 3 gltX1 Glutamate--tRNA ligase 1 Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A8GPB2 2.79e-17 88 35 1 131 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia akari (strain Hartford)
Q4UME8 2.84e-17 88 36 1 128 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A5CD02 3.26e-17 88 36 2 130 3 gltX1 Glutamate--tRNA ligase 1 Orientia tsutsugamushi (strain Boryong)
A6LJ42 3.55e-17 87 31 6 216 3 gltX1 Glutamate--tRNA ligase 1 Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q0AUF7 3.67e-17 87 27 7 265 3 gltX2 Glutamate--tRNA ligase 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1QMM2 3.93e-17 87 24 8 313 3 gltX Glutamate--tRNA ligase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9JWT4 4.16e-17 87 35 1 135 3 gltX Glutamate--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0BS88 4.18e-17 87 29 6 216 3 gltX2 Glutamate--tRNA ligase 2 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A1KWM9 4.39e-17 87 35 1 135 3 gltX Glutamate--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A5G3W1 4.54e-17 87 31 2 157 3 gltX Glutamate--tRNA ligase Geotalea uraniireducens (strain Rf4)
B1Z9T1 4.71e-17 87 34 1 132 3 gltX1 Glutamate--tRNA ligase 1 Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B0K403 4.78e-17 87 29 6 221 3 gltX2 Glutamate--tRNA ligase 2 Thermoanaerobacter sp. (strain X514)
A7H0G1 5.03e-17 87 29 6 209 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter curvus (strain 525.92)
Q2JRD6 5.66e-17 87 28 6 211 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
A7ZFB9 5.81e-17 87 30 6 208 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter concisus (strain 13826)
B0KAA6 5.87e-17 87 29 6 221 3 gltX2 Glutamate--tRNA ligase 2 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A9W910 6.27e-17 87 34 1 132 3 gltX1 Glutamate--tRNA ligase 1 Methylorubrum extorquens (strain PA1)
Q3SRI7 6.55e-17 87 23 7 312 3 gltX Glutamate--tRNA ligase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B2UST7 7.1e-17 87 29 6 213 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter pylori (strain Shi470)
A8GT27 7.31e-17 87 35 1 128 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia rickettsii (strain Sheila Smith)
B0BUL7 7.31e-17 87 35 1 128 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia rickettsii (strain Iowa)
B4RPQ3 7.8e-17 86 35 1 135 3 gltX Glutamate--tRNA ligase Neisseria gonorrhoeae (strain NCCP11945)
Q5F5J8 7.8e-17 86 35 1 135 3 gltX Glutamate--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q92H06 8.07e-17 87 35 1 128 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9K1R6 8.31e-17 86 35 1 135 3 gltX Glutamate--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q68WB4 1.14e-16 86 35 2 130 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B3CST4 1.27e-16 86 34 1 130 3 gltX2 Glutamate--tRNA ligase 2 Orientia tsutsugamushi (strain Ikeda)
Q9ZFA3 1.47e-16 85 35 1 128 3 gltX1 Glutamate--tRNA ligase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A7HY03 1.5e-16 85 33 1 131 3 gltX2 Glutamate--tRNA ligase 2 Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B5EEE6 1.56e-16 85 24 12 356 3 gltX Glutamate--tRNA ligase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B5YEP5 1.71e-16 85 31 5 209 3 gltX Glutamate--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q215D4 1.83e-16 85 25 10 313 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain BisB18)
Q9ZCT8 1.99e-16 85 36 2 130 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia prowazekii (strain Madrid E)
