Homologs in group_1254

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07300 FBDBKF_07300 100.0 Morganella morganii S1 uup ABC transporter ATP-binding protein
EHELCC_03670 EHELCC_03670 100.0 Morganella morganii S2 uup ABC transporter ATP-binding protein
LHKJJB_09500 LHKJJB_09500 100.0 Morganella morganii S3 uup ABC transporter ATP-binding protein
HKOGLL_09475 HKOGLL_09475 100.0 Morganella morganii S5 uup ABC transporter ATP-binding protein
F4V73_RS01485 F4V73_RS01485 91.1 Morganella psychrotolerans - ABC transporter ATP-binding protein
PMI_RS03810 PMI_RS03810 77.5 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1254

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1254

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P43672 0.0 957 75 2 638 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
Q57242 0.0 776 62 1 637 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57445 0.0 542 43 6 634 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P45167 0.0 542 65 1 449 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 6.95e-07 55 28 6 228 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9I3 1.42e-180 527 42 6 634 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P9WQK3 6.06e-106 334 36 2 503 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 6.06e-106 334 36 2 503 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O06476 3.69e-97 313 31 8 641 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q45978 3.12e-91 297 37 7 620 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 1.33e-14 80 32 7 242 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0A0H2VFI8 6.97e-91 295 33 6 523 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 1.66e-19 95 29 10 278 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 7.27e-91 295 33 6 523 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.68e-19 95 29 10 278 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 7.27e-91 295 33 6 523 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.68e-19 95 29 10 278 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 7.27e-91 295 33 6 523 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.68e-19 95 29 10 278 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P45127 7.35e-89 290 32 5 540 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 5.32e-20 97 29 3 240 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O05519 2.17e-83 278 29 17 651 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.39e-23 109 29 6 280 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
P0A9U3 1.75e-79 264 32 8 503 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 5.54e-25 112 29 5 240 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 5.49e-16 85 25 5 234 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 1.75e-79 264 32 8 503 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 5.54e-25 112 29 5 240 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 5.49e-16 85 25 5 234 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 1.75e-79 264 32 8 503 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 5.54e-25 112 29 5 240 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 5.49e-16 85 25 5 234 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q9LV93 5.58e-78 265 31 11 579 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 6.52e-23 107 27 5 247 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 6.05e-13 75 26 6 307 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9FIB4 1.21e-73 253 31 11 578 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 4.28e-22 104 27 5 244 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 6.06e-13 75 26 10 323 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
P44808 1.17e-69 241 28 13 633 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 1.9e-22 105 33 6 249 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P63389 1.42e-66 233 27 14 630 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
A0A0H2VBH0 1.42e-66 233 27 14 630 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63390 1.42e-66 233 27 14 630 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
O34512 2.09e-66 229 30 10 524 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O31716 2.56e-62 219 29 10 553 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.61e-17 89 25 4 251 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q5R9Z5 7.41e-62 221 31 18 541 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 1.91e-12 73 36 0 99 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q8K268 1.68e-61 220 30 16 537 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 6.02e-16 85 29 16 378 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 8.73e-15 81 26 4 225 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 5.89e-61 219 30 17 541 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 1.62e-14 80 26 4 222 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
P40024 3.61e-60 214 28 15 547 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q66H39 5.31e-60 216 30 17 541 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 4.55e-15 82 26 4 222 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q9FJH6 1.47e-59 213 29 13 535 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 6.13e-13 75 26 9 264 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q8H0V6 6.68e-59 213 28 15 548 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q9UG63 4.85e-57 206 30 13 534 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 2.13e-13 77 28 6 238 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
O59672 7.26e-57 208 29 15 550 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8T6B4 7.89e-57 211 30 14 536 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q99LE6 1.76e-56 205 29 13 534 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 2.2e-13 77 28 6 238 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
P43535 2.93e-55 204 29 15 535 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 3e-10 67 33 1 103 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2KJA2 3.22e-54 199 30 13 532 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 1.27e-13 77 28 6 238 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
P12622 4.93e-54 189 36 2 277 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.01e-11 69 36 5 139 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
Q9M1H3 5.89e-53 197 28 16 555 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
O42943 1.78e-52 194 27 12 524 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 4.03e-16 85 29 7 237 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 2.83e-10 67 26 8 242 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8T6B7 2.41e-52 193 28 12 530 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 9.14e-14 78 27 6 233 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
P39115 1.35e-49 184 25 13 542 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 1.47e-24 111 29 9 306 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q9USH9 6.29e-48 183 28 15 532 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1.23e-11 71 30 7 212 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1.85e-10 67 29 8 239 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25256 7.1e-48 179 30 14 536 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 5e-12 72 45 1 83 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
Q8SRV5 7.25e-44 168 27 14 511 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 3.19e-15 82 27 7 246 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 8.36e-14 78 32 10 252 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q6P542 1.64e-39 159 26 13 536 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 9.56e-11 68 27 5 234 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q7YR37 3.08e-39 157 25 10 512 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.85e-13 77 27 8 300 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.1e-09 65 25 6 241 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q767L0 4.45e-39 157 25 10 512 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 3.98e-14 79 27 8 300 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 3.56e-10 67 26 6 241 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q6MG08 5.49e-39 157 26 11 517 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 1.42e-10 68 25 6 241 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q8NE71 5.85e-39 157 25 10 512 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.02e-09 65 25 6 241 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
P0DX93 5.27e-37 147 28 10 394 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 1.59e-19 95 33 9 247 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 8.98e-14 77 26 4 215 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P23212 1.82e-35 143 27 14 524 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 1.83e-19 95 33 3 178 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P16521 1.58e-30 131 27 10 388 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.05e-15 84 28 6 219 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 4.22e-08 60 33 1 89 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.21e-06 55 27 2 116 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
