Homologs in group_3640

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20640 FBDBKF_20640 100.0 Morganella morganii S1 sul1 sulfonamide-resistant dihydropteroate synthase Sul1
EHELCC_19915 EHELCC_19915 100.0 Morganella morganii S2 sul1 sulfonamide-resistant dihydropteroate synthase Sul1
NLDBIP_19915 NLDBIP_19915 100.0 Morganella morganii S4 sul1 sulfonamide-resistant dihydropteroate synthase Sul1
HKOGLL_19715 HKOGLL_19715 100.0 Morganella morganii S5 sul1 sulfonamide-resistant dihydropteroate synthase Sul1

Distribution of the homologs in the orthogroup group_3640

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3640

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0C003 0.0 550 99 0 278 3 sulI Dihydropteroate synthase type-1 Pseudomonas aeruginosa
Q49184 0.0 550 99 0 278 3 sulI Dihydropteroate synthase type-1 Mycolicibacterium fortuitum
P0C002 0.0 550 99 0 278 1 sulI Dihydropteroate synthase type-1 Escherichia coli
P0C004 0.0 550 99 0 278 3 sulI Dihydropteroate synthase type-1 Corynebacterium glutamicum
P0AC12 1.11e-74 232 53 2 256 3 sulII Dihydropteroate synthase type-2 Shigella flexneri
P0AC11 1.11e-74 232 53 2 256 1 sulII Dihydropteroate synthase type-2 Escherichia coli
P73248 4.29e-31 120 35 6 248 3 folP Dihydropteroate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0AC15 2.37e-30 118 31 4 246 3 folP Dihydropteroate synthase Shigella flexneri
P0AC13 2.37e-30 118 31 4 246 1 folP Dihydropteroate synthase Escherichia coli (strain K12)
P0AC14 2.37e-30 118 31 4 246 3 folP Dihydropteroate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0C0G0 1.85e-29 115 30 6 251 3 folP Dihydropteroate synthase Streptococcus pyogenes
Q05621 6.79e-29 114 31 7 248 3 Cbei_0206 Dihydropteroate synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P9WND1 1.04e-28 113 36 8 269 1 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WND0 1.04e-28 113 36 8 269 3 folP1 Dihydropteroate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A579 1.04e-28 113 36 8 269 3 folP1 Dihydropteroate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O04862 1.35e-28 117 29 5 279 1 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Pisum sativum
Q5XCA8 2.21e-28 112 29 6 249 1 folP Dihydropteroate synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8P152 2.56e-28 112 30 6 249 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DB09 2.88e-28 112 30 6 249 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB08 2.88e-28 112 30 6 249 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0C0G1 3.74e-28 112 30 6 249 3 folP Dihydropteroate synthase Streptococcus pyogenes serotype M1
P43776 1.44e-27 110 28 5 248 3 folP-A Dihydropteroate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0C0X1 1.84e-27 110 36 5 222 1 folP1 Dihydropteroate synthase Mycobacterium leprae (strain TN)
P28822 6.53e-27 108 30 6 251 3 sul Dihydropteroate synthase Bacillus subtilis (strain 168)
Q9SZV3 1.69e-26 111 30 5 259 2 MitHPPK/DHPS Folate synthesis bifunctional protein, mitochondrial Arabidopsis thaliana
Q59919 9.4e-26 105 28 7 251 3 folP Dihydropteroate synthase Staphylococcus haemolyticus
Q1ENB6 1.56e-25 108 28 6 282 1 CytHPPK/DHPS Folate synthesis bifunctional protein Arabidopsis thaliana
O05701 1.66e-25 104 28 6 249 1 folP Dihydropteroate synthase Staphylococcus aureus
Q6GJF7 1.66e-25 104 28 6 249 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MRSA252)
Q9HS44 3.84e-25 108 37 5 245 3 folP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8NXZ2 7.98e-25 103 28 6 249 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MW2)
Q6GBX4 1.72e-24 102 28 6 249 3 folP Dihydropteroate synthase Staphylococcus aureus (strain MSSA476)
Q5HIG1 1.83e-24 102 28 6 249 3 folP Dihydropteroate synthase Staphylococcus aureus (strain COL)