B5YIG1 2.04e-16 85 30 5 208 3 gltX Glutamate--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B5Y7R0 2.43e-16 85 27 3 209 3 gltX Glutamate--tRNA ligase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
A3PHK2 2.68e-16 85 35 1 128 3 gltX1 Glutamate--tRNA ligase 1 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0C8D6 3.76e-16 84 35 3 136 3 gltX Glutamate--tRNA ligase Acaryochloris marina (strain MBIC 11017)
Q5N1B8 3.79e-16 84 30 9 217 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q8L1E5 3.79e-16 84 30 9 217 3 gltX Glutamate--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4WX62 3.97e-16 84 31 1 139 3 gltX2 Glutamate--tRNA ligase 2 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A6X0K5 4.08e-16 84 25 10 329 3 gltX1 Glutamate--tRNA ligase 1 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B6JH82 5.88e-16 84 24 8 311 3 gltX Glutamate--tRNA ligase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A4YVF1 6.17e-16 84 23 8 311 3 gltX Glutamate--tRNA ligase Bradyrhizobium sp. (strain ORS 278)
A7HZN3 6.28e-16 84 30 6 206 3 gltX1 Glutamate--tRNA ligase 1 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q55778 7.27e-16 84 26 4 218 3 gltX Glutamate--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2IW96 8.04e-16 83 33 1 130 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain HaA2)
B0UQ09 9.14e-16 83 33 1 132 3 gltX1 Glutamate--tRNA ligase 1 Methylobacterium sp. (strain 4-46)
Q8RB93 1.04e-15 83 29 5 217 3 gltX1 Glutamate--tRNA ligase 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q136B9 1.08e-15 83 32 1 130 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain BisB5)
Q3A413 1.08e-15 83 34 0 121 3 gltX Glutamate--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1AUQ6 1.1e-15 83 28 4 207 3 gltX Glutamate--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B1WYU1 1.17e-15 83 33 4 154 3 gltX Glutamate--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q73R87 1.34e-15 83 28 8 223 3 gltX Glutamate--tRNA ligase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7TUT7 1.38e-15 83 27 5 217 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
Q8G0E8 1.43e-15 82 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella suis biovar 1 (strain 1330)
Q30UA5 1.45e-15 82 26 11 306 3 gltX1 Glutamate--tRNA ligase 1 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A1B8E0 1.51e-15 82 34 1 128 3 gltX2 Glutamate--tRNA ligase 2 Paracoccus denitrificans (strain Pd 1222)
O67271 1.57e-15 82 32 8 213 3 gltX Glutamate--tRNA ligase Aquifex aeolicus (strain VF5)
B4U896 1.79e-15 82 27 6 226 3 gltX Glutamate--tRNA ligase Hydrogenobaculum sp. (strain Y04AAS1)
Q2RTZ4 2.01e-15 82 35 1 131 3 gltX2 Glutamate--tRNA ligase 2 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B0JY53 2.03e-15 82 27 7 218 3 gltX Glutamate--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B0CGU5 2.24e-15 82 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VQR9 2.24e-15 82 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M5G0 2.24e-15 82 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2GHQ1 2.27e-15 82 33 6 175 3 gltX1 Glutamate--tRNA ligase 1 Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q07NH8 2.29e-15 82 33 1 130 3 gltX Glutamate--tRNA ligase Rhodopseudomonas palustris (strain BisA53)
B6IST4 2.31e-15 82 32 1 131 3 gltX2 Glutamate--tRNA ligase 2 Rhodospirillum centenum (strain ATCC 51521 / SW)
Q0I858 2.33e-15 82 23 5 302 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain CC9311)
Q0APU9 2.34e-15 82 32 1 131 3 gltX2 Glutamate--tRNA ligase 2 Maricaulis maris (strain MCS10)
