Homologs in group_1325

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08205 FBDBKF_08205 100.0 Morganella morganii S1 rhlB ATP-dependent RNA helicase RhlB
EHELCC_13320 EHELCC_13320 100.0 Morganella morganii S2 rhlB ATP-dependent RNA helicase RhlB
NLDBIP_13660 NLDBIP_13660 100.0 Morganella morganii S4 rhlB ATP-dependent RNA helicase RhlB
HKOGLL_12135 HKOGLL_12135 100.0 Morganella morganii S5 rhlB ATP-dependent RNA helicase RhlB
F4V73_RS18755 F4V73_RS18755 96.1 Morganella psychrotolerans rhlB ATP-dependent RNA helicase RhlB
PMI_RS16465 PMI_RS16465 83.8 Proteus mirabilis HI4320 rhlB ATP-dependent RNA helicase RhlB

Distribution of the homologs in the orthogroup group_1325

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1325

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C6DHF5 0.0 755 83 0 429 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8G828 0.0 749 83 2 429 3 rhlB ATP-dependent RNA helicase RhlB Serratia proteamaculans (strain 568)
Q7MYL2 0.0 746 83 2 429 3 rhlB ATP-dependent RNA helicase RhlB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JQ11 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G19 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRC8 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis (strain Pestoides F)
Q1CNK3 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAD8 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis
B2K046 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBQ4 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD47 0.0 745 84 2 428 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6CZD9 0.0 742 81 0 429 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4F1V3 0.0 741 82 3 433 3 rhlB ATP-dependent RNA helicase RhlB Proteus mirabilis (strain HI4320)
B7LU75 0.0 734 84 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NTG2 0.0 734 84 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A9MJ29 0.0 734 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1LLV3 0.0 734 84 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SMS-3-5 / SECEC)
Q3YVI4 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella sonnei (strain Ss046)
P0A8K0 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri
Q1R4F9 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain UTI89 / UPEC)
B6I4B6 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SE11)
B7NF85 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8J8 0.0 733 83 1 416 1 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12)
B1IWC0 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8J9 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU3 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHV0 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O1:K1 / APEC
A8A6N4 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O9:H4 (strain HS)
B1X9Z4 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / DH10B)
C4ZZ48 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5C7 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O8 (strain IAI1)
B7MR01 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O81 (strain ED1a)
B7L8B6 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain 55989 / EAEC)
B7MGJ1 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN5 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTY2 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O139:H28 (strain E24377A / ETEC)
A7MQI2 0.0 733 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Cronobacter sakazakii (strain ATCC BAA-894)
Q31UK5 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 4 (strain Sb227)
B2TU12 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B2VG58 0.0 731 80 1 428 3 rhlB ATP-dependent RNA helicase RhlB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P0A2P0 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P1 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhi
B4TNT3 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella schwarzengrund (strain CVM19633)
C0Q2V9 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi C (strain RKS4594)
A9MXF3 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ26 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella newport (strain SL254)
B4TB13 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella heidelberg (strain SL476)
B5RFS3 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVH2 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella enteritidis PT4 (strain P125109)
Q57HT6 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella choleraesuis (strain SC-B67)
B5EZ40 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella agona (strain SL483)
B5YY28 0.0 731 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7 (strain EC4115 / EHEC)
B5BIS9 0.0 729 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi A (strain AKU_12601)
Q8XAT4 0.0 729 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7
Q329V8 0.0 729 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella dysenteriae serotype 1 (strain Sd197)
B5FN74 0.0 728 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Salmonella dublin (strain CT_02021853)
Q2NQB2 0.0 727 81 1 428 3 rhlB ATP-dependent RNA helicase RhlB Sodalis glossinidius (strain morsitans)
Q0SYX0 0.0 727 83 1 416 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri serotype 5b (strain 8401)
A8ACT3 0.0 727 82 1 418 3 rhlB ATP-dependent RNA helicase RhlB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TGG9 0.0 724 84 0 401 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WG30 0.0 721 82 1 418 3 rhlB ATP-dependent RNA helicase RhlB Enterobacter sp. (strain 638)