D0MYB4 1.97e-30 131 27 10 385 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 9.23e-14 78 31 5 189 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 4.4e-07 57 34 0 85 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.34e-06 55 32 3 94 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O93796 1.44e-29 129 27 8 383 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.33e-15 84 30 4 188 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.84e-08 61 33 1 89 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 5.37e-07 56 29 2 116 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q08972 8.11e-29 126 26 7 383 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.32e-13 76 28 5 216 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.48e-09 65 28 6 214 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.46e-09 63 27 3 161 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29551 9.33e-29 126 27 13 388 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 9.4e-18 91 33 6 200 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 4.01e-07 57 32 0 86 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 5.5e-07 56 37 2 72 3 TEF3 Elongation factor 3 Pneumocystis carinii
O94489 9.88e-29 126 28 12 399 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.51e-13 77 32 6 183 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.72e-08 61 36 3 90 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 4.85e-08 60 29 2 115 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25997 1.28e-27 122 26 11 390 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.73e-15 83 30 4 191 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1e-07 59 30 2 97 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 4.52e-06 53 32 0 85 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P53978 3.81e-27 121 26 10 389 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 6.02e-16 85 29 5 211 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.42e-08 62 33 1 89 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 4.37e-07 57 32 0 86 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q75EV6 5.33e-27 120 26 10 391 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3e-15 83 30 4 188 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 6.21e-08 59 32 1 89 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.28e-05 52 32 0 77 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
O14134 6.19e-25 114 26 11 390 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.66e-21 101 31 4 207 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.42e-08 62 33 0 83 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 2e-07 58 33 2 98 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6LQ00 3.65e-22 104 24 21 545 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 1.07e-06 55 23 6 220 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q4ZZS2 4.63e-22 99 35 3 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 1.89e-07 56 21 4 238 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q8D3Z9 7.24e-22 103 25 21 543 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q4FQ27 8.55e-22 98 34 6 193 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 1.4e-09 62 27 6 233 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q87G35 1.06e-21 103 24 21 538 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87UN0 1.55e-21 98 35 3 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 4.61e-09 61 22 4 238 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q73P93 1.59e-21 102 21 16 533 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 9.21e-08 58 22 4 222 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 3.13e-06 53 21 8 229 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q48PV0 1.61e-21 98 35 3 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7MFH3 3.52e-21 101 25 21 543 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8TQ05 2.7e-20 99 25 18 524 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 1.51e-06 55 25 17 349 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q58129 2.88e-20 98 23 17 498 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A0KPH6 4.24e-20 93 36 5 188 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 1.38e-08 59 23 6 234 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q832R5 4.67e-20 97 24 23 538 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q3KKA1 6.17e-20 93 35 4 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q4KKK4 6.17e-20 93 35 5 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 4.94e-10 64 24 6 240 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8XK20 1.36e-19 96 23 21 536 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 3.48e-07 57 23 7 224 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q1Q889 1.81e-19 91 33 6 193 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 1.51e-10 65 26 5 232 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q97WT4 2.3e-19 95 26 22 538 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97WT4 0.000287 47 25 8 213 3 SSO2030 Putative ABC transporter ATP-binding protein SSO2030 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9XDA6 2.71e-19 91 31 7 223 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 7.73e-07 54 22 7 242 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9WXX0 5.06e-19 94 22 15 538 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX0 6.54e-09 62 24 6 216 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q89AJ0 5.18e-19 90 30 5 188 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 1.37e-11 68 27 9 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q926D8 7.12e-19 90 31 7 221 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 1.51e-08 59 23 7 242 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8XXY9 3.47e-18 89 36 4 179 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 4e-05 49 21 5 235 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8DQY5 3.88e-18 91 23 18 533 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 6.21e-09 62 24 7 246 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
O34362 7.99e-18 90 23 17 541 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q88RL1 1.43e-17 86 34 5 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8G838 1.61e-17 90 22 17 526 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 9.14e-09 62 30 10 194 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 6e-07 56 27 8 229 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q87BH8 1.78e-17 85 30 6 206 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q6VMN4 2.14e-17 89 23 18 518 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 0.000491 47 33 1 83 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q97SA3 2.67e-17 89 23 18 527 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 1.66e-09 64 24 8 247 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O34314 2.92e-17 85 37 6 172 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
O34314 0.000394 46 41 1 60 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
P0A2U7 3.08e-17 84 30 5 193 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U7 8.23e-10 63 24 7 247 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 3.08e-17 84 30 5 193 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0A2U6 8.23e-10 63 24 7 247 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1IGY7 4.53e-17 84 34 5 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q9MUN1 4.56e-17 86 32 4 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 3.93e-10 65 27 8 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q5PIA5 5.66e-17 84 31 5 191 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 5.66e-17 84 31 5 191 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8ZNV7 6.1e-17 84 31 5 191 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GDC0 6.99e-17 87 24 23 532 3 SAR2766 Putative ABC transporter ATP-binding protein SAR2766 Staphylococcus aureus (strain MRSA252)
A1TXH7 8.07e-17 86 30 5 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 8.24e-13 73 28 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9HT73 8.37e-17 84 34 5 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 6.36e-09 60 23 6 239 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 8.37e-17 84 34 5 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 6.36e-09 60 23 6 239 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2SPI3 8.96e-17 84 33 6 193 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 2.39e-08 58 23 4 230 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q6D4A8 1.04e-16 83 32 5 192 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5V6B8 1.05e-16 84 31 8 205 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q32HA3 1.28e-16 83 30 4 192 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q83KR7 1.34e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.34e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q3Z2L6 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.71e-16 83 33 6 192 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.71e-16 83 33 6 192 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q6HG98 1.76e-16 86 24 17 524 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 3.99e-08 60 29 6 202 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8TSC8 2.37e-16 86 22 19 541 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 2.04e-07 57 26 7 206 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 1.64e-06 55 24 10 243 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O34946 2.39e-16 82 28 7 209 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 3.41e-15 79 25 6 250 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
A0PY57 2.47e-16 84 25 6 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