Q2JKY3 2.38e-15 82 28 6 211 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q31GB2 2.57e-15 82 34 2 134 3 gltX Glutamate--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q163X3 3.11e-15 82 31 1 154 3 gltX2 Glutamate--tRNA ligase 2 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
O68142 3.16e-15 79 28 7 220 3 gluQ Glutamyl-Q tRNA(Asp) synthetase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
B3CLF5 3.39e-15 81 36 0 113 3 gltX2 Glutamate--tRNA ligase 2 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A8I819 3.41e-15 81 32 1 132 3 gltX Glutamate--tRNA ligase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A6Q5I8 3.58e-15 81 28 4 211 3 gltX2 Glutamate--tRNA ligase 2 Nitratiruptor sp. (strain SB155-2)
Q0BTZ0 3.79e-15 81 35 2 131 3 gltX1 Glutamate--tRNA ligase 1 Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q3YR29 3.95e-15 81 34 3 123 3 gltX2 Glutamate--tRNA ligase 2 Ehrlichia canis (strain Jake)
Q15RR1 4.04e-15 81 30 5 209 3 gltX Glutamate--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q57CZ2 4.1e-15 81 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella abortus biovar 1 (strain 9-941)
Q2YRQ9 4.1e-15 81 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella abortus (strain 2308)
B2S5Z7 4.1e-15 81 25 10 334 3 gltX2 Glutamate--tRNA ligase 2 Brucella abortus (strain S19)
Q8YHG4 4.1e-15 81 25 10 334 3 gltX1 Glutamate--tRNA ligase 1 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1RJC6 4.21e-15 81 34 1 129 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia bellii (strain RML369-C)
A8GX08 4.21e-15 81 34 1 129 3 gltX2 Glutamate--tRNA ligase 2 Rickettsia bellii (strain OSU 85-389)
B2IKL1 4.37e-15 81 32 0 122 3 gltX1 Glutamate--tRNA ligase 1 Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A1USF5 4.46e-15 81 24 9 333 3 gltX1 Glutamate--tRNA ligase 1 Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P57906 4.91e-15 81 27 7 211 3 gltX Glutamate--tRNA ligase Pasteurella multocida (strain Pm70)
Q5FRG7 5.11e-15 81 34 2 131 3 gltX1 Glutamate--tRNA ligase 1 Gluconobacter oxydans (strain 621H)
A5EK39 5.88e-15 80 32 1 130 3 gltX Glutamate--tRNA ligase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q89KR5 6.29e-15 80 33 1 129 3 gltX Glutamate--tRNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q0A936 6.41e-15 80 25 14 363 3 gltX1 Glutamate--tRNA ligase 1 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q39F07 6.89e-15 80 29 7 209 3 gltX Glutamate--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7VHN8 7.31e-15 80 27 5 210 3 gltX1 Glutamate--tRNA ligase 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q6G3V8 8.54e-15 80 23 9 330 3 gltX1 Glutamate--tRNA ligase 1 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2LQN4 8.79e-15 80 26 4 211 3 gltX1 Glutamate--tRNA ligase 1 Syntrophus aciditrophicus (strain SB)
A7HL47 9.49e-15 80 28 7 222 3 gltX2 Glutamate--tRNA ligase 2 Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A6VLT3 1.02e-14 80 28 9 214 3 gltX Glutamate--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A2C0T1 1.06e-14 80 24 7 305 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain NATL1A)
B1JUI6 1.1e-14 80 29 7 209 3 gltX Glutamate--tRNA ligase Burkholderia orbicola (strain MC0-3)
A0K8I0 1.1e-14 80 29 7 209 3 gltX Glutamate--tRNA ligase Burkholderia cenocepacia (strain HI2424)
Q1BHL9 1.13e-14 80 29 7 209 3 gltX Glutamate--tRNA ligase Burkholderia orbicola (strain AU 1054)
B4ECR7 1.16e-14 80 29 7 209 3 gltX Glutamate--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39UV7 1.24e-14 80 28 4 204 3 gltX Glutamate--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q119Z5 1.32e-14 80 29 8 215 3 gltX Glutamate--tRNA ligase Trichodesmium erythraeum (strain IMS101)