B5XYY9 0.0 720 84 0 401 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae (strain 342)
C4K8M8 0.0 649 72 0 417 3 rhlB ATP-dependent RNA helicase RhlB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q6LLL5 0.0 646 71 2 431 3 rhlB ATP-dependent RNA helicase RhlB Photobacterium profundum (strain SS9)
Q8DDN6 0.0 635 70 1 431 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain CMCP6)
B6EPA4 0.0 635 70 3 429 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio salmonicida (strain LFI1238)
C3LQR1 0.0 634 70 2 431 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain M66-2)
Q9KV52 0.0 634 70 2 431 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R4 0.0 634 70 2 431 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FF87 0.0 633 69 2 428 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain MJ11)
Q5E8U5 0.0 633 69 2 428 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MGP7 0.0 631 70 1 431 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain YJ016)
Q87KH5 0.0 630 69 1 428 3 rhlB ATP-dependent RNA helicase RhlB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MXT4 0.0 624 69 1 428 3 rhlB ATP-dependent RNA helicase RhlB Vibrio campbellii (strain ATCC BAA-1116)
Q0I1X0 0.0 619 70 3 419 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 129Pt)
B0UUZ9 0.0 617 69 3 419 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 2336)
B7VME9 0.0 615 67 4 440 3 rhlB ATP-dependent RNA helicase RhlB Vibrio atlanticus (strain LGP32)
C4LB49 0.0 611 69 2 431 3 rhlB ATP-dependent RNA helicase RhlB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KEG9 0.0 608 71 3 429 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6VKC3 0.0 607 72 2 401 3 rhlB ATP-dependent RNA helicase RhlB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A5UI36 0.0 603 72 3 406 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittGG)
A5UDI1 0.0 602 71 3 406 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittEE)
A4STJ7 0.0 601 70 3 429 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas salmonicida (strain A449)
A8G0U0 0.0 599 65 4 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sediminis (strain HAW-EB3)
B8CHZ1 0.0 599 64 2 437 3 rhlB ATP-dependent RNA helicase RhlB Shewanella piezotolerans (strain WP3 / JCM 13877)
A3Q9R3 0.0 595 66 2 421 3 rhlB ATP-dependent RNA helicase RhlB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q65RG7 0.0 593 72 2 413 3 rhlB ATP-dependent RNA helicase RhlB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CJS1 0.0 591 72 2 401 3 rhlB ATP-dependent RNA helicase RhlB Pasteurella multocida (strain Pm70)
B1KQF6 0.0 588 63 2 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella woodyi (strain ATCC 51908 / MS32)
A9L5D5 0.0 587 63 2 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS195)
A6WTD3 0.0 587 63 2 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS185)
A3D9I5 0.0 587 63 2 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E670 0.0 587 63 2 435 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS223)
A8GZJ0 0.0 587 63 2 438 3 rhlB ATP-dependent RNA helicase RhlB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q12S35 0.0 585 65 0 401 3 rhlB ATP-dependent RNA helicase RhlB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1SAL1 0.0 584 63 4 437 3 rhlB ATP-dependent RNA helicase RhlB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TJ29 0.0 584 63 1 434 3 rhlB ATP-dependent RNA helicase RhlB Shewanella halifaxensis (strain HAW-EB4)
Q8EJQ5 0.0 582 62 2 440 3 rhlB ATP-dependent RNA helicase RhlB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q088J2 0.0 582 65 2 414 3 rhlB ATP-dependent RNA helicase RhlB Shewanella frigidimarina (strain NCIMB 400)
A1RFB3 0.0 581 63 2 436 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain W3-18-1)
A4YB09 0.0 581 63 2 436 3 rhlB ATP-dependent RNA helicase RhlB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P44922 0.0 580 72 3 406 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0HQL1 0.0 579 62 2 440 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-7)
Q0HN76 0.0 579 62 2 440 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-4)
A0KS84 0.0 577 62 3 437 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain ANA-3)
A1SZG4 0.0 560 65 0 397 3 rhlB ATP-dependent RNA helicase RhlB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q15N18 0.0 552 65 3 430 3 rhlB ATP-dependent RNA helicase RhlB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QYF8 0.0 532 65 1 393 3 rhlB ATP-dependent RNA helicase RhlB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8PFZ3 1.61e-147 434 56 2 395 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas axonopodis pv. citri (strain 306)
Q3BNH8 1.68e-147 434 56 2 395 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8P4D4 3.36e-147 433 56 2 395 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWT6 3.36e-147 433 56 2 395 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain B100)
Q4UPY5 3.36e-147 433 56 2 395 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain 8004)
Q5GUR8 3.47e-147 433 56 3 403 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q879Y6 7.48e-136 403 52 2 399 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PA24 8.46e-131 390 52 2 399 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain 9a5c)
Q88NB7 9.13e-113 339 46 3 390 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HXE5 9.77e-110 332 45 2 390 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S21 9.77e-110 332 45 2 390 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UUT0 9.77e-110 332 45 2 390 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain LESB58)