A0PY57 9.58e-07 55 24 6 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q8KLG1 2.72e-16 84 30 5 230 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 1.89e-06 53 24 8 242 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q31I51 2.8e-16 82 31 6 194 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 4.34e-13 73 24 5 228 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7N545 2.8e-16 82 31 5 187 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0K9I2 3.77e-16 83 33 6 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K9I2 4.23e-13 73 27 5 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5WKG4 3.98e-16 82 30 8 210 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 3.86e-12 70 27 7 243 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q0S0X2 4.03e-16 82 31 6 207 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 2.43e-11 68 26 7 233 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
O86751 4.59e-16 83 27 5 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O86751 2.09e-10 66 27 11 272 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9WXX8 4.97e-16 81 30 5 184 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 7.77e-09 60 24 5 234 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q13ZJ1 5.15e-16 82 32 5 211 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 4.8e-07 55 25 6 223 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q576K0 5.2e-16 82 32 3 187 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 5.2e-16 82 32 3 187 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q0SRL2 5.42e-16 83 25 6 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 1.09e-08 61 25 6 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q897I2 5.55e-16 84 23 14 395 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.96e-06 54 24 7 238 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q8Z5W6 5.57e-16 81 31 5 192 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8XIZ5 6.16e-16 83 25 6 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q8XIZ5 7.54e-09 61 25 6 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 6.16e-16 83 25 6 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ3 7.54e-09 61 25 6 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3JSQ0 6.26e-16 82 34 6 201 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 2.67e-08 59 25 7 229 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 6.26e-16 82 34 6 201 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 2.67e-08 59 25 7 229 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q88ZZ2 6.43e-16 84 23 17 534 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q63TX3 6.81e-16 82 34 6 201 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 2.85e-08 59 25 7 229 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q88AS5 7.24e-16 82 29 8 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 1.7e-13 75 31 7 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21XJ9 7.57e-16 81 34 4 184 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 1.55e-09 62 26 7 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2SVP3 8.05e-16 82 34 6 201 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 3.09e-08 59 25 7 226 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7MMN0 8.14e-16 81 31 4 182 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 8.14e-16 81 31 4 182 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q9PAP0 8.2e-16 80 29 6 206 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xylella fastidiosa (strain 9a5c)
Q4K441 8.32e-16 81 32 4 188 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K441 2.69e-06 53 35 1 87 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8FV85 8.57e-16 83 30 8 228 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 1.71e-09 63 25 8 230 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 8.57e-16 83 30 8 228 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 1.71e-09 63 25 8 230 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 8.57e-16 83 30 8 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 1.71e-09 63 25 8 230 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 8.57e-16 83 30 8 228 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 1.71e-09 63 25 8 230 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q99QV7 8.76e-16 84 24 19 523 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 8.76e-16 84 24 19 523 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q5HCL3 9.39e-16 84 24 19 523 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q5X627 1.19e-15 82 27 9 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 3.3e-12 72 30 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q81N53 1.25e-15 84 24 18 524 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 1.03e-08 62 30 6 202 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q6LV32 1.64e-15 80 31 7 204 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q0VTB6 1.94e-15 80 32 4 192 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2J3F7 1.95e-15 78 32 6 176 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain HaA2)
Q2J3F7 0.000385 45 26 6 199 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain HaA2)
Q87UI3 2.04e-15 80 32 5 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 7.52e-11 66 26 5 230 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8FUU5 2.18e-15 80 32 3 187 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q13DS7 2.59e-15 78 31 5 176 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q13DS7 0.00066 45 29 5 162 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q8K9M6 2.61e-15 79 32 5 196 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9M6 9.75e-07 53 24 6 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5NQX0 2.69e-15 79 33 4 165 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q87PH3 3.32e-15 81 29 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87PH3 3.35e-09 62 24 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q14Q07 3.49e-15 80 32 7 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 6.12e-10 65 26 7 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q7N3S7 3.6e-15 79 31 7 200 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1LNM0 3.69e-15 80 33 6 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 1.01e-08 60 26 6 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q93DX8 3.88e-15 79 30 8 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 8.06e-10 63 32 8 177 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q4UJW5 3.97e-15 78 30 6 189 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q4UJW5 1.66e-08 59 24 6 225 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6NDA6 4.1e-15 77 31 4 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0SBZ1 5.15e-15 80 28 5 214 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 9.37e-07 55 22 3 237 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q65E55 5.59e-15 81 23 21 571 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6D4E2 5.75e-15 80 29 7 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4E2 1.23e-08 61 24 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JRI2 5.76e-15 78 31 5 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 6.67e-07 54 22 5 219 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q81CT8 6.17e-15 81 21 20 532 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 7.19e-09 62 25 8 248 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 1.51e-05 51 24 5 201 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8YDJ8 6.41e-15 79 31 3 187 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q48CA0 6.63e-15 79 31 4 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 1.46e-11 68 27 5 230 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3SQ65 6.66e-15 79 32 5 181 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q39GT7 7.06e-15 79 33 6 199 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.45e-07 57 25 7 229 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9KP42 7.11e-15 78 33 7 183 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O70014 7.3e-15 78 31 6 194 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
O70014 6.18e-08 57 26 8 244 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q32AY3 7.37e-15 78 31 6 194 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q32AY3 1.21e-07 57 25 7 231 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q6G2E2 7.41e-15 79 27 7 241 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6G2E2 5.85e-07 55 24 11 274 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8NUH8 7.49e-15 81 23 19 523 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 7.49e-15 81 23 19 523 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q1R597 8.17e-15 78 31 6 194 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q1R597 1.54e-07 56 25 7 231 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q0S0Z3 8.21e-15 79 28 5 214 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 7.5e-07 55 22 3 237 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q92G36 8.23e-15 77 30 5 185 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q92G36 2.27e-08 58 24 7 223 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZCC4 8.31e-15 77 31 6 194 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q9ZCC4 8.81e-07 53 22 5 221 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q8FCJ1 8.73e-15 78 31 6 194 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCJ1 2.14e-07 56 25 7 231 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 8.73e-15 78 31 6 194 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBU8 2.14e-07 56 25 7 231 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5E586 9.04e-15 80 25 13 346 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E586 4.19e-11 68 21 4 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