Q1MR60 1.33e-14 79 31 0 129 3 gltX Glutamate--tRNA ligase Lawsonia intracellularis (strain PHE/MN1-00)
Q11HT5 1.37e-14 79 34 1 132 3 gltX2 Glutamate--tRNA ligase 2 Chelativorans sp. (strain BNC1)
Q6FZN9 1.37e-14 79 24 9 331 3 gltX2 Glutamate--tRNA ligase 2 Bartonella quintana (strain Toulouse)
Q46GU9 1.48e-14 79 24 7 305 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain NATL2A)
Q7U581 1.64e-14 79 25 9 308 3 gltX Glutamate--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
A4XHE0 1.69e-14 79 31 8 216 3 gltX1 Glutamate--tRNA ligase 1 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A0LI05 1.71e-14 79 25 6 210 3 gltX Glutamate--tRNA ligase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A8G3I8 1.74e-14 79 27 5 211 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9215)
Q3ALW7 1.81e-14 79 27 5 219 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain CC9605)
Q74DU6 1.86e-14 79 26 3 217 3 gltX Glutamate--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A0RR62 1.88e-14 79 29 5 209 3 gltX2 Glutamate--tRNA ligase 2 Campylobacter fetus subsp. fetus (strain 82-40)
A5GUL0 1.98e-14 79 28 5 215 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain RCC307)
Q1GUX4 2e-14 79 31 1 124 3 gltX1 Glutamate--tRNA ligase 1 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5UAL5 3e-14 79 28 6 209 3 gltX Glutamate--tRNA ligase Haemophilus influenzae (strain PittEE)
P43818 3.03e-14 79 28 6 209 3 gltX Glutamate--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6MKR6 3.05e-14 79 27 6 218 3 gltX Glutamate--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7M7L9 3.07e-14 78 25 10 326 3 gltX1 Glutamate--tRNA ligase 1 Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q4QNR5 3.11e-14 79 28 6 209 3 gltX Glutamate--tRNA ligase Haemophilus influenzae (strain 86-028NP)
A6Q6F9 3.12e-14 78 30 5 203 3 gltX1 Glutamate--tRNA ligase 1 Sulfurovum sp. (strain NBC37-1)
Q31C61 3.3e-14 78 27 5 213 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
Q9A721 3.55e-14 78 28 4 208 3 gltX Glutamate--tRNA ligase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q28L59 3.66e-14 78 32 5 157 3 gltX2 Glutamate--tRNA ligase 2 Jannaschia sp. (strain CCS1)
A9ISS8 3.75e-14 78 35 2 123 3 gltX2 Glutamate--tRNA ligase 2 Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q7MMW8 3.87e-14 78 27 5 215 3 gltX Glutamate--tRNA ligase Vibrio vulnificus (strain YJ016)
B3E399 3.99e-14 78 27 4 208 3 gltX Glutamate--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q8DFH5 4.04e-14 78 27 5 215 3 gltX Glutamate--tRNA ligase Vibrio vulnificus (strain CMCP6)
Q5FGB6 4.07e-14 78 32 5 155 3 gltX1 Glutamate--tRNA ligase 1 Ehrlichia ruminantium (strain Gardel)
A8EQW9 4.38e-14 78 30 7 204 3 gltX1 Glutamate--tRNA ligase 1 Aliarcobacter butzleri (strain RM4018)
Q5HAC1 4.49e-14 78 32 5 155 3 gltX1 Glutamate--tRNA ligase 1 Ehrlichia ruminantium (strain Welgevonden)
Q73H00 4.63e-14 78 35 1 101 3 gltX2 Glutamate--tRNA ligase 2 Wolbachia pipientis wMel
A5UG92 4.72e-14 78 28 6 209 3 gltX Glutamate--tRNA ligase Haemophilus influenzae (strain PittGG)
A2C7H0 4.78e-14 78 26 5 217 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q7V2K3 4.9e-14 78 27 4 208 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q47Z58 5.34e-14 78 35 3 129 3 gltX Glutamate--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A8ZWA3 5.52e-14 77 33 0 117 3 gltX Glutamate--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A7MY61 6.21e-14 77 28 4 206 3 gltX Glutamate--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