Q887N8 4.21e-104 317 45 1 371 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0A4D8 3.82e-92 290 41 2 366 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4D7 3.82e-92 290 41 2 366 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8Y8N0 1.26e-88 281 41 2 366 2 cshA ATP-dependent RNA helicase CshA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5L3G9 1.29e-86 275 40 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Geobacillus kaustophilus (strain HTA426)
P25888 2.44e-83 266 38 4 389 1 rhlE ATP-dependent RNA helicase RhlE Escherichia coli (strain K12)
Q55804 1.37e-82 265 40 4 358 1 crhR RNA helicase CrhR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q65N62 1.4e-82 265 39 3 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P96614 1.62e-82 265 39 3 365 1 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus subtilis (strain 168)
Q4L7W0 5.67e-80 258 37 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus haemolyticus (strain JCSC1435)
Q49Z29 1.41e-79 258 37 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9Z6C9 3.72e-79 256 38 3 368 3 cshA ATP-dependent RNA helicase CshA Limosilactobacillus reuteri
Q814I2 5.01e-79 255 36 2 375 2 dbpA ATP-dependent RNA helicase DbpA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8CRP6 5.13e-78 253 37 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q73EU1 7.76e-78 253 36 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63GX5 1.2e-77 253 36 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ZK / E33L)
Q6HPE6 1.39e-77 253 36 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VG0 1.39e-77 253 36 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus anthracis
A0R8U6 1.39e-77 253 36 2 365 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis (strain Al Hakam)
Q81IT9 1.77e-77 253 36 2 365 2 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81DF9 1.99e-77 250 36 4 372 2 cshE DEAD-box ATP-dependent RNA helicase CshE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5HME0 2.48e-77 252 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0D2 3.03e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MW2)
Q6G7M9 3.03e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MSSA476)
Q7A4G0 3.03e-77 251 36 2 352 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain N315)
Q99SH6 3.03e-77 251 36 2 352 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEB9 3.03e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain COL)
Q2FWH5 3.03e-77 251 36 2 352 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF45 3.03e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain USA300)
Q6GEZ3 3.17e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MRSA252)
Q2YUH3 4.13e-77 251 36 2 352 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain bovine RF122 / ET3-1)
O25029 1.05e-76 249 39 2 351 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain ATCC 700392 / 26695)
B9XXL6 1.68e-76 249 39 2 351 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain B128)
Q8K9H6 3.97e-75 248 38 6 381 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57453 1.72e-74 247 38 6 381 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P44586 2.87e-74 246 40 5 354 3 deaD ATP-dependent RNA helicase DeaD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A9P8 3.83e-74 246 40 4 348 3 deaD ATP-dependent RNA helicase DeaD Shigella flexneri
P0A9P6 3.83e-74 246 40 4 348 1 deaD ATP-dependent RNA helicase DeaD Escherichia coli (strain K12)
P0A9P7 3.83e-74 246 40 4 348 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA87 4.63e-74 246 40 4 348 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O157:H7
A7EYW0 1.51e-73 244 42 6 346 3 dbp3 ATP-dependent RNA helicase dbp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
P33906 1.73e-73 245 40 4 348 3 deaD ATP-dependent RNA helicase DeaD Klebsiella pneumoniae
A6SCT6 3.95e-73 243 42 7 347 3 dbp3 ATP-dependent RNA helicase dbp3 Botryotinia fuckeliana (strain B05.10)
Q9LUW6 5.26e-73 243 38 6 369 1 RH9 DEAD-box ATP-dependent RNA helicase 9, mitochondrial Arabidopsis thaliana
P42305 5.55e-73 239 36 3 369 1 dbpA ATP-dependent RNA helicase DbpA Bacillus subtilis (strain 168)
A6ZP47 2.63e-72 241 35 5 412 3 DED1 ATP-dependent RNA helicase DED1 Saccharomyces cerevisiae (strain YJM789)
P06634 3.28e-72 241 35 5 412 1 DED1 ATP-dependent RNA helicase DED1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9LUW5 5.49e-72 241 37 6 369 1 RH53 DEAD-box ATP-dependent RNA helicase 53, mitochondrial Arabidopsis thaliana
Q7S5R1 7.45e-72 240 38 7 381 3 dbp-3 ATP-dependent RNA helicase dbp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P9WH05 1.07e-71 238 38 6 370 1 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH04 1.07e-71 238 38 6 370 3 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P24783 1.07e-71 238 37 5 359 1 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZRX0 1.11e-71 238 37 5 359 3 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain YJM789)
P44701 1.16e-71 235 36 7 376 3 srmB ATP-dependent RNA helicase SrmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89AF9 1.23e-71 239 39 5 358 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8SRB2 2.23e-71 236 40 7 355 3 DBP2 ATP-dependent RNA helicase DBP2 Encephalitozoon cuniculi (strain GB-M1)
A7TKR8 3.72e-71 239 37 3 360 3 DED1 ATP-dependent RNA helicase DED1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q8TFK8 5.25e-71 238 37 3 360 3 DED1 ATP-dependent RNA helicase DED1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q59LU0 6.83e-71 236 37 6 357 3 DBP2 ATP-dependent RNA helicase DBP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4JG17 7.46e-71 239 37 4 359 2 vasa Probable ATP-dependent RNA helicase vasa-like Penaeus vannamei