P64142 1.97e-24 102 27 6 249 3 folP Dihydropteroate synthase Staphylococcus aureus (strain N315)
P64141 1.97e-24 102 27 6 249 1 folP Dihydropteroate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
O25830 3.72e-24 103 30 9 254 1 folP Bifunctional dihydropteroate synthase/dihydropteroate reductase Helicobacter pylori (strain ATCC 700392 / 26695)
Q51161 3.4e-23 99 30 6 222 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P29251 3.69e-22 99 29 11 275 1 fol1 Folic acid synthesis protein fol1 Pneumocystis carinii
Q5HRP0 9.32e-22 95 27 7 253 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P57696 1.54e-21 94 29 7 222 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup C
D4GW05 3.79e-21 96 34 5 250 3 folCP Probable bifunctional folylpolyglutamate synthase/dihydropteroate synthase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9JT70 5.53e-21 93 30 7 222 3 folP Dihydropteroate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8CMT7 1.88e-20 91 27 7 253 3 folP Dihydropteroate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P82602 2.58e-18 87 26 9 260 3 folKP Folate synthesis bifunctional protein Chlamydia muridarum (strain MoPn / Nigg)
Q4LB35 3.6e-18 87 28 7 259 1 fol1 Folic acid synthesis protein fol1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Z7E8 8.55e-18 85 28 10 264 3 folKP Folate synthesis bifunctional protein Chlamydia pneumoniae
Q821E2 1.6e-17 85 27 9 261 3 folKP Folate synthesis bifunctional protein Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
O84619 2.47e-15 79 25 8 258 3 folKP Folate synthesis bifunctional protein Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P0C0X2 6.62e-15 76 28 6 232 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium leprae (strain TN)
P05382 8.2e-13 70 26 9 295 1 sulA Dihydropteroate synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P59655 7.84e-12 67 26 10 295 1 sulA Dihydropteroate synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P53848 1.07e-11 68 24 11 320 1 FOL1 Folic acid synthesis protein FOL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54YD9 1.08e-09 62 27 1 105 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
Q54YD9 3.06e-06 52 29 4 126 3 fol1 Folic acid synthesis protein FOL1 Dictyostelium discoideum
P9WNC9 6.37e-09 59 27 7 230 1 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNC8 6.37e-09 59 27 7 230 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64140 6.37e-09 59 27 7 230 3 folP2 Inactive dihydropteroate synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_19880
Feature type CDS
Gene sul1
Product sulfonamide-resistant dihydropteroate synthase Sul1
Location 2 - 838 (strand: 1)
Length 837 (nucleotides) / 278 (amino acids)

Contig

Accession ZDB_415
Length 862 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3640
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00809 Pterin binding enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0294 Coenzyme transport and metabolism (H) H Dihydropteroate synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K18974 dihydropteroate synthase type 1 [EC:2.5.1.15] Folate biosynthesis
Metabolic pathways		 -

AMR gene Annotation(s)

Gene Description Scope Type Class Subclass HMM
sul1 sulfonamide-resistant dihydropteroate synthase Sul1 core AMR SULFONAMIDE SULFONAMIDE NF000294 

Protein Sequence

MTVFGILNLTEDSFFDESRRLDPAGAVTAAIEMLRVGSDVVDVGPAASHPDARPVSPADEIRRIAPLLDALSDQMHRVSIDSFQPETQRYALKRGVGYLNDIQGFPDPALYPDIAEADCRLVVMHSAQRDGIATRTGHLRPEDALDEIVRFFEARVSALRRSGVAADRLILDPGMGFFLSPAPETSLHVLSNLQKLKSALGLPLLVSVSRKSFLGATVGLPVKDLGPASLAAELHAIGNGADYVRTHAPGDLRSAITFSETLAKFRSRDARDRGLDHA

Flanking regions ( +/- flanking 50bp)

GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCT