Homologs in group_1319

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07345 FBDBKF_07345 80.4 Morganella morganii S1 sulA SOS-induced cell division inhibitor SulA
EHELCC_03625 EHELCC_03625 80.4 Morganella morganii S2 sulA SOS-induced cell division inhibitor SulA
NLDBIP_03625 NLDBIP_03625 80.4 Morganella morganii S4 sulA SOS-induced cell division inhibitor SulA
LHKJJB_09455 LHKJJB_09455 80.4 Morganella morganii S3 sulA SOS-induced cell division inhibitor SulA
HKOGLL_09520 HKOGLL_09520 80.4 Morganella morganii S5 sulA SOS-induced cell division inhibitor SulA
PMI_RS03860 PMI_RS03860 50.9 Proteus mirabilis HI4320 sulA SOS-induced cell division inhibitor SulA

Distribution of the homologs in the orthogroup group_1319

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1319

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N601 1.24e-49 160 47 1 168 3 sulA Cell division inhibitor SulA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P08845 3.4e-39 134 51 1 140 3 sulA Cell division inhibitor SulA Serratia marcescens
A4TKW3 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pestis (strain Pestoides F)
Q1CGK9 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2N0 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Angola)
Q7CHL5 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pestis
B2JYT5 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CA26 2.23e-38 132 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pestis bv. Antiqua (strain Antiqua)
B1JQQ5 2.92e-38 131 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CE9 2.92e-38 131 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FJS7 2.92e-38 131 44 2 172 3 sulA Cell division inhibitor SulA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GCL9 9.25e-38 130 48 2 158 3 sulA Cell division inhibitor SulA Serratia proteamaculans (strain 568)
C6DKX8 1.44e-36 127 46 3 173 3 sulA Cell division inhibitor SulA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D6D3 2.96e-36 126 47 2 159 3 sulA Cell division inhibitor SulA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JMT8 8.63e-35 122 44 4 176 3 sulA Cell division inhibitor SulA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P08848 3.07e-30 111 43 5 166 3 sulA Cell division inhibitor SulA Klebsiella aerogenes
B5XY47 4.58e-30 110 42 4 163 3 sulA Cell division inhibitor SulA Klebsiella pneumoniae (strain 342)
A8AIC1 7.44e-30 110 41 4 160 3 sulA Cell division inhibitor SulA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6T752 8.94e-30 110 43 4 163 3 sulA Cell division inhibitor SulA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1RDQ5 1.28e-29 109 41 4 160 3 sulA Cell division inhibitor SulA Escherichia coli (strain UTI89 / UPEC)
A1A9M7 1.28e-29 109 41 4 160 3 sulA Cell division inhibitor SulA Escherichia coli O1:K1 / APEC
B7MIB2 1.28e-29 109 41 4 160 3 sulA Cell division inhibitor SulA Escherichia coli O45:K1 (strain S88 / ExPEC)
Q31YM1 2.08e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Shigella boydii serotype 4 (strain Sb227)
B7NM15 2.42e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3Z3G3 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Shigella sonnei (strain Ss046)
B2TTT7 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LJ40 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain SMS-3-5 / SECEC)
B6I933 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain SE11)
Q1JQN1 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli
B7N3C1 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AFZ5 2.47e-29 108 43 3 148 1 sulA Cell division inhibitor SulA Escherichia coli (strain K12)
B1IVX4 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYR0 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O9:H4 (strain HS)
B1X8R2 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain K12 / DH10B)
C4ZQ84 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain K12 / MC4100 / BW2952)
B7M887 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O8 (strain IAI1)
B5YT88 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFZ6 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O157:H7
B7LE58 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli (strain 55989 / EAEC)
A7ZK62 2.47e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83RX1 2.55e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Shigella flexneri
Q0T677 2.55e-29 108 43 3 148 3 sulA Cell division inhibitor SulA Shigella flexneri serotype 5b (strain 8401)
B7UN37 2.87e-29 108 41 4 160 3 sulA Cell division inhibitor SulA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FJ79 1.96e-28 106 42 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJA2 1.96e-28 106 42 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MS69 1.96e-28 106 42 3 148 3 sulA Cell division inhibitor SulA Escherichia coli O81 (strain ED1a)
A4W8X0 4.27e-28 105 42 4 163 3 sulA Cell division inhibitor SulA Enterobacter sp. (strain 638)
D2TDA7 3.16e-27 103 43 4 158 3 sulA Cell division inhibitor SulA Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
B5R6C4 7.44e-27 102 40 4 166 3 sulA Cell division inhibitor SulA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZG1 8.38e-27 102 40 4 166 3 sulA Cell division inhibitor SulA Salmonella enteritidis PT4 (strain P125109)
B5FR01 8.38e-27 102 40 4 166 3 sulA Cell division inhibitor SulA Salmonella dublin (strain CT_02021853)
P0A241 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A242 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella typhi
B4TSI4 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella schwarzengrund (strain CVM19633)
B5BBK9 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella paratyphi A (strain AKU_12601)
A9N6X0 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PGD6 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T201 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella newport (strain SL254)
B4TDZ8 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella heidelberg (strain SL476)
B5F1V5 1.92e-26 101 40 4 166 3 sulA Cell division inhibitor SulA Salmonella agona (strain SL483)
C0Q8D4 1.21e-25 99 39 4 166 3 sulA Cell division inhibitor SulA Salmonella paratyphi C (strain RKS4594)
Q57QT2 1.21e-25 99 39 4 166 3 sulA Cell division inhibitor SulA Salmonella choleraesuis (strain SC-B67)
E0T4V0 3.14e-24 95 49 0 118 3 sulA Cell division inhibitor SulA Edwardsiella tarda (strain FL6-60)
D0ZFT0 3.14e-24 95 49 0 118 3 sulA Cell division inhibitor SulA Edwardsiella tarda (strain EIB202)
C9Y0Q0 1.87e-23 94 38 3 150 3 sulA Cell division inhibitor SulA Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
B7LNW8 2.4e-23 93 39 4 163 3 sulA Cell division inhibitor SulA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MFW4 2.22e-22 90 37 3 151 3 sulA Cell division inhibitor SulA Cronobacter sakazakii (strain ATCC BAA-894)
A9MHT1 6.95e-22 89 40 3 142 3 sulA Cell division inhibitor SulA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01530
Feature type CDS
Gene sulA
Product SOS-induced cell division inhibitor SulA
Location 342010 - 342528 (strand: -1)
Length 519 (nucleotides) / 172 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1319
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03846 Cell division inhibitor SulA

