Homologs in group_1319

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07345 FBDBKF_07345 100.0 Morganella morganii S1 sulA SOS-induced cell division inhibitor SulA
EHELCC_03625 EHELCC_03625 100.0 Morganella morganii S2 sulA SOS-induced cell division inhibitor SulA
LHKJJB_09455 LHKJJB_09455 100.0 Morganella morganii S3 sulA SOS-induced cell division inhibitor SulA
HKOGLL_09520 HKOGLL_09520 100.0 Morganella morganii S5 sulA SOS-induced cell division inhibitor SulA
F4V73_RS01530 F4V73_RS01530 80.4 Morganella psychrotolerans sulA SOS-induced cell division inhibitor SulA
PMI_RS03860 PMI_RS03860 51.5 Proteus mirabilis HI4320 sulA SOS-induced cell division inhibitor SulA

Distribution of the homologs in the orthogroup group_1319

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1319

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N601 2.2e-48 157 52 1 150 3 sulA Cell division inhibitor SulA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P08845 3.44e-42 141 56 1 141 3 sulA Cell division inhibitor SulA Serratia marcescens
A8GCL9 1.05e-40 137 55 1 141 3 sulA Cell division inhibitor SulA Serratia proteamaculans (strain 568)
B1JQQ5 4.91e-40 135 51 1 151 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CE9 4.91e-40 135 51 1 151 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FJS7 4.91e-40 135 51 1 151 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TKW3 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pestis (strain Pestoides F)
Q1CGK9 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2N0 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Angola)
Q7CHL5 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pestis
B2JYT5 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CA26 1.62e-39 134 50 1 151 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Antiqua)
C6DKX8 1.13e-34 122 51 2 141 3 sulA Cell division inhibitor SulA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D6D3 2.38e-34 121 51 2 141 3 sulA Cell division inhibitor SulA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JMT8 5.42e-34 120 51 2 142 3 sulA Cell division inhibitor SulA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1RDQ5 3.22e-31 113 43 3 166 3 sulA Cell division inhibitor SulA Escherichia coli (strain UTI89 / UPEC)
A1A9M7 3.22e-31 113 43 3 166 3 sulA Cell division inhibitor SulA Escherichia coli O1:K1 / APEC
B7MIB2 3.22e-31 113 43 3 166 3 sulA Cell division inhibitor SulA Escherichia coli O45:K1 (strain S88 / ExPEC)
Q83RX1 8.45e-31 112 45 3 150 3 sulA Cell division inhibitor SulA Shigella flexneri
Q0T677 8.45e-31 112 45 3 150 3 sulA Cell division inhibitor SulA Shigella flexneri serotype 5b (strain 8401)
Q31YM1 9.52e-31 112 45 3 150 3 sulA Cell division inhibitor SulA Shigella boydii serotype 4 (strain Sb227)
Q3Z3G3 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Shigella sonnei (strain Ss046)
B2TTT7 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LJ40 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain SMS-3-5 / SECEC)
B6I933 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain SE11)
Q1JQN1 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli
B7N3C1 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AFZ5 1.13e-30 112 45 3 150 1 sulA Cell division inhibitor SulA Escherichia coli (strain K12)
B1IVX4 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYR0 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O9:H4 (strain HS)
B1X8R2 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain K12 / DH10B)
C4ZQ84 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain K12 / MC4100 / BW2952)
B7M887 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O8 (strain IAI1)
B5YT88 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFZ6 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O157:H7
B7LE58 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli (strain 55989 / EAEC)
A7ZK62 1.13e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NM15 1.27e-30 112 45 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UN37 3.52e-30 110 42 3 166 3 sulA Cell division inhibitor SulA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P08848 4.1e-30 110 44 5 162 3 sulA Cell division inhibitor SulA Klebsiella aerogenes
Q8FJ79 9.95e-30 109 44 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJA2 9.95e-30 109 44 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MS69 9.95e-30 109 44 3 150 3 sulA Cell division inhibitor SulA Escherichia coli O81 (strain ED1a)
A8AIC1 1.12e-29 109 40 3 166 3 sulA Cell division inhibitor SulA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XY47 1.39e-29 109 44 3 147 3 sulA Cell division inhibitor SulA Klebsiella pneumoniae (strain 342)
A6T752 7.51e-29 107 41 3 167 3 sulA Cell division inhibitor SulA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
D2TDA7 1.19e-27 104 44 4 161 3 sulA Cell division inhibitor SulA Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
B5QZG1 9.65e-27 102 46 3 149 3 sulA Cell division inhibitor SulA Salmonella enteritidis PT4 (strain P125109)
B5FR01 9.65e-27 102 46 3 149 3 sulA Cell division inhibitor SulA Salmonella dublin (strain CT_02021853)
B5R6C4 9.97e-27 102 46 3 149 3 sulA Cell division inhibitor SulA Salmonella gallinarum (strain 287/91 / NCTC 13346)
P0A241 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A242 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella typhi
B4TSI4 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella schwarzengrund (strain CVM19633)
B5BBK9 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella paratyphi A (strain AKU_12601)
A9N6X0 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PGD6 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T201 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella newport (strain SL254)
B4TDZ8 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella heidelberg (strain SL476)
B5F1V5 1.97e-26 101 46 3 149 3 sulA Cell division inhibitor SulA Salmonella agona (strain SL483)
A4W8X0 4.86e-26 100 46 4 147 3 sulA Cell division inhibitor SulA Enterobacter sp. (strain 638)
C0Q8D4 1.37e-25 99 45 3 149 3 sulA Cell division inhibitor SulA Salmonella paratyphi C (strain RKS4594)
Q57QT2 1.37e-25 99 45 3 149 3 sulA Cell division inhibitor SulA Salmonella choleraesuis (strain SC-B67)
E0T4V0 1.94e-24 96 51 0 118 3 sulA Cell division inhibitor SulA Edwardsiella tarda (strain FL6-60)
D0ZFT0 1.94e-24 96 51 0 118 3 sulA Cell division inhibitor SulA Edwardsiella tarda (strain EIB202)
C9Y0Q0 4.58e-23 92 41 4 151 3 sulA Cell division inhibitor SulA Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
B7LNW8 6.55e-23 92 38 3 166 3 sulA Cell division inhibitor SulA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MHT1 1.6e-22 91 44 3 142 3 sulA Cell division inhibitor SulA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MFW4 7.06e-22 89 41 4 151 3 sulA Cell division inhibitor SulA Cronobacter sakazakii (strain ATCC BAA-894)
Q9HZJ8 0.000178 43 29 3 127 1 sulA Cell division inhibitor SulA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03625
Feature type CDS
Gene sulA
Product SOS-induced cell division inhibitor SulA
Location 31896 - 32402 (strand: 1)
Length 507 (nucleotides) / 168 (amino acids)
In genomic island -