P24784 7.91e-71 238 38 3 359 1 DBP1 ATP-dependent RNA helicase DBP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZWD3 9.36e-71 237 38 3 359 3 DBP1 ATP-dependent RNA helicase DBP1 Saccharomyces cerevisiae (strain YJM789)
Q2HBE7 1.81e-70 238 38 3 355 3 DED1 ATP-dependent RNA helicase DED1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q9C718 2.11e-70 233 37 6 377 2 RH20 DEAD-box ATP-dependent RNA helicase 20 Arabidopsis thaliana
Q2GUI4 8.44e-70 233 40 6 359 3 DBP3 ATP-dependent RNA helicase DBP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A3LQ01 8.81e-70 235 38 3 355 3 DED1 ATP-dependent RNA helicase DED1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5QMN3 8.94e-70 231 37 6 378 3 Os01g0197200 DEAD-box ATP-dependent RNA helicase 20 Oryza sativa subsp. japonica
A6SFW7 1.16e-69 233 38 6 357 3 dbp2 ATP-dependent RNA helicase dbp2 Botryotinia fuckeliana (strain B05.10)
Q4IP34 1.2e-69 242 37 6 382 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4IJH1 1.76e-69 233 38 7 396 3 DBP3 ATP-dependent RNA helicase DBP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q2R1M8 1.89e-69 234 35 3 366 3 Os11g0599500 DEAD-box ATP-dependent RNA helicase 52C Oryza sativa subsp. japonica
Q6CIV2 1.94e-69 232 37 5 360 3 DBP2 ATP-dependent RNA helicase DBP2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6FLF3 2.49e-69 232 37 6 359 3 DBP2 ATP-dependent RNA helicase DBP2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9NXZ2 2.8e-69 234 38 6 351 1 DDX43 Probable ATP-dependent RNA helicase DDX43 Homo sapiens
Q5B0J9 3.42e-69 232 38 7 363 3 dbp2 ATP-dependent RNA helicase dbp2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A7E449 4.03e-69 232 38 5 355 3 dbp2 ATP-dependent RNA helicase dbp2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q8W4R3 6.23e-69 232 37 6 380 1 RH30 DEAD-box ATP-dependent RNA helicase 30 Arabidopsis thaliana
Q4X195 7.41e-69 231 37 7 364 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1DGZ7 1.01e-68 230 37 7 364 3 dbp2 ATP-dependent RNA helicase dbp2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q6Z4K6 1.02e-68 232 36 4 364 2 PL10B DEAD-box ATP-dependent RNA helicase 52B Oryza sativa subsp. japonica
P21507 1.23e-68 227 37 5 391 1 srmB ATP-dependent RNA helicase SrmB Escherichia coli (strain K12)
Q2U070 1.36e-68 230 37 7 358 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A2QC74 1.95e-68 230 38 7 358 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q5N7W4 3.16e-68 232 37 6 378 2 Os01g0911100 DEAD-box ATP-dependent RNA helicase 30 Oryza sativa subsp. japonica
Q6BY27 4.87e-68 228 37 5 355 3 DBP2 ATP-dependent RNA helicase DBP2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A5DQS0 8.01e-68 230 38 3 354 3 DED1 ATP-dependent RNA helicase DED1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A5DL80 8.7e-68 228 37 6 365 3 DBP2 ATP-dependent RNA helicase DBP2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q0UWA6 1.05e-67 231 36 4 362 3 DED1 ATP-dependent RNA helicase DED1 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0DB53 1.06e-67 229 36 3 372 2 Os06g0602400 DEAD-box ATP-dependent RNA helicase 52A Oryza sativa subsp. japonica
A5DZE6 1.12e-67 230 37 4 357 3 DED1 ATP-dependent RNA helicase DED1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
G0SFM2 1.26e-67 228 38 5 363 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
A1C6C4 1.41e-67 227 37 7 358 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q4P733 1.41e-67 230 37 4 363 3 DED1 ATP-dependent RNA helicase DED1 Ustilago maydis (strain 521 / FGSC 9021)
Q75HJ0 1.61e-67 229 35 3 364 2 PL10A DEAD-box ATP-dependent RNA helicase 37 Oryza sativa subsp. japonica
P09052 1.71e-67 229 35 3 374 1 vas ATP-dependent RNA helicase vasa Drosophila melanogaster
Q5A4E2 2.11e-67 229 36 4 355 3 DED1 ATP-dependent RNA helicase DED1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q755N4 2.13e-67 227 37 5 360 3 DBP2 ATP-dependent RNA helicase DBP2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q54QS3 2.62e-67 230 38 4 364 3 ddx3 Probable ATP-dependent RNA helicase ddx3 Dictyostelium discoideum
Q1DP69 3.65e-67 226 37 6 363 3 DBP2 ATP-dependent RNA helicase DBP2 Coccidioides immitis (strain RS)
Q9M2F9 3.76e-67 228 38 3 343 1 RH52 DEAD-box ATP-dependent RNA helicase 52 Arabidopsis thaliana
Q6BU54 6.21e-67 228 38 5 360 3 DED1 ATP-dependent RNA helicase DED1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A2QFL3 7.08e-67 224 39 9 346 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q0CL13 7.42e-67 224 40 9 357 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q5AWA6 1.07e-66 223 40 7 343 3 dbp3 ATP-dependent RNA helicase dbp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q501J6 1.1e-66 227 39 5 355 1 Ddx17 Probable ATP-dependent RNA helicase DDX17 Mus musculus
Q2UMH8 1.15e-66 224 40 7 344 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q84W89 1.24e-66 227 37 3 343 2 RH37 DEAD-box ATP-dependent RNA helicase 37 Arabidopsis thaliana
A7TJ36 1.69e-66 224 38 10 381 3 DBP3 ATP-dependent RNA helicase DBP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q10MH8 1.99e-66 229 38 4 346 2 Os03g0308500 DEAD-box ATP-dependent RNA helicase 24 Oryza sativa subsp. japonica
A6RGE3 2.9e-66 224 37 6 364 3 DBP2 ATP-dependent RNA helicase DBP2 Ajellomyces capsulatus (strain NAm1 / WU24)
Q0ILZ4 2.98e-66 226 36 6 370 2 Os12g0611200 DEAD-box ATP-dependent RNA helicase 9 Oryza sativa subsp. japonica
Q7SBC6 3.15e-66 224 37 6 357 3 drh-1 ATP-dependent RNA helicase dbp2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q92841 3.82e-66 227 39 5 355 1 DDX17 Probable ATP-dependent RNA helicase DDX17 Homo sapiens
Q6FS54 3.92e-66 223 38 10 364 3 DBP3 ATP-dependent RNA helicase DBP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q0UY62 4.15e-66 224 42 7 345 3 DBP3 ATP-dependent RNA helicase DBP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q9VHP0 5.39e-66 228 39 6 348 1 bel ATP-dependent RNA helicase bel Drosophila melanogaster
Q5VQL1 5.82e-66 226 36 8 371 2 Os01g0172200 DEAD-box ATP-dependent RNA helicase 14 Oryza sativa subsp. japonica
Q1DZK8 6.5e-66 222 40 8 354 3 DBP3 ATP-dependent RNA helicase DBP3 Coccidioides immitis (strain RS)
Q0D8N0 6.79e-66 224 38 6 360 2 Os07g0143700 DEAD-box ATP-dependent RNA helicase 53 Oryza sativa subsp. japonica
Q6CB69 6.92e-66 224 37 3 338 3 DED1 ATP-dependent RNA helicase DED1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q1DJF0 8.1e-66 225 35 3 363 3 DED1 ATP-dependent RNA helicase DED1 Coccidioides immitis (strain RS)
P20447 1.06e-65 222 38 8 343 1 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
D0PV95 1.13e-65 226 37 5 363 1 laf-1 ATP-dependent RNA helicase laf-1 Caenorhabditis elegans
O13370 1.19e-65 224 35 4 365 1 ded1 ATP-dependent RNA helicase ded1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6CLR3 1.21e-65 224 38 4 341 3 DED1 ATP-dependent RNA helicase DED1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A6ZUA1 1.51e-65 221 38 8 343 3 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain YJM789)
P0CQ79 1.66e-65 223 38 7 371 3 DBP3 ATP-dependent RNA helicase DBP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
O22907 1.66e-65 226 37 4 351 1 RH24 DEAD-box ATP-dependent RNA helicase 24 Arabidopsis thaliana
Q8Y7M8 1.7e-65 220 32 8 428 2 dbpA ATP-dependent RNA helicase DbpA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8LA13 1.73e-65 223 36 6 371 1 RH11 DEAD-box ATP-dependent RNA helicase 11 Arabidopsis thaliana
Q3MSQ8 1.84e-65 225 37 4 355 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Pelophylax lessonae
P54475 2.13e-65 219 34 4 357 1 cshB DEAD-box ATP-dependent RNA helicase CshB Bacillus subtilis (strain 168)
P0CQ78 2.42e-65 223 38 7 371 3 DBP3 ATP-dependent RNA helicase DBP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q9P6U9 2.93e-65 224 36 5 364 3 drh-9 ATP-dependent RNA helicase ded1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4IF76 3.79e-65 221 37 6 356 3 DBP2 ATP-dependent RNA helicase DBP2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q755A5 3.96e-65 221 37 10 382 3 DBP3 ATP-dependent RNA helicase DBP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A4QSS5 3.99e-65 221 36 6 361 3 DBP2 ATP-dependent RNA helicase DBP2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0INC5 4.2e-65 226 34 5 375 2 Os12g0481100 DEAD-box ATP-dependent RNA helicase 28 Oryza sativa subsp. japonica
Q6FP38 4.59e-65 222 36 4 361 3 DBP1 ATP-dependent RNA helicase DBP1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A1DG51 5.77e-65 219 39 8 355 3 dbp3 ATP-dependent RNA helicase dbp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P24782 6.2e-65 220 36 6 363 2 dbp2 ATP-dependent RNA helicase dbp2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZRZ8 6.35e-65 225 36 5 375 2 RH28 DEAD-box ATP-dependent RNA helicase 28 Arabidopsis thaliana
Q7ZY47 6.4e-65 227 36 4 351 2 ddx42 ATP-dependent RNA helicase DDX42 Xenopus laevis
Q4WH83 9.28e-65 219 38 10 372 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8H136 1.01e-64 221 35 8 397 1 RH14 DEAD-box ATP-dependent RNA helicase 14 Arabidopsis thaliana
A5E1W4 1.12e-64 219 37 5 343 3 DBP3 ATP-dependent RNA helicase DBP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q75B50 1.18e-64 221 36 3 354 3 DED1 ATP-dependent RNA helicase DED1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7EJY3 1.27e-64 222 36 4 362 3 ded1 ATP-dependent RNA helicase ded1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A6R3L3 1.51e-64 223 38 7 362 3 DED1 ATP-dependent RNA helicase DED1 Ajellomyces capsulatus (strain NAm1 / WU24)
Q6C4D4 1.56e-64 219 35 5 358 3 DBP2 ATP-dependent RNA helicase DBP2 Yarrowia lipolytica (strain CLIB 122 / E 150)
A1A4H6 1.88e-64 223 35 6 385 2 DDX27 Probable ATP-dependent RNA helicase DDX27 Bos taurus
Q54CE0 2.01e-64 224 36 4 358 3 ddx17 Probable ATP-dependent RNA helicase ddx17 Dictyostelium discoideum
A6QXC1 2.32e-64 217 40 8 346 3 DBP3 ATP-dependent RNA helicase DBP3 Ajellomyces capsulatus (strain NAm1 / WU24)
A6SEH9 2.57e-64 221 35 4 362 3 ded1 ATP-dependent RNA helicase ded1 Botryotinia fuckeliana (strain B05.10)
Q9SQV1 2.64e-64 226 38 9 379 2 RH40 DEAD-box ATP-dependent RNA helicase 40 Arabidopsis thaliana
Q5JKF2 2.64e-64 223 36 7 381 2 Os01g0549400 DEAD-box ATP-dependent RNA helicase 40 Oryza sativa subsp. japonica
A4RN46 3.52e-64 226 36 7 383 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P93008 3.76e-64 222 35 2 367 2 RH21 DEAD-box ATP-dependent RNA helicase 21 Arabidopsis thaliana
Q4R6M5 4.43e-64 219 37 4 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Macaca fascicularis
Q61656 4.48e-64 219 37 4 353 1 Ddx5 Probable ATP-dependent RNA helicase DDX5 Mus musculus
Q84UQ1 4.96e-64 225 36 9 383 2 Os08g0159900 DEAD-box ATP-dependent RNA helicase 42 Oryza sativa subsp. japonica
P17844 5.4e-64 219 37 4 353 1 DDX5 Probable ATP-dependent RNA helicase DDX5 Homo sapiens
Q5R4I9 5.46e-64 219 37 4 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pongo abelii
P46942 5.64e-64 219 36 8 380 2 None ATP-dependent RNA helicase-like protein DB10 Nicotiana sylvestris
Q10202 6.65e-64 218 40 10 364 3 dbp3 ATP-dependent RNA helicase dbp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2H720 7.22e-64 218 36 6 357 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q810A7 8.6e-64 224 35 3 351 1 Ddx42 ATP-dependent RNA helicase DDX42 Mus musculus