P27675 9.22e-15 77 25 5 243 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P27675 7.95e-08 57 26 9 195 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q4ZLS1 9.3e-15 78 31 4 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZLS1 4.52e-11 67 26 5 230 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q7N3Q4 9.3e-15 78 36 7 179 3 btuD Vitamin B12 import ATP-binding protein BtuD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3Q4 3.7e-06 52 25 6 218 3 btuD Vitamin B12 import ATP-binding protein BtuD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0RYP7 9.77e-15 79 28 5 214 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0RYP7 1.32e-06 54 22 3 237 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q7MKU3 1e-14 79 29 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q7MKU3 5.91e-10 65 23 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1e-14 79 29 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8D9J4 5.91e-10 65 23 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q97ZT9 1.01e-14 78 26 7 264 3 pstB Phosphate import ATP-binding protein PstB Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97ZT9 6.44e-11 66 26 7 218 3 pstB Phosphate import ATP-binding protein PstB Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q1BWI2 1.03e-14 79 33 6 199 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 4.93e-07 55 24 7 229 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q3J1N0 1.1e-14 79 27 6 231 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J1N0 3.02e-07 56 27 8 233 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8U648 1.18e-14 77 34 8 195 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U648 2.14e-12 71 24 4 232 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5ZWE4 1.19e-14 79 27 9 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 3.15e-12 72 29 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q18AM3 1.23e-14 79 25 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q18AM3 5.48e-11 68 27 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q46ZU5 1.24e-14 78 30 5 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 1.21e-10 66 28 6 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2P7S3 1.43e-14 79 27 7 258 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P7S3 5.13e-06 52 25 8 211 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q6LK87 1.44e-14 79 26 8 242 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q6LK87 2.54e-08 60 28 8 190 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q83F44 1.45e-14 79 28 6 232 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83F44 1.05e-05 51 25 6 197 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8X5N2 1.46e-14 77 31 6 194 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8X5N2 8.3e-08 57 25 7 231 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
P94367 1.51e-14 80 32 9 198 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
P94367 0.000452 47 23 9 264 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
P74981 1.55e-14 77 32 5 173 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q7MFC4 1.57e-14 79 27 9 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q7MFC4 7.38e-09 61 28 7 182 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 1.57e-14 79 27 9 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q8D3V0 7.38e-09 61 28 7 182 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q8PUE7 1.61e-14 80 23 21 517 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 3.67e-06 53 22 7 234 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9KL04 1.83e-14 79 26 8 241 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KL04 1.34e-08 60 30 8 177 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0BMC9 1.86e-14 79 26 5 232 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q0BMC9 5.6e-05 49 25 7 190 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.86e-14 79 26 5 232 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q2A3Z2 5.6e-05 49 25 7 190 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q2NTI7 1.87e-14 77 31 3 183 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q11D92 1.99e-14 77 32 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
P26050 2.18e-14 77 33 6 204 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 1.54e-07 57 27 5 193 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1CJG3 2.19e-14 77 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.91e-08 59 22 5 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 2.19e-14 77 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.91e-08 59 22 5 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 2.19e-14 77 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.91e-08 59 22 5 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 2.21e-14 77 31 3 190 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 2.13e-08 59 22 5 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q11B53 2.29e-14 77 33 3 191 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
Q39GW5 2.32e-14 78 33 5 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GW5 8.28e-08 58 26 7 234 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P31134 2.53e-14 78 32 7 199 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 1.21e-07 58 25 7 221 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q1CDR0 2.54e-14 77 33 4 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDR0 7.2e-11 67 26 7 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 2.54e-14 77 33 4 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q74PI5 7.2e-11 67 26 7 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 2.54e-14 77 33 4 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1S0 7.2e-11 67 26 7 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q6MU19 2.6e-14 78 28 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 1.61e-11 69 23 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q1IGL4 2.63e-14 77 32 4 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q1IGL4 2.42e-09 62 27 5 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q72D73 2.8e-14 77 29 7 226 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 7.15e-10 63 27 4 225 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9I6T2 3.02e-14 78 30 8 221 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6T2 2.64e-08 60 29 6 173 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q737I0 3.06e-14 79 22 19 499 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 0.000165 48 24 5 201 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q665B6 3.13e-14 77 33 4 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q665B6 5.46e-11 67 25 6 225 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2SSS4 3.21e-14 78 28 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 1.04e-11 70 23 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6D201 3.27e-14 77 35 5 176 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 1.78e-13 75 29 10 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9PKX1 3.41e-14 76 27 8 213 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q5H503 3.42e-14 77 26 7 258 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H503 6.58e-06 52 25 8 211 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q1LKJ2 3.49e-14 77 33 4 176 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 4.32e-07 55 21 5 238 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5NFU5 3.55e-14 77 26 5 232 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NFU5 0.000119 48 25 7 190 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q8KZQ6 3.89e-14 76 34 5 178 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8KZQ6 6.25e-10 63 28 8 232 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q5WXF0 3.91e-14 77 27 9 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5WXF0 7.23e-12 70 29 4 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q1CMQ3 3.94e-14 75 31 6 192 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 3.94e-14 75 31 6 192 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 3.94e-14 75 31 6 192 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q6AJW3 4e-14 79 26 12 298 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q1BWL4 4.11e-14 77 33 5 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
Q1BWL4 2.94e-08 59 26 6 234 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 4.11e-14 77 33 5 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
A0K739 2.94e-08 59 26 6 234 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q664X5 4.68e-14 77 25 7 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q664X5 8.39e-08 58 27 6 189 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 4.68e-14 77 25 7 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CNR8 8.39e-08 58 27 6 189 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 4.68e-14 77 25 7 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q8ZAS8 8.39e-08 58 27 6 189 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 4.68e-14 77 25 7 238 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CC21 8.39e-08 58 27 6 189 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
