Homologs in group_3054

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18250 FBDBKF_18250 100.0 Morganella morganii S1 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
EHELCC_18285 EHELCC_18285 100.0 Morganella morganii S2 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
NLDBIP_18210 NLDBIP_18210 100.0 Morganella morganii S4 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
HKOGLL_18140 HKOGLL_18140 100.0 Morganella morganii S5 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
F4V73_RS01780 F4V73_RS01780 76.9 Morganella psychrotolerans - carboxymuconolactone decarboxylase family protein

Distribution of the homologs in the orthogroup group_3054

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3054

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P96684 8.04e-27 100 30 0 139 4 ydfG Uncharacterized protein YdfG Bacillus subtilis (strain 168)
P76222 4.18e-14 68 37 1 104 4 ynjA Uncharacterized protein YnjA Escherichia coli (strain K12)
Q0BXT2 0.000529 41 52 0 36 3 ahpD Alkyl hydroperoxide reductase AhpD Hyphomonas neptunium (strain ATCC 15444)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_18405
Feature type CDS
Gene yciW
Product Alkylhydroperoxidase family enzyme, contains CxxC motif
Location 14786 - 15217 (strand: 1)
Length 432 (nucleotides) / 143 (amino acids)

Contig

Accession ZDB_383
Length 35029 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3054
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF02627 Carboxymuconolactone decarboxylase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2128 Inorganic ion transport and metabolism (P) P Alkylhydroperoxidase family enzyme, contains CxxC motif

Protein Sequence

MSSLRLSYPKLSPAAYAGLIACKNALESSALSPELVELVYLRVSQINGCAFCLEMHTAALRKRGMVQEKLDALAGWRVSERFSDRERAALEWTEAVTQLSAQNTDEATWQRVKAHFSDAEMSDLTIAAGLMNAFNRIAVSLRQ

Flanking regions ( +/- flanking 50bp)

AGCGCCCGGTTTCCGGGATACTTTTTCACTCTGATCAAGGCAGGTCTGTTATGTCATCACTACGTTTATCTTATCCGAAACTCAGTCCGGCAGCGTATGCGGGGCTGATTGCCTGTAAAAATGCACTGGAAAGCAGCGCGTTATCCCCTGAACTGGTTGAGCTGGTGTATCTGCGGGTATCCCAGATTAACGGCTGCGCATTCTGTCTGGAAATGCACACGGCGGCACTGCGCAAGCGGGGCATGGTTCAGGAGAAACTTGACGCACTGGCGGGCTGGCGCGTGAGTGAACGTTTCAGTGATCGCGAGCGGGCGGCGCTGGAATGGACGGAAGCGGTCACACAGTTATCGGCTCAGAATACTGATGAGGCAACCTGGCAGCGTGTGAAGGCACATTTTTCTGATGCGGAAATGAGTGATCTGACAATCGCGGCAGGGCTGATGAATGCCTTCAACCGGATTGCTGTCAGTCTGCGTCAGTAGCGGATCACAGCAACCCGGCACCGGCGGTTATTCGCCGGTGTTATCCCGCA