Q1GHK0 6.28e-14 77 34 2 129 3 gltX1 Glutamate--tRNA ligase 1 Ruegeria sp. (strain TM1040)
A5G1Y4 6.44e-14 77 25 13 351 3 gltX2 Glutamate--tRNA ligase 2 Acidiphilium cryptum (strain JF-5)
Q73HV5 7.3e-14 77 32 0 113 3 gltX1 Glutamate--tRNA ligase 1 Wolbachia pipientis wMel
A8F597 7.48e-14 77 28 5 214 3 gltX1 Glutamate--tRNA ligase 1 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A9BGT8 8.33e-14 77 26 6 231 3 gltX2 Glutamate--tRNA ligase 2 Petrotoga mobilis (strain DSM 10674 / SJ95)
Q87RL6 8.45e-14 77 28 4 206 3 gltX Glutamate--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1D8Y1 8.75e-14 77 28 6 216 3 gltX Glutamate--tRNA ligase Myxococcus xanthus (strain DK1622)
A9GZS1 8.8e-14 77 32 1 131 3 gltX1 Glutamate--tRNA ligase 1 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B1KML5 8.98e-14 77 24 10 326 3 gltX Glutamate--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A4J0Y7 9.92e-14 77 29 7 227 3 gltX Glutamate--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q82U77 1.04e-13 77 28 4 207 3 gltX Glutamate--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A8LMK2 1.09e-13 77 32 1 133 3 gltX1 Glutamate--tRNA ligase 1 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B6EJQ3 1.16e-13 77 27 6 226 3 gltX Glutamate--tRNA ligase Aliivibrio salmonicida (strain LFI1238)
Q1H0X9 1.24e-13 77 32 1 132 3 gltX Glutamate--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B0BQK7 1.28e-13 77 27 5 209 3 gltX Glutamate--tRNA ligase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H248 1.28e-13 77 27 5 209 3 gltX Glutamate--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P31970 1.38e-13 76 23 7 335 3 gltX Glutamate--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3A9N9 1.39e-13 76 30 6 218 3 gltX Glutamate--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A8FXE0 1.48e-13 76 26 6 219 3 gltX Glutamate--tRNA ligase Shewanella sediminis (strain HAW-EB3)
A8H2J4 1.52e-13 76 27 6 219 3 gltX Glutamate--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q5GSI3 1.6e-13 76 33 0 110 3 gltX2 Glutamate--tRNA ligase 2 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5E3L4 1.7e-13 76 27 3 208 3 gltX Glutamate--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A3N1S5 1.76e-13 76 27 5 209 3 gltX Glutamate--tRNA ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3QCW8 1.78e-13 76 26 6 219 3 gltX Glutamate--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B5FGU2 1.83e-13 76 27 3 208 3 gltX Glutamate--tRNA ligase Aliivibrio fischeri (strain MJ11)
A9BE95 1.87e-13 76 27 6 217 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
Q0BDX9 2.2e-13 76 28 7 209 3 gltX Glutamate--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A3PBJ6 2.21e-13 76 27 4 210 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
Q2GKT8 2.23e-13 76 33 1 128 3 gltX2 Glutamate--tRNA ligase 2 Anaplasma phagocytophilum (strain HZ)
B1YSK3 2.26e-13 75 28 7 209 3 gltX Glutamate--tRNA ligase Burkholderia ambifaria (strain MC40-6)
B3CNK5 2.32e-13 75 31 5 174 3 gltX1 Glutamate--tRNA ligase 1 Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q7VDB2 2.67e-13 75 26 5 216 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B2IGY0 2.74e-13 75 37 4 142 3 gltX2 Glutamate--tRNA ligase 2 Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B0TNB9 2.9e-13 75 26 6 219 3 gltX Glutamate--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