P55476 4.91e-14 77 29 5 209 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 2.25e-07 57 26 7 231 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1M7W6 5.18e-14 77 31 3 191 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 8.64e-06 51 25 8 238 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q82MV1 5.49e-14 75 32 6 182 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82MV1 1.57e-09 62 26 6 233 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q66EN1 5.59e-14 75 31 6 192 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q14H97 5.75e-14 77 26 5 232 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q14H97 0.000176 47 25 7 190 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q6LR20 6.01e-14 77 30 6 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q6LR20 7.66e-10 64 22 5 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q31VE6 6.09e-14 75 26 9 287 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 1.48e-09 62 28 8 218 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q4KKK8 6.31e-14 77 26 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK8 3.21e-06 53 26 7 211 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0VQQ0 6.63e-14 75 30 6 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VQQ0 3.1e-06 52 26 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0SZJ3 6.74e-14 75 26 8 272 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q0SZJ3 1.7e-08 59 27 8 219 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q87GB5 6.76e-14 77 26 9 244 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87GB5 8.91e-10 64 29 7 180 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q89ER4 7.23e-14 75 27 4 233 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89ER4 2.77e-08 59 33 7 162 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6F0V4 7.29e-14 77 29 6 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6F0V4 1.28e-11 70 24 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6NBT1 7.42e-14 77 25 4 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBT1 1.66e-08 60 30 7 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q87SV4 8.34e-14 74 30 8 212 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q83J77 8.36e-14 75 26 8 272 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q83J77 1.91e-08 59 27 8 219 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q8E8K8 9.23e-14 76 29 7 223 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8E8K8 6.04e-09 62 30 7 191 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8UH62 9.24e-14 76 29 10 246 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 3.7e-12 71 31 5 197 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0SIB7 9.59e-14 75 32 6 199 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q0SIB7 4.71e-12 70 29 7 228 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q1LLP5 1.13e-13 76 31 7 185 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LLP5 2.75e-08 60 25 9 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1IKM7 1.14e-13 74 31 7 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q1IKM7 1.65e-08 58 26 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q8EB59 1.16e-13 74 32 7 198 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EB59 5.65e-08 57 25 6 232 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9G4F5 1.19e-13 76 28 9 230 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 1.89e-11 69 32 7 183 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q3K506 1.4e-13 74 31 3 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3K506 2.08e-09 62 26 5 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q21BU8 1.41e-13 76 29 8 243 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q21BU8 1.01e-08 61 27 7 200 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q8PGE8 1.46e-13 75 27 7 258 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q8PGE8 4.66e-06 52 25 10 237 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q6D3Q6 1.49e-13 75 25 6 250 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3Q6 3.84e-09 62 27 9 228 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1RGL1 1.53e-13 73 30 5 189 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 1.26e-07 56 24 6 216 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q9KS33 1.56e-13 76 28 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KS33 2.84e-11 69 24 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P49938 1.76e-13 74 28 4 194 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P49938 1.08e-07 57 23 6 236 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
Q82JY6 1.76e-13 75 25 6 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 9.54e-10 64 31 6 185 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q7NWX3 2e-13 75 32 3 172 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 6.3e-08 58 24 7 227 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3BNZ3 2.02e-13 75 26 7 258 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BNZ3 6.82e-06 52 25 10 237 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q7W9U5 2.04e-13 75 28 6 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W9U5 2e-11 69 32 7 183 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8YEM5 2.04e-13 73 27 5 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q89UD2 2.08e-13 75 27 8 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 4.7e-10 65 30 8 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q4ZZK0 2.16e-13 75 26 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZK0 4.68e-05 49 25 6 193 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q5DZC6 2.24e-13 75 26 9 239 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5DZC6 1.91e-08 60 29 8 181 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q68Y13 2.32e-13 73 30 5 192 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q68Y13 9.09e-08 57 21 5 232 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q3M5J9 2.32e-13 73 33 6 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 4.53e-09 61 26 7 234 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8RI39 2.36e-13 75 28 6 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RI39 7.22e-10 65 26 8 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q46RX0 2.38e-13 73 30 3 189 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q31FG2 2.42e-13 76 27 7 218 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q830W6 2.45e-13 75 25 9 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 1.83e-09 63 26 6 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q92P76 2.47e-13 74 32 6 180 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q00564 2.48e-13 77 31 9 236 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q00564 5.99e-13 75 30 7 175 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q87AL9 2.58e-13 75 25 6 268 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87AL9 0.001 45 22 6 199 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7WGW1 2.6e-13 75 28 6 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WGW1 2.06e-11 69 32 7 183 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q92VJ2 2.79e-13 75 32 5 179 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 7.58e-12 70 25 9 266 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q13RD3 2.87e-13 73 35 8 182 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paraburkholderia xenovorans (strain LB400)
Q7N986 2.88e-13 75 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N986 7.89e-08 58 28 7 185 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O51587 3.07e-13 75 26 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O51587 9.32e-11 67 24 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q146E7 3.07e-13 73 33 5 170 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q146E7 7.81e-06 51 27 9 229 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q5HIL5 3.07e-13 75 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q5HIL5 1.82e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 3.07e-13 75 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G0V2 1.82e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 3.07e-13 75 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q2FJI0 1.82e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q46ZM0 3.1e-13 75 28 8 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZM0 1.28e-07 57 24 8 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O31427 3.13e-13 73 27 4 193 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
O31427 6.5e-11 66 26 8 246 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q88CL2 3.14e-13 74 28 8 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88CL2 2.03e-11 69 30 7 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O05779 3.18e-13 73 32 8 188 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O05779 1.36e-11 68 30 9 233 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9K876 3.2e-13 75 28 7 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 4.13e-11 68 28 6 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0K998 3.26e-13 75 29 8 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K998 3.42e-07 56 24 8 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0BFQ0 3.28e-13 74 36 5 165 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFQ0 2.96e-07 56 25 6 237 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A5U7B7 3.34e-13 72 32 8 188 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A5U7B7 1.3e-11 68 30 9 233 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P37774 3.46e-13 73 27 10 243 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 1.05e-11 68 24 6 241 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q660M8 3.79e-13 74 26 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q660M8 8.29e-11 67 24 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q3YW48 3.98e-13 73 25 7 272 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 2.08e-09 62 28 8 218 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q88RL5 4.15e-13 74 25 4 227 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL5 2.65e-05 50 23 6 211 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6LTB1 4.32e-13 73 28 4 196 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 9.62e-09 60 22 5 236 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