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1319
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03846 Cell division inhibitor SulA

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5404 Cell cycle control, cell division, chromosome partitioning (D) D Cell division inhibitor SulA, prevents FtsZ ring assembly

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13053 cell division inhibitor SulA - -

Protein Sequence

MRQQATREYVPVTPASVSPALAEERRLNGMVSELVYRNNDIVLTHILLPLLRQLAGESRWLLWLSPGAKLNRTWLSQNQLPGDKIMQLSRIPAINSVAAMEKALASGNYSVVLGWLPVLTEQENARLQRAAEQGGCLGFIMRPQEWHHDSAPVARQLNTLQIHSFPYH

Flanking regions ( +/- flanking 50bp)

GAATTGGATTATACTGTACACATATACAGTATCACTATGTGAGGTTAACTATGCGCCAGCAGGCAACCCGGGAATACGTTCCTGTTACACCGGCATCTGTGTCACCCGCCCTTGCGGAGGAACGCCGTCTGAACGGAATGGTCAGCGAACTGGTTTATCGCAATAATGATATCGTCCTGACCCACATTCTGCTTCCTTTATTACGTCAGCTTGCCGGGGAGTCCCGCTGGCTGTTATGGCTCTCTCCGGGTGCAAAACTTAACCGCACCTGGTTATCGCAGAATCAGCTGCCGGGTGATAAAATCATGCAGTTGTCCCGCATCCCGGCAATCAACAGTGTTGCCGCTATGGAGAAAGCACTCGCCAGCGGTAACTACAGTGTGGTTCTGGGCTGGCTGCCGGTACTGACTGAGCAGGAAAATGCCCGGTTACAGCGCGCTGCGGAACAGGGCGGCTGCCTCGGTTTTATTATGCGTCCGCAGGAATGGCATCATGACAGTGCACCTGTTGCACGACAACTGAATACATTACAAATTCACTCTTTCCCTTATCATTAAGGAAAATTAAGAATATTCTCAGAGTTTTTTACATGCCCGTATCATTTGCT