Homologs in group_3057

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18250 FBDBKF_18250 76.9 Morganella morganii S1 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
EHELCC_18285 EHELCC_18285 76.9 Morganella morganii S2 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
NLDBIP_18210 NLDBIP_18210 76.9 Morganella morganii S4 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
LHKJJB_18405 LHKJJB_18405 76.9 Morganella morganii S3 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif
HKOGLL_18140 HKOGLL_18140 76.9 Morganella morganii S5 yciW Alkylhydroperoxidase family enzyme, contains CxxC motif

Distribution of the homologs in the orthogroup group_3057

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3057

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P96684 5.02e-26 98 31 1 141 4 ydfG Uncharacterized protein YdfG Bacillus subtilis (strain 168)
P76222 2.02e-11 61 32 1 106 4 ynjA Uncharacterized protein YnjA Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01780
Feature type CDS
Gene -
Product carboxymuconolactone decarboxylase family protein
Location 392975 - 393406 (strand: 1)
Length 432 (nucleotides) / 143 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3057
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF02627 Carboxymuconolactone decarboxylase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2128 Inorganic ion transport and metabolism (P) P Alkylhydroperoxidase family enzyme, contains CxxC motif

Protein Sequence

MSQLRLQYPNLSPAAYSGLIACKNALENSALGAELTELVYLRVSQINGCAFCLEMHSSALRKKSVPQTTLDALAGWQVSERFTDRERAALLWAESVTHISAQKTDDALYQKVKAHFTDEEMSDLTIAVALMNAFNRVAVSLRQ

Flanking regions ( +/- flanking 50bp)

CCTTCCGGTTTACCGGATATTACTGACCATTTATAAAGAGCGAGCCTGCCATGTCACAATTACGTTTACAGTATCCGAATCTCAGCCCTGCGGCATATTCAGGCCTGATAGCCTGTAAAAATGCTCTGGAAAACAGCGCATTGGGTGCGGAGTTAACAGAACTTGTTTACCTGCGTGTTTCTCAGATTAACGGCTGCGCATTCTGCCTTGAGATGCACAGCAGCGCCCTGCGCAAAAAATCGGTGCCGCAGACAACACTGGATGCATTGGCAGGCTGGCAGGTGAGTGAGCGGTTTACTGACCGTGAACGTGCCGCCTTATTGTGGGCAGAATCAGTTACACACATATCAGCGCAGAAAACTGATGATGCGTTGTATCAGAAGGTTAAAGCACATTTTACGGATGAAGAGATGAGTGATTTGACAATCGCTGTTGCGTTGATGAATGCATTTAACCGGGTGGCTGTCAGCCTGCGTCAGTAACAGGGATAACAACCACCAGGCGCCGGATAATTACTCTGTGGCGTTATCAC