P78966 4.32e-13 76 28 6 224 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.98e-10 68 27 9 205 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.6e-08 62 24 6 233 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1MEG2 4.48e-13 73 35 7 177 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q32AQ1 4.49e-13 73 26 6 246 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q32AQ1 3.92e-10 64 27 9 232 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q52815 4.52e-13 73 23 8 246 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q52815 4.36e-08 58 27 11 217 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9Z3I3 4.62e-13 73 32 7 205 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 1.12e-06 54 26 5 193 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q88R93 4.89e-13 73 34 5 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 1.5e-06 53 35 1 87 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8XZQ4 4.9e-13 73 33 5 182 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZQ4 8.19e-10 63 25 6 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2GE91 4.9e-13 72 32 6 179 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q2GE91 6.85e-08 57 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
P56344 4.95e-13 72 30 8 226 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 3.82e-10 63 29 7 212 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q8G358 5.08e-13 72 27 4 184 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella suis biovar 1 (strain 1330)
Q57FS7 5.08e-13 72 27 4 184 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus biovar 1 (strain 9-941)
Q2YNU0 5.08e-13 72 27 4 184 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus (strain 2308)
Q72FW5 5.15e-13 74 24 5 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 5.88e-09 62 26 5 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0TA26 5.17e-13 74 26 9 240 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TA26 1.49e-08 60 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q471U2 5.34e-13 72 31 7 195 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q471U2 0.000693 45 23 8 230 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P77622 5.59e-13 73 30 7 185 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P77622 6e-07 55 38 1 81 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q3YSK9 5.72e-13 72 24 3 209 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q3YSK9 2.97e-09 61 21 4 233 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q7MPC5 5.94e-13 72 32 6 180 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 5.94e-13 72 32 6 180 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
P08720 5.94e-13 73 30 3 191 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 8.09e-05 48 25 8 238 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q4K681 6.13e-13 74 29 7 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K681 2.84e-09 63 32 8 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q57554 6.29e-13 72 25 6 250 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57554 4.13e-10 64 24 5 181 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P63354 6.3e-13 74 27 9 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 2.27e-11 69 32 5 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 6.3e-13 74 27 9 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 2.27e-11 69 32 5 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YVT7 6.37e-13 73 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YVT7 1.5e-05 51 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1QE80 6.58e-13 74 28 6 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 4.33e-10 65 25 9 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q7VZE5 6.63e-13 73 27 6 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZE5 1.95e-11 69 32 7 183 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0SML1 6.66e-13 73 26 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0SML1 1.42e-10 67 24 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q1IGZ0 6.73e-13 73 27 6 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q1IGZ0 1.64e-05 51 24 8 218 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
P45769 6.89e-13 72 26 8 236 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P45769 1.47e-05 50 27 9 196 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q9I6L0 6.9e-13 73 27 7 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 1.49e-11 69 30 7 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O65934 6.98e-13 75 30 9 219 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O65934 9.1e-06 52 23 6 221 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9KQB8 7.02e-13 72 28 5 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q02QT1 7.02e-13 72 35 3 164 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02QT1 4.78e-10 64 26 5 225 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8CQS7 7.37e-13 73 26 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CQS7 0.000323 47 22 9 275 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 7.37e-13 73 26 6 222 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HRU5 0.000323 47 22 9 275 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0LCH8 7.48e-13 72 34 6 197 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 2e-12 71 24 4 215 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q24XJ2 7.62e-13 73 24 7 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q24XJ2 3.42e-08 59 27 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q63TY1 7.96e-13 73 29 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q63TY1 8e-11 67 32 8 177 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
P57383 7.97e-13 71 27 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O34756 8.06e-13 72 32 11 234 3 yjkB Putative ABC transporter ATP-binding protein YjkB Bacillus subtilis (strain 168)
Q7UBD0 8.27e-13 73 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q7UBD0 1.09e-08 61 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q62K82 8.49e-13 73 29 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q62K82 9.08e-11 67 32 8 177 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q6GJL2 8.53e-13 73 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q6GJL2 1.99e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q48PN3 8.8e-13 73 26 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PN3 1.25e-06 54 24 10 282 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q734T1 8.9e-13 74 25 13 406 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q734T1 1.09e-06 55 30 6 202 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
P33594 8.96e-13 72 24 5 247 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 1.83e-09 62 28 8 218 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q7A7E3 9e-13 73 25 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q7A7E3 1.79e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 9e-13 73 25 5 221 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99WE1 1.79e-05 50 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7UPK3 9.46e-13 72 30 9 209 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UPK3 1.52e-10 65 31 8 200 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q3YUV0 9.47e-13 73 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q3YUV0 1.1e-08 61 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 9.47e-13 73 27 10 243 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
Q1R3Q1 1.1e-08 61 31 7 174 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 9.47e-13 73 27 10 243 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68187 1.1e-08 61 31 7 174 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
Q8FB37 9.47e-13 73 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FB37 1.06e-08 61 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P68188 9.47e-13 73 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
P68188 1.1e-08 61 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q03ZL6 9.55e-13 72 30 7 196 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZL6 0.000133 47 26 10 234 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9TKX3 9.59e-13 73 28 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 3.06e-09 62 27 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
P44656 9.65e-13 71 28 5 189 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U8D6 9.71e-13 72 28 4 198 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U8D6 4.33e-12 70 28 5 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7UX73 9.8e-13 71 33 8 201 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UX73 6.69e-05 48 25 8 211 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9HYG4 9.82e-13 72 35 3 164 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HYG4 5.23e-09 61 25 5 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8NY21 9.86e-13 73 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q8NY21 1.19e-05 51 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 9.86e-13 73 26 7 223 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q6GC27 1.19e-05 51 24 6 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q4QK57 9.89e-13 73 25 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4QK57 4.41e-12 71 28 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q5X484 1e-12 73 27 6 237 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q5X484 3.27e-08 59 27 7 205 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