O86528 3.22e-13 75 26 7 224 3 gltX Glutamate--tRNA ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5LRH2 3.29e-13 75 32 1 128 3 gltX2 Glutamate--tRNA ligase 2 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1IVB1 3.59e-13 75 31 0 127 3 gltX2 Glutamate--tRNA ligase 2 Koribacter versatilis (strain Ellin345)
Q7VNZ3 3.61e-13 75 26 5 209 3 gltX Glutamate--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4XLI3 3.61e-13 75 27 10 277 3 gltX2 Glutamate--tRNA ligase 2 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B1LBX4 3.71e-13 75 27 5 218 3 gltX2 Glutamate--tRNA ligase 2 Thermotoga sp. (strain RQ2)
Q65VB3 4.13e-13 75 27 7 211 3 gltX Glutamate--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8LIP0 4.14e-13 75 29 7 212 3 gltX2 Glutamate--tRNA ligase 2 Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A9AHQ3 4.24e-13 75 24 8 303 3 gltX Glutamate--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
Q2SX36 4.43e-13 75 23 6 303 1 gltX Glutamate--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q609J9 4.45e-13 75 34 0 113 3 gltX2 Glutamate--tRNA ligase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A5IMM2 4.55e-13 75 27 5 218 3 gltX2 Glutamate--tRNA ligase 2 Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X172 4.55e-13 75 27 5 218 1 gltX1 Glutamate--tRNA ligase 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B5XVT8 4.64e-13 75 31 0 122 3 gltX Glutamate--tRNA ligase Klebsiella pneumoniae (strain 342)
B1YGS7 4.95e-13 75 27 7 219 3 gltX Glutamate--tRNA ligase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A7INJ6 5.05e-13 75 31 1 132 3 gltX1 Glutamate--tRNA ligase 1 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q47GG0 5.88e-13 74 26 4 214 3 gltX Glutamate--tRNA ligase Dechloromonas aromatica (strain RCB)
P0C6Q1 6.14e-13 74 27 5 208 3 gltX Glutamate--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F649 6.14e-13 74 27 5 208 3 gltX Glutamate--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0Q4G6 6.46e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
Q11I44 6.59e-13 74 36 4 145 3 gltX1 Glutamate--tRNA ligase 1 Chelativorans sp. (strain BNC1)
Q67TJ2 7.32e-13 74 27 5 220 3 gltX Glutamate--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q0BNU3 7.44e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5I8 7.44e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A7N9Q8 7.44e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q5NHY6 7.51e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JD8 7.51e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
A4IZU9 7.57e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SE01 7.57e-13 74 27 6 209 3 gltX Glutamate--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5GSJ1 7.59e-13 74 32 4 150 3 gltX1 Glutamate--tRNA ligase 1 Wolbachia sp. subsp. Brugia malayi (strain TRS)
A6TC43 8.46e-13 74 30 0 122 3 gltX Glutamate--tRNA ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q0AIP6 8.5e-13 74 27 4 214 3 gltX Glutamate--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3JEF2 8.53e-13 74 24 5 208 3 gltX1 Glutamate--tRNA ligase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4JFB2 8.6e-13 74 27 7 209 3 gltX Glutamate--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2W3G8 8.83e-13 74 32 1 127 3 gltX2 Glutamate--tRNA ligase 2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A9I219 8.93e-13 74 32 3 134 3 gltX Glutamate--tRNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A3PMJ1 9.86e-13 73 35 2 124 3 gltX2 Glutamate--tRNA ligase 2 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A2BPV5 9.87e-13 73 26 5 212 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain AS9601)