Q6CH58 1.13e-63 215 35 4 361 3 RRP3 ATP-dependent rRNA helicase RRP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4WP13 1.27e-63 219 36 5 359 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5BDW4 1.33e-63 225 36 8 385 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q6CT46 1.38e-63 216 38 7 362 3 DBP3 ATP-dependent RNA helicase DBP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q921N6 1.55e-63 221 35 6 385 1 Ddx27 Probable ATP-dependent RNA helicase DDX27 Mus musculus
A5DAC8 1.78e-63 216 38 11 379 3 DBP3 ATP-dependent RNA helicase DBP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q86XP3 1.79e-63 223 35 3 351 1 DDX42 ATP-dependent RNA helicase DDX42 Homo sapiens
Q5R7D1 2.04e-63 223 35 3 351 2 DDX42 ATP-dependent RNA helicase DDX42 Pongo abelii
Q96GQ7 2.05e-63 221 35 6 385 1 DDX27 Probable ATP-dependent RNA helicase DDX27 Homo sapiens
Q7SH33 2.35e-63 224 35 6 382 3 prp-5 Pre-mRNA-processing ATP-dependent RNA helicase prp-5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7RY59 2.58e-63 215 36 6 399 3 rrp-3 ATP-dependent rRNA helicase rrp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q0CLJ6 2.67e-63 219 35 4 359 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9LYJ9 2.77e-63 218 34 9 413 2 RH46 DEAD-box ATP-dependent RNA helicase 46 Arabidopsis thaliana
A7EML8 2.98e-63 214 37 5 357 3 rrp3 ATP-dependent rRNA helicase rrp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q4P3U9 3.23e-63 216 36 3 368 3 RRP3 ATP-dependent rRNA helicase RRP3 Ustilago maydis (strain 521 / FGSC 9021)
Q86TM3 3.27e-63 218 34 6 356 1 DDX53 Probable ATP-dependent RNA helicase DDX53 Homo sapiens
Q2UGK3 3.38e-63 218 35 4 359 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A5A6J2 3.41e-63 217 37 4 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pan troglodytes
A2QI25 4.55e-63 218 35 4 359 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A6QRQ7 5.84e-63 213 36 5 357 3 RRP3 ATP-dependent rRNA helicase RRP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q6BZ77 6.5e-63 214 38 9 360 3 DBP3 ATP-dependent RNA helicase DBP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5F485 6.9e-63 221 33 8 432 2 DDX42 ATP-dependent RNA helicase DDX42 Gallus gallus
Q9BUQ8 9.67e-63 219 35 3 386 1 DDX23 Probable ATP-dependent RNA helicase DDX23 Homo sapiens
P0CQ74 1.2e-62 216 35 4 366 3 DED1 ATP-dependent RNA helicase ded1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ75 1.2e-62 216 35 4 366 3 DED1 ATP-dependent RNA helicase ded1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P19109 1.28e-62 218 35 6 372 1 Rm62 ATP-dependent RNA helicase p62 Drosophila melanogaster
A6RW56 1.32e-62 213 37 5 357 3 rrp3 ATP-dependent rRNA helicase rrp3 Botryotinia fuckeliana (strain B05.10)
A5DS77 1.4e-62 214 36 5 345 3 DBP2 ATP-dependent RNA helicase DBP2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A6RW79 1.51e-62 222 35 7 382 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Botryotinia fuckeliana (strain B05.10)
Q8H0U8 1.51e-62 222 34 6 373 1 RH42 DEAD-box ATP-dependent RNA helicase 42 Arabidopsis thaliana
A4RHF1 2.18e-62 216 36 5 359 3 DED1 ATP-dependent RNA helicase DED1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A4R5B8 2.26e-62 219 34 5 411 3 DBP10 ATP-dependent RNA helicase DBP10 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0D1K3 2.34e-62 221 35 8 385 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q6C9P3 2.61e-62 213 38 8 358 3 DBP3 ATP-dependent RNA helicase DBP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q0DM51 2.64e-62 218 37 7 350 2 Os03g0827700 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Oryza sativa subsp. japonica
P0CQ76 2.9e-62 213 35 5 353 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ77 2.9e-62 213 35 5 353 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q2U2J6 3.12e-62 221 35 7 383 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A1CXK7 3.5e-62 216 35 5 364 3 ded1 ATP-dependent RNA helicase ded1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4IFI0 4.66e-62 211 36 5 357 3 RRP3 ATP-dependent rRNA helicase RRP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A2QQA8 4.77e-62 220 34 9 413 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P16381 5.06e-62 215 35 3 368 1 D1Pas1 Putative ATP-dependent RNA helicase Pl10 Mus musculus
A7ENE0 5.86e-62 220 35 8 383 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q9C551 6.22e-62 212 39 7 354 1 RH5 DEAD-box ATP-dependent RNA helicase 5 Arabidopsis thaliana
A1C5V3 6.36e-62 211 37 7 354 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q4I7K4 6.74e-62 215 37 3 334 3 DED1 ATP-dependent RNA helicase DED1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5RC67 9.81e-62 217 34 3 386 2 DDX23 Probable ATP-dependent RNA helicase DDX23 Pongo abelii
A7TS37 1.14e-61 211 35 6 414 3 RRP3 ATP-dependent rRNA helicase RRP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q9UJV9 1.16e-61 213 35 6 371 1 DDX41 Probable ATP-dependent RNA helicase DDX41 Homo sapiens
A0A1D6GDY8 1.3e-61 215 35 6 367 3 RH3A DEAD-box ATP-dependent RNA helicase 3A, chloroplastic Zea mays
Q8GY84 1.32e-61 209 34 7 423 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Arabidopsis thaliana
Q91VN6 1.84e-61 213 35 6 371 1 Ddx41 Probable ATP-dependent RNA helicase DDX41 Mus musculus
Q4WJE9 1.88e-61 209 36 5 357 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4PDT1 2.16e-61 212 37 4 353 3 DBP3 ATP-dependent RNA helicase DBP3 Ustilago maydis (strain 521 / FGSC 9021)