P44986 1.03e-12 71 32 8 217 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I3Y9 1.04e-12 73 28 8 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q0I3Y9 4.55e-11 68 23 5 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
P45171 1.06e-12 73 25 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 4.49e-12 71 28 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SXQ1 1.09e-12 73 26 9 241 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q0SXQ1 6.52e-09 62 31 7 174 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
P75370 1.14e-12 71 24 6 236 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 1.86e-10 65 24 5 205 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5PKZ8 1.17e-12 73 27 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PKZ8 3.88e-08 59 31 9 175 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0I4A9 1.17e-12 72 29 6 220 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q0I4A9 2.68e-07 55 29 3 186 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q66FK0 1.17e-12 72 30 7 201 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66FK0 1.12e-08 60 26 6 228 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 1.17e-12 72 30 7 201 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CE65 1.12e-08 60 26 6 228 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 1.17e-12 72 30 7 201 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q56993 1.12e-08 60 26 6 228 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 1.17e-12 72 30 7 201 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0Q8 1.12e-08 60 26 6 228 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q9PF03 1.23e-12 73 25 7 269 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q5WVL8 1.26e-12 73 26 5 236 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q5WVL8 2.23e-07 57 27 7 205 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q9V2C0 1.28e-12 73 35 9 173 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2C0 0.000398 46 25 4 182 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q1R5D8 1.31e-12 72 26 6 246 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q1R5D8 5.73e-10 63 27 9 232 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 1.31e-12 72 26 6 246 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCM9 5.73e-10 63 27 9 232 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 1.31e-12 72 26 6 246 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBX8 5.73e-10 63 27 9 232 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5LUR8 1.32e-12 71 29 4 199 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5L222 1.33e-12 73 26 4 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 2.66e-09 63 23 6 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
D4GP38 1.35e-12 73 25 5 245 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GP38 6.23e-08 58 25 5 208 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5ZUG5 1.36e-12 73 26 5 236 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZUG5 2.17e-07 57 27 7 205 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9KLL9 1.38e-12 73 31 6 169 3 modC Molybdenum import ATP-binding protein ModC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLL9 2.84e-07 56 37 1 81 3 modC Molybdenum import ATP-binding protein ModC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0A9E2 1.42e-12 71 34 4 166 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 3.18e-10 64 25 7 237 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3KJS6 1.44e-12 73 27 7 225 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q3KJS6 5.88e-07 55 25 12 286 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q6DB03 1.5e-12 73 24 23 512 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q02R79 1.55e-12 73 29 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 1.82e-08 60 26 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 1.55e-12 73 29 5 196 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 1.86e-08 60 26 5 224 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31339 1.65e-12 72 28 7 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 8.64e-11 67 31 6 177 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q65QT6 1.68e-12 73 25 4 236 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65QT6 8.23e-10 64 29 3 170 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2K6Q4 1.71e-12 72 30 3 186 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7NX01 1.72e-12 72 29 10 231 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 5.48e-12 71 32 7 213 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5PMK1 1.74e-12 73 29 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 2.15e-08 60 23 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P72335 1.79e-12 72 30 5 196 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 3.12e-08 59 25 5 236 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q39IE7 1.81e-12 72 28 7 239 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39IE7 4.01e-06 53 22 9 263 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P54954 1.81e-12 71 28 9 212 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
P54954 2.44e-09 62 24 6 237 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q2RZ08 1.82e-12 71 31 8 216 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
Q74DN5 1.86e-12 71 30 7 199 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 4.21e-09 61 27 5 224 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q65V02 1.86e-12 70 30 5 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Z7H7 1.88e-12 72 29 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 2.19e-08 60 23 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
O34814 1.9e-12 70 28 7 196 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
O34814 2.42e-11 67 25 8 249 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
Q0K2U3 2.01e-12 71 30 8 201 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5X2Z8 2.13e-12 70 27 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q5X2Z8 0.000194 47 23 8 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q8Z1U0 2.16e-12 72 26 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q8Z1U0 3.43e-08 59 31 9 175 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q5WUF8 2.17e-12 70 27 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q9CJB8 2.21e-12 73 27 7 192 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9CJB8 1.95e-11 70 29 9 236 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q8X4L6 2.23e-12 71 25 6 246 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8X4L6 3.26e-10 64 27 9 232 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8D385 2.28e-12 70 30 3 161 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8D385 4.77e-07 54 24 7 235 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
P40790 2.34e-12 72 29 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 2.29e-08 60 23 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.34e-12 72 29 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 2.29e-08 60 23 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q8NR42 2.4e-12 70 34 6 177 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR42 3.19e-07 55 26 6 218 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O57872 2.45e-12 70 31 6 187 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 0.000142 47 25 11 251 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q92XW1 2.46e-12 72 33 5 173 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92XW1 2.7e-10 65 25 7 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q4QLQ1 2.52e-12 70 30 7 217 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q2W4W1 2.55e-12 70 37 6 170 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W4W1 2.18e-08 59 25 6 234 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P19566 2.58e-12 72 26 10 243 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19566 4.02e-08 59 31 9 175 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 2.58e-12 72 26 10 243 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q57GZ7 4.02e-08 59 31 9 175 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q6CYU2 2.69e-12 70 31 3 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 1.03e-05 51 33 1 87 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7RX59 2.72e-12 73 30 7 192 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7RX59 0.00018 48 23 3 181 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1B9Q7 2.75e-12 72 29 6 196 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
A1B9Q7 5.41e-11 68 25 6 225 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q2HIE9 2.8e-12 73 28 8 203 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HIE9 6.72e-07 56 27 7 225 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q8XZX8 2.8e-12 72 31 6 184 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZX8 1.33e-07 57 23 6 234 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q30V33 2.88e-12 72 26 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q30V33 1.55e-11 70 28 5 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q13GD4 2.89e-12 70 30 6 200 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Paraburkholderia xenovorans (strain LB400)