Q1QY92 1.01e-12 73 24 11 318 3 gltX Glutamate--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q98MD0 1.02e-12 73 32 1 130 3 gltX1 Glutamate--tRNA ligase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1K5J1 1.19e-12 73 32 1 123 3 gltX Glutamate--tRNA ligase Azoarcus sp. (strain BH72)
A1SVA7 1.21e-12 73 29 0 119 3 gltX Glutamate--tRNA ligase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A5EV06 1.28e-12 73 33 3 124 3 gltX Glutamate--tRNA ligase Dichelobacter nodosus (strain VCS1703A)
Q0VPE1 1.3e-12 73 26 6 263 3 gltX Glutamate--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B6ISG3 1.36e-12 73 28 8 215 3 gltX1 Glutamate--tRNA ligase 1 Rhodospirillum centenum (strain ATCC 51521 / SW)
Q3IZQ8 1.37e-12 73 35 2 124 3 gltX2 Glutamate--tRNA ligase 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q13X76 1.4e-12 73 29 0 121 3 gltX Glutamate--tRNA ligase Paraburkholderia xenovorans (strain LB400)
Q6AJL4 1.47e-12 73 31 1 132 3 gltX Glutamate--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q16AX5 1.79e-12 73 45 0 64 3 gltX1 Glutamate--tRNA ligase 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LWB2 1.8e-12 73 33 4 150 3 gltX1 Glutamate--tRNA ligase 1 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3AWM6 1.82e-12 73 27 6 219 3 gltX Glutamate--tRNA ligase Synechococcus sp. (strain CC9902)
A4G3S7 1.88e-12 73 30 0 121 3 gltX Glutamate--tRNA ligase Herminiimonas arsenicoxydans
Q6FZP6 2.12e-12 72 33 3 131 3 gltX1 Glutamate--tRNA ligase 1 Bartonella quintana (strain Toulouse)
Q2NA91 2.19e-12 73 30 2 132 3 gltX1 Glutamate--tRNA ligase 1 Erythrobacter litoralis (strain HTCC2594)
B1H0J3 2.34e-12 72 28 7 224 3 gltX Glutamate--tRNA ligase Endomicrobium trichonymphae
Q1GEA9 2.35e-12 72 28 7 212 3 gltX2 Glutamate--tRNA ligase 2 Ruegeria sp. (strain TM1040)
A6X0R0 2.45e-12 72 40 3 104 3 gltX2 Glutamate--tRNA ligase 2 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A4WPH4 2.79e-12 72 33 2 124 3 gltX1 Glutamate--tRNA ligase 1 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q2Y8L6 2.88e-12 72 26 5 210 3 gltX Glutamate--tRNA ligase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7N6Y2 2.94e-12 72 27 5 211 3 gltX Glutamate--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1AU10 2.95e-12 72 24 9 310 3 gltX1 Glutamate--tRNA ligase 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B0USJ3 3.01e-12 72 30 1 124 3 gltX Glutamate--tRNA ligase Histophilus somni (strain 2336)
Q0I297 3.07e-12 72 30 1 124 3 gltX Glutamate--tRNA ligase Histophilus somni (strain 129Pt)
Q03U68 3.12e-12 72 25 10 302 3 gltX1 Glutamate--tRNA ligase 1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A2BVD5 3.24e-12 72 26 4 210 3 gltX Glutamate--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
Q055X5 3.32e-12 72 26 6 220 3 gltX Glutamate--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04PF0 3.32e-12 72 26 6 220 3 gltX Glutamate--tRNA ligase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q2RJE3 3.42e-12 72 27 7 227 3 gltX Glutamate--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A9ISQ6 3.52e-12 72 22 8 333 3 gltX1 Glutamate--tRNA ligase 1 Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q5NY25 3.65e-12 72 25 3 216 3 gltX Glutamate--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5PBW1 3.67e-12 72 32 4 125 3 gltX1 Glutamate--tRNA ligase 1 Anaplasma marginale (strain St. Maries)
Q32DE6 3.69e-12 72 30 2 123 3 gltX Glutamate--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B2V5J1 3.9e-12 72 28 7 219 3 gltX Glutamate--tRNA ligase Sulfurihydrogenibium sp. (strain YO3AOP1)