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5404 Cell cycle control, cell division, chromosome partitioning (D) D Cell division inhibitor SulA, prevents FtsZ ring assembly

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13053 cell division inhibitor SulA - -

Protein Sequence

MRQQSTREYLPATSASASPALPRAAHSQTGTTGMVSELVYRNNDMILTHILLPLLRQFAGEPRWLLWLSPGEKLSRRWLAQNQLPRDKIMQLSRIPAINSVDAMEKALTSGNFGVVLGWLPVLTEQENYRLQQAAQRGSCLGFIMRPQEWHHDNAPVARQLNTVQIHSFSYH

Flanking regions ( +/- flanking 50bp)

AAATTGAATTGTACTGTACATTCATACAGTATCACTATGTGAGGTCAACTATGCGCCAGCAATCAACCCGGGAATATCTCCCTGCCACGTCTGCATCCGCGTCACCTGCCCTTCCGCGGGCAGCTCACTCACAAACAGGCACAACCGGTATGGTCAGCGAATTGGTTTATCGCAATAATGATATGATCCTGACTCATATCCTGCTCCCGTTGTTACGTCAGTTTGCCGGTGAACCGCGCTGGCTGCTCTGGCTGTCACCCGGAGAAAAACTCAGCCGCCGGTGGCTGGCGCAAAATCAGCTGCCCCGTGATAAAATTATGCAACTTTCCCGTATTCCGGCAATCAACAGTGTTGATGCGATGGAAAAAGCACTCACCAGTGGTAACTTCGGTGTTGTGCTCGGCTGGCTGCCGGTATTAACTGAACAGGAAAATTACCGGTTGCAACAGGCGGCACAGCGGGGAAGCTGCCTGGGCTTTATTATGCGGCCTCAGGAATGGCATCATGACAACGCCCCCGTGGCACGACAACTGAACACAGTACAAATTCACTCATTCTCTTACCATTAAGTAAAATTAAGAATATTCTCAGTCTTTTTTACAAGCCCGTATCATTTACC