Q9CPN2 2.91e-12 69 31 5 177 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pasteurella multocida (strain Pm70)
Q6AE21 2.94e-12 72 27 9 233 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q6AE21 5.3e-07 55 24 6 219 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q8UF79 3.07e-12 71 29 3 196 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UF79 0.000192 47 25 5 229 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
P77795 3.11e-12 72 30 6 194 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
P77795 1.05e-09 63 22 10 322 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
O85818 3.13e-12 72 23 4 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
O85818 2.38e-11 69 27 7 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q6F9A8 3.18e-12 72 28 8 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9A8 1.25e-10 67 31 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q97T09 3.24e-12 72 26 5 217 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97T09 1.33e-05 51 25 5 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9Z3R9 3.28e-12 72 30 8 196 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q9Z3R9 8.83e-08 58 24 8 230 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q1GAD3 3.39e-12 70 31 8 225 3 pstB Phosphate import ATP-binding protein PstB Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GAD3 5.9e-06 51 29 11 193 3 pstB Phosphate import ATP-binding protein PstB Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1QH37 3.6e-12 73 31 11 243 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5ZT78 3.69e-12 69 27 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZT78 0.000235 46 23 8 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q57399 3.77e-12 70 31 7 169 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57399 8.19e-06 51 24 8 216 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4FTM3 3.8e-12 69 31 4 179 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 2.62e-07 55 24 4 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
O52618 3.87e-12 71 30 5 207 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 6.36e-07 55 25 6 236 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q1MQ44 3.92e-12 72 29 8 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q1MQ44 7.01e-11 68 25 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
P47532 3.93e-12 70 24 7 238 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47532 2.84e-08 58 24 5 205 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q58762 3.96e-12 70 32 8 178 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58762 2.7e-10 65 24 10 277 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q97KD5 3.97e-12 71 28 9 227 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2YQP3 4.04e-12 70 29 5 203 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q2YQP3 2.72e-08 58 27 6 226 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q57CD8 4.04e-12 70 29 5 203 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q57CD8 2.72e-08 58 27 6 226 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q3KK97 4.08e-12 71 26 5 238 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q3KK97 4.27e-05 49 25 7 221 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q9Z8J5 4.11e-12 70 28 8 207 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q2NSR0 4.13e-12 70 29 6 197 3 hmuV Hemin import ATP-binding protein HmuV Sodalis glossinidius (strain morsitans)
Q7VNG4 4.18e-12 71 24 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VNG4 2.97e-08 59 25 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CP06 4.23e-12 71 24 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 7.94e-12 70 27 5 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q84EY8 4.31e-12 70 29 6 197 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q4KK46 4.39e-12 71 27 7 225 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KK46 2.7e-06 53 26 6 193 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5JEB0 4.4e-12 71 33 4 148 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 1.21e-05 51 23 5 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q87UV4 4.4e-12 71 26 6 219 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UV4 1.72e-05 51 25 6 193 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2K4V4 4.52e-12 71 22 6 237 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K4V4 1.37e-08 60 26 6 190 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5FQN4 4.56e-12 69 29 4 192 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q8PNN4 4.57e-12 71 26 8 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 3.5e-10 65 31 7 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q28VL7 4.6e-12 69 31 6 180 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q6D645 4.73e-12 70 30 6 195 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2GFZ6 4.88e-12 69 25 4 208 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q2GFZ6 5.93e-10 63 21 4 233 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q9HX79 4.96e-12 70 31 7 200 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YAD6 5.09e-12 71 30 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 5.8e-07 55 24 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q1BY14 5.1e-12 71 27 5 241 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
Q1BY14 5.77e-06 52 23 9 263 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 5.1e-12 71 27 5 241 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
A0K5N5 5.77e-06 52 23 9 263 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q9KD30 5.15e-12 69 29 8 202 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8ENU2 5.25e-12 71 26 10 275 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENU2 7.57e-07 55 24 7 212 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q13ZK7 5.3e-12 71 33 5 173 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q13ZK7 8.31e-06 52 23 6 238 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
P0C0E2 5.51e-12 69 26 5 225 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 1.71e-11 67 27 7 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 5.51e-12 69 26 5 225 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 1.71e-11 67 27 7 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03670
Feature type CDS
Gene uup
Product ABC transporter ATP-binding protein
Location 41104 - 43023 (strand: -1)
Length 1920 (nucleotides) / 639 (amino acids)

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1254
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter
PF16326 ABC transporter C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15738 ABC transport system ATP-binding/permease protein - -

Protein Sequence

MSLINMAGAWLAFSDAPLLENAEMHIEENERVCLVGRNGAGKSTLMRVLTKEQPLDDGTVIYEQDLIVARLQQDPPRDVEGTVFDFVAEGVAEQAQHIKAFHQISKLVESDPSDKNLSKMAELQEILDTQNLWLLDSRIADVIAHLELPADEKLSALSGGWLRKAALGRALVSGPKVLFLDEPTNHLDIETIQWLESFLKNFSGSIVFISHDRSFIRNMATRIIDLDRGKLASWPGSYDDYLVAKEEALRVEEMQNAEFDRKLAQEEVWIRQGIKARRTRNEGRVRALKALRSERAERREVMGKAKMQVEEATRSGKIVFEIDDISYGIDGKDLVSHFSAQVNRGDKIALVGPNGCGKTTLLKLMLGDLQPDDGSVHIGTKLEVAYFDQHRAALDPDKTVMDNLAEGKQEVLVNGKPRHVLGYLQEFLFHPKRARTPVRALSGGERNRLLLARLFLKPSNLLILDEPTNDLDVETLELLEELVDNYQGTVLLVSHDRQFVDNCVTECWIFEGNGTIGRYVGGYFDAQQQRAQVQSLKAPAEKAAKPEAAEEKRKDNIKKANTSAKLSYKLQRELEQLPSLLESLDEEIQQLQSQVSAPEFFNQPHDETDKVLKLLAEKEHALEEAFERWQTLEAMQSGN

Flanking regions ( +/- flanking 50bp)

ATCCATAACTGCTGGCTTATCCGCCACGCAGGCGAGGAATAACAGAAATTATGTCGTTGATTAATATGGCGGGCGCCTGGCTCGCATTCAGTGATGCTCCGCTGCTGGAAAATGCGGAGATGCATATCGAAGAAAATGAGCGTGTCTGTCTGGTCGGACGTAACGGGGCGGGAAAATCCACCCTGATGCGTGTGCTGACCAAAGAGCAGCCGCTGGATGACGGTACGGTTATCTATGAACAGGATCTGATTGTTGCCCGTCTGCAGCAGGATCCGCCGCGTGATGTGGAAGGCACCGTGTTTGACTTTGTCGCCGAAGGGGTGGCAGAGCAGGCGCAGCATATCAAGGCATTCCATCAGATCTCAAAATTAGTGGAAAGTGACCCGAGTGATAAAAATCTGTCAAAAATGGCGGAACTGCAGGAAATTTTAGACACTCAGAATTTATGGCTGCTCGACAGCCGGATCGCGGATGTGATCGCGCACCTGGAATTACCGGCGGATGAAAAATTATCCGCACTGTCCGGCGGCTGGTTGCGTAAAGCGGCACTCGGCCGTGCACTGGTCAGCGGGCCGAAAGTGCTGTTTCTGGATGAACCGACCAACCACCTGGATATCGAAACCATCCAGTGGCTGGAAAGCTTCCTGAAAAATTTCAGCGGCAGCATTGTCTTTATTTCCCATGACCGTTCATTTATCCGCAATATGGCGACACGGATTATCGATCTGGATCGCGGTAAATTAGCCTCCTGGCCGGGCAGTTATGATGATTATCTGGTGGCCAAGGAAGAGGCACTGCGTGTCGAAGAGATGCAGAATGCGGAATTTGACCGCAAGCTGGCGCAGGAAGAAGTCTGGATCCGTCAGGGCATCAAAGCCCGCCGTACCCGTAATGAAGGGCGCGTCCGTGCCCTGAAAGCCCTGCGCAGCGAACGCGCGGAACGCCGTGAGGTGATGGGCAAAGCGAAGATGCAGGTGGAAGAGGCAACCCGTTCCGGCAAAATCGTCTTTGAAATCGATGATATCAGCTATGGTATTGATGGTAAGGATCTGGTCAGCCATTTCAGTGCTCAGGTAAACCGGGGGGACAAAATTGCCCTGGTCGGCCCGAACGGCTGCGGTAAAACCACGCTGCTGAAACTGATGCTCGGTGATTTGCAGCCGGACGACGGCAGTGTGCATATTGGTACCAAACTGGAAGTGGCTTACTTCGACCAGCACCGTGCAGCGCTGGATCCGGATAAAACGGTGATGGATAACCTGGCGGAAGGCAAACAGGAAGTGCTGGTTAATGGCAAACCACGCCATGTGCTCGGCTATTTACAGGAATTCCTGTTCCATCCGAAACGGGCGAGAACACCGGTGCGGGCCCTGTCCGGCGGGGAGCGTAACCGCCTGCTGCTGGCAAGATTGTTCCTGAAACCAAGCAACCTGCTGATCCTCGATGAACCGACCAACGACCTTGATGTCGAAACACTGGAACTGCTGGAAGAGCTGGTGGATAACTATCAGGGTACCGTCCTGCTGGTCAGCCATGATCGTCAGTTTGTTGATAACTGCGTGACCGAATGCTGGATTTTTGAAGGCAATGGCACCATCGGGCGTTATGTCGGCGGTTACTTTGATGCACAACAGCAGCGGGCACAGGTTCAGTCGCTGAAAGCGCCGGCGGAGAAAGCAGCGAAACCGGAAGCGGCGGAAGAAAAACGTAAAGATAACATTAAAAAAGCAAATACATCTGCAAAATTAAGTTATAAATTACAGCGGGAACTTGAACAACTGCCGTCATTGCTGGAATCTCTCGACGAGGAAATTCAGCAACTGCAAAGTCAGGTCAGTGCGCCTGAATTCTTTAACCAGCCGCATGATGAAACAGATAAAGTGCTGAAGCTGCTGGCAGAGAAAGAGCATGCGCTGGAAGAGGCGTTTGAGCGCTGGCAGACGCTGGAAGCAATGCAGAGCGGGAACTGATCCCGCCTGTGATTTTGGAGAAATAACGAAACAGTGTGTGTTCATCATTC