A1D405 2.9e-61 209 36 5 357 3 rrp3 ATP-dependent rRNA helicase rrp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q5B5E7 2.92e-61 208 36 3 355 3 rrp3 ATP-dependent rRNA helicase rrp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4PHU9 3.07e-61 211 35 7 365 3 DBP2 ATP-dependent RNA helicase DBP2 Ustilago maydis (strain 521 / FGSC 9021)
O00571 3.19e-61 213 34 3 368 1 DDX3X ATP-dependent RNA helicase DDX3X Homo sapiens
A1CH78 3.23e-61 213 35 4 359 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A4QYM6 3.74e-61 215 37 7 368 3 DRS1 ATP-dependent RNA helicase DRS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0UK12 3.8e-61 210 34 7 387 3 RRP3 ATP-dependent rRNA helicase RRP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q5RF43 3.86e-61 213 34 3 369 2 DDX3Y ATP-dependent RNA helicase DDX3Y Pongo abelii
Q2H0R2 4.06e-61 214 34 4 394 3 DBP10 ATP-dependent RNA helicase DBP10 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q9P7C7 4.65e-61 217 34 7 381 1 prp11 Pre-mRNA-processing ATP-dependent RNA helicase prp11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6FW42 4.8e-61 213 33 7 385 3 DRS1 ATP-dependent RNA helicase DRS1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O15523 5.06e-61 212 34 3 369 1 DDX3Y ATP-dependent RNA helicase DDX3Y Homo sapiens
Q2HAD8 5.2e-61 217 34 6 382 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q6C024 5.27e-61 211 33 4 365 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q53RK8 5.37e-61 214 35 3 367 2 Os03g0708600 DEAD-box ATP-dependent RNA helicase 21 Oryza sativa subsp. japonica
Q8Y755 5.73e-61 207 32 4 352 2 cshB DEAD-box ATP-dependent RNA helicase CshB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1E1N5 5.96e-61 208 36 6 360 3 RRP3 ATP-dependent rRNA helicase RRP3 Coccidioides immitis (strain RS)
P21693 6.11e-61 207 37 4 343 1 dbpA ATP-dependent RNA helicase DbpA Escherichia coli (strain K12)
Q4WT99 6.29e-61 217 34 6 383 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
C8V8H4 6.79e-61 212 35 4 362 3 ded1 ATP-dependent RNA helicase ded1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A5DF03 8.87e-61 210 32 6 389 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A1D373 1.19e-60 216 34 6 383 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q1DHB2 1.26e-60 216 34 8 385 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Coccidioides immitis (strain RS)
A0A1D6LAB7 1.28e-60 213 35 6 367 2 RH3B DEAD-box ATP-dependent RNA helicase 3B, chloroplastic Zea mays
Q2UNB7 1.44e-60 207 35 4 374 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q75F95 1.48e-60 212 34 6 359 3 DRS1 ATP-dependent RNA helicase DRS1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q62095 2.08e-60 211 34 3 368 1 Ddx3y ATP-dependent RNA helicase DDX3Y Mus musculus
Q4PFD9 2.44e-60 215 35 8 382 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Ustilago maydis (strain 521 / FGSC 9021)
Q4HZ42 2.46e-60 214 32 4 429 3 DBP10 ATP-dependent RNA helicase DBP10 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q62167 2.72e-60 210 34 3 368 1 Ddx3x ATP-dependent RNA helicase DDX3X Mus musculus
Q8K4L0 3.24e-60 213 34 4 363 1 Ddx54 ATP-dependent RNA helicase DDX54 Mus musculus
Q4TVV3 3.3e-60 214 34 7 381 2 ddx46 Probable ATP-dependent RNA helicase DDX46 Danio rerio
A3LQW7 3.86e-60 207 36 5 340 3 DBP2 ATP-dependent RNA helicase DBP2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6GVM6 4.32e-60 210 34 3 369 2 DDX3Y ATP-dependent RNA helicase DDX3Y Pan troglodytes
Q5APT8 4.35e-60 208 36 8 357 3 DBP3 ATP-dependent RNA helicase DBP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q0CIQ3 4.99e-60 205 33 3 383 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q75EW9 5.26e-60 206 35 5 383 3 RRP3 ATP-dependent rRNA helicase RRP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A6QUM7 5.75e-60 213 32 6 435 3 DBP10 ATP-dependent RNA helicase DBP10 Ajellomyces capsulatus (strain NAm1 / WU24)
Q6BLU9 1.13e-59 207 33 5 367 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A5DU73 1.17e-59 207 34 6 383 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q2UQI6 1.33e-59 211 35 5 365 3 drs1 ATP-dependent RNA helicase drs1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A7TJM9 1.39e-59 210 33 6 359 3 DRS1 ATP-dependent RNA helicase DRS1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q650T9 1.43e-59 209 35 6 373 2 Os09g0520700 DEAD-box ATP-dependent RNA helicase 7 Oryza sativa subsp. japonica
Q91VC3 1.5e-59 202 34 3 370 1 Eif4a3 Eukaryotic initiation factor 4A-III Mus musculus
P24346 1.57e-59 209 34 3 369 2 an3 Putative ATP-dependent RNA helicase an3 Xenopus laevis
A1CR32 1.6e-59 204 36 5 364 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P32892 1.72e-59 210 33 8 362 1 DRS1 ATP-dependent RNA helicase DRS1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7A0P8 1.77e-59 210 33 8 362 3 DRS1 ATP-dependent RNA helicase DRS1 Saccharomyces cerevisiae (strain YJM789)
B5FZY7 1.95e-59 202 34 3 370 2 EIF4A3 Eukaryotic initiation factor 4A-III Taeniopygia guttata
Q3B8Q2 1.96e-59 202 34 3 370 1 Eif4a3 Eukaryotic initiation factor 4A-III Rattus norvegicus
A6M931 1.96e-59 202 34 3 370 2 EIF4A3 Eukaryotic initiation factor 4A-III Sus scrofa
Q2NL22 1.96e-59 202 34 3 370 2 EIF4A3 Eukaryotic initiation factor 4A-III Bos taurus
Q5ZM36 1.96e-59 202 34 3 370 2 EIF4A3 Eukaryotic initiation factor 4A-III Gallus gallus
P38919 2.04e-59 202 34 3 370 1 EIF4A3 Eukaryotic initiation factor 4A-III Homo sapiens
A2RB17 2.13e-59 204 36 5 358 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q553B1 2.3e-59 213 35 7 381 2 helB1 ATP-dependent RNA helicase ddx46 Dictyostelium discoideum