A7HKV0 4.26e-12 72 27 5 216 3 gltX1 Glutamate--tRNA ligase 1 Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A8GRM9 4.32e-12 72 33 4 147 3 gltX1 Glutamate--tRNA ligase 1 Rickettsia rickettsii (strain Sheila Smith)
B0BX35 4.32e-12 72 33 4 147 3 gltX1 Glutamate--tRNA ligase 1 Rickettsia rickettsii (strain Iowa)
P57173 4.35e-12 72 31 0 119 3 gltX Glutamate--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q46ZE6 4.44e-12 72 23 6 301 3 gltX Glutamate--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_04710
Feature type CDS
Gene glnS
Product glutamine--tRNA ligase
Location 268436 - 270103 (strand: -1)
Length 1668 (nucleotides) / 555 (amino acids)

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1534
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00749 tRNA synthetases class I (E and Q), catalytic domain
PF03950 tRNA synthetases class I (E and Q), anti-codon binding domain
PF20974 tRNA synthetases class I (E and Q), anti-codon binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0008 Translation, ribosomal structure and biogenesis (J) J Glutamyl- or glutaminyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01886 glutaminyl-tRNA synthetase [EC:6.1.1.18] Aminoacyl-tRNA biosynthesis
Metabolic pathways
-

Protein Sequence

MNEADARPTNFIRQIIDEDLASGKHTTVHTRFPPEPNGYLHIGHAKSICLNFGIAQDYQGQCNLRFDDTNPVKEDVEYVNSIENDVKWLGFQWSGNVCYSSDYFDTLYNYAVELINKGLAYVCELSSEEIREYRGTLKEPGRNSPYRDRTPEENLALFEKMRDGGFEEGKACLRAKIDMASSFMVMRDPVIYRIKFATHHQSGDKWCIYPMYDFTHCISDALEGITHSLCTLEFQDNRRLYDWVLDNITIDCHPRQYEFSRLNLEYTVMSKRKLNQLVTEKFVEGWDDPRMLTISGLRRRGYTAASIREFCRRIGVTKQDNNVEMAALESCIRDDLNESAPRAMAVIDPVKVVIENMPEGDVMVTMPNHPNKPEMGSREVPFSREIWIDRADFREEANKQYKRLVLNKEVRLRNAFVIKAERAEKDSEGNITTIYCTYDPETLNKDPADGRKVKGVIHWVSVKHAVPAEIRLYDRLFSVPNPGAEDDFLSTLNPDSLVIRQGFVEPSLVAADSSKPYQFEREGYFCADAKLSSADKLVFNRTVGLRDTWAKIESK

Flanking regions ( +/- flanking 50bp)

CGGATGATAAGAGGTTATTAACGCGCATATTGCATTGAGGAATTATGACAATGAACGAGGCTGATGCCCGCCCGACAAACTTTATTCGTCAGATTATTGACGAAGACCTGGCTTCCGGAAAACATACCACGGTTCACACGCGCTTCCCGCCTGAGCCGAACGGTTACCTGCATATTGGTCATGCGAAATCAATCTGCCTGAATTTCGGCATTGCACAAGACTATCAGGGGCAATGCAATCTGCGTTTTGATGACACCAACCCGGTTAAAGAAGACGTGGAATATGTTAATTCCATTGAAAACGATGTCAAATGGCTCGGTTTTCAGTGGAGCGGCAATGTATGCTACTCCTCCGACTATTTCGACACGCTGTACAACTACGCCGTTGAGCTGATCAACAAAGGCCTGGCGTATGTCTGCGAATTAAGTTCGGAAGAGATCCGTGAATACCGCGGCACCTTAAAAGAGCCGGGCCGGAACAGCCCGTACCGCGACCGTACTCCGGAAGAGAACCTCGCGCTGTTTGAAAAAATGCGTGACGGCGGCTTTGAGGAAGGTAAAGCGTGTCTGCGTGCCAAAATCGATATGGCATCCTCCTTTATGGTGATGCGTGATCCGGTCATTTACCGTATTAAGTTTGCGACTCACCATCAGTCCGGTGACAAATGGTGCATCTACCCGATGTACGATTTCACCCACTGTATTTCTGATGCGCTGGAAGGGATCACCCATTCACTCTGTACACTGGAATTCCAGGACAACCGCCGCCTGTATGACTGGGTGCTGGATAACATCACTATTGACTGCCATCCGCGTCAGTATGAGTTCTCCCGCCTGAATCTTGAATACACTGTGATGTCCAAGCGGAAGCTGAATCAGCTGGTAACAGAGAAATTTGTTGAAGGCTGGGATGACCCGCGCATGCTGACCATTTCCGGTCTGCGCCGTCGTGGTTATACCGCTGCCTCTATCCGCGAGTTCTGCCGCCGTATCGGCGTCACCAAACAGGATAACAACGTCGAAATGGCGGCTCTGGAATCCTGTATCCGTGATGACCTGAACGAAAGCGCACCACGCGCCATGGCGGTTATCGACCCGGTGAAAGTCGTGATTGAAAACATGCCGGAAGGCGATGTGATGGTCACCATGCCGAATCATCCGAACAAACCGGAGATGGGCAGCCGCGAAGTGCCGTTCAGCCGTGAAATCTGGATTGATCGCGCGGACTTCCGTGAAGAAGCGAACAAGCAGTACAAGCGTCTGGTGCTGAATAAAGAAGTGCGTCTGCGTAATGCGTTTGTGATTAAAGCAGAGCGCGCGGAAAAAGACAGCGAAGGCAATATCACCACTATCTACTGTACCTATGATCCGGAAACCCTGAATAAAGATCCGGCTGACGGACGTAAAGTGAAGGGCGTTATCCACTGGGTCAGCGTGAAACACGCGGTACCGGCGGAAATCCGTCTGTATGACCGCCTGTTCAGTGTACCGAACCCGGGCGCAGAGGATGATTTCCTGTCGACGCTTAACCCGGATTCTCTGGTGATCCGTCAGGGCTTTGTGGAGCCGTCACTGGTCGCTGCAGACAGCAGCAAGCCGTATCAGTTTGAGCGTGAAGGGTATTTCTGTGCTGATGCCAAATTATCCTCAGCGGATAAATTAGTCTTTAACCGGACTGTCGGCCTGCGTGATACCTGGGCGAAAATTGAGAGTAAATAACAGATAACACAGTGTTATTAATATAAAAAAGCCGTTCGCAGGAACGGCTT