Q2H1Q8 2.64e-59 204 37 6 363 3 RRP3 ATP-dependent rRNA helicase RRP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q61496 2.65e-59 208 34 4 338 1 Ddx4 ATP-dependent RNA helicase DDX4 Mus musculus
Q9V3C0 3.14e-59 207 34 4 358 1 abs ATP-dependent RNA helicase abstrakt Drosophila melanogaster
Q9LU46 3.31e-59 206 35 6 356 2 RH35 DEAD-box ATP-dependent RNA helicase 35 Arabidopsis thaliana
Q1E5R1 3.85e-59 204 32 7 422 3 DHH1 ATP-dependent RNA helicase DHH1 Coccidioides immitis (strain RS)
Q09719 3.94e-59 210 31 4 422 1 dbp10 ATP-dependent RNA helicase dbp10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1CQA9 3.95e-59 212 33 6 384 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q6FNK8 4.15e-59 204 34 6 414 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A3LS22 4.15e-59 203 35 3 353 3 RRP3 ATP-dependent rRNA helicase RRP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q4I830 4.48e-59 209 36 7 363 3 DRS1 ATP-dependent RNA helicase DRS1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8TDD1 4.73e-59 210 35 4 363 1 DDX54 ATP-dependent RNA helicase DDX54 Homo sapiens
Q91372 5.23e-59 207 35 3 337 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Xenopus laevis
Q64060 5.32e-59 208 35 4 338 1 Ddx4 Probable ATP-dependent RNA helicase DDX4 Rattus norvegicus
Q0U7S9 5.62e-59 204 33 4 374 3 DHH1 ATP-dependent RNA helicase DHH1 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q54IV3 5.77e-59 211 36 4 351 3 ddx42 Probable ATP-dependent RNA helicase ddx42 Dictyostelium discoideum
P0CR00 6.06e-59 203 35 5 390 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CR01 6.06e-59 203 35 5 390 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0C2N8 6.13e-59 209 36 5 356 3 drh-11 ATP-dependent RNA helicase drs1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6YS30 6.57e-59 203 36 4 359 2 Os07g0301200 DEAD-box ATP-dependent RNA helicase 5 Oryza sativa subsp. japonica
Q9NQI0 6.63e-59 207 35 4 338 1 DDX4 Probable ATP-dependent RNA helicase DDX4 Homo sapiens
A6ZSX1 6.69e-59 203 34 6 414 3 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain YJM789)
Q9SZB4 8.01e-59 204 35 6 356 3 RH43 Putative DEAD-box ATP-dependent RNA helicase 43 Arabidopsis thaliana
P38712 9.85e-59 202 34 6 414 1 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59W52 1.15e-58 204 33 6 379 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4R3Q1 1.21e-58 200 33 3 370 2 EIF4A3 Eukaryotic initiation factor 4A-III Macaca fascicularis
A5DWJ1 1.25e-58 200 32 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A1DNG2 1.33e-58 209 31 4 423 3 dbp10 ATP-dependent RNA helicase dbp10 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A7ESL7 1.34e-58 209 34 5 384 3 dbp10 ATP-dependent RNA helicase dbp10 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q8NJM2 1.6e-58 208 31 4 423 3 dbp10 ATP-dependent RNA helicase dbp10 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A4RGD1 1.81e-58 203 35 6 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q9P6N8 1.83e-58 201 32 6 429 3 rrp3 ATP-dependent rRNA helicase rrp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CQ93 2.11e-58 207 35 5 356 3 DRS1 ATP-dependent RNA helicase DRS1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A3LSN3 2.48e-58 206 33 7 368 3 DRS1 ATP-dependent RNA helicase DRS1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6GWX0 2.69e-58 206 35 4 338 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Sus scrofa
Q4R5S7 2.71e-58 206 35 4 338 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Macaca fascicularis
P0CQ92 2.93e-58 207 35 5 356 3 DRS1 ATP-dependent RNA helicase DRS1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q54VT4 3.73e-58 202 34 4 353 3 ddx47 Probable ATP-dependent RNA helicase ddx47 Dictyostelium discoideum
Q6CJV1 3.74e-58 206 32 6 361 3 DRS1 ATP-dependent RNA helicase DRS1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2UHC1 3.75e-58 208 31 4 422 3 dbp10 ATP-dependent RNA helicase dbp10 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A1CJ18 3.93e-58 201 31 6 416 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A5E6W6 4.75e-58 201 35 10 377 3 RRP3 ATP-dependent rRNA helicase RRP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q5A9Z6 5.06e-58 198 32 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Candida albicans (strain SC5314 / ATCC MYA-2876)
B7ZTW1 5.09e-58 199 33 3 370 2 eif4a3 Eukaryotic initiation factor 4A-III Xenopus tropicalis
Q5W5U4 5.31e-58 205 35 4 338 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Bos taurus
B5DG42 5.84e-58 198 33 3 370 2 eif4a3 Eukaryotic initiation factor 4A-III Salmo salar
Q7Y183 7.11e-58 200 32 3 381 2 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. japonica
A2XKG2 7.11e-58 200 32 3 381 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. indica
O42226 7.5e-58 198 33 3 370 2 eif4a3-b Eukaryotic initiation factor 4A-III-B Xenopus laevis
Q757U8 8.33e-58 207 31 5 419 3 DBP10 ATP-dependent RNA helicase DBP10 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A3GFV3 9.05e-58 197 33 4 378 3 FAL1 ATP-dependent RNA helicase FAL1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q2U5A2 1.04e-57 200 31 5 424 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q7S9J4 1.11e-57 207 33 5 396 3 dbp-10 ATP-dependent RNA helicase dbp-10 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1D8G1 1.17e-57 200 31 4 422 3 dhh1 ATP-dependent RNA helicase dhh1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1CTZ6 1.31e-57 206 31 4 421 3 dbp10 ATP-dependent RNA helicase dbp10 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q5U526 1.46e-57 197 33 3 370 2 eif4a3-a Eukaryotic initiation factor 4A-III-A Xenopus laevis
P39517 1.55e-57 200 32 3 369 1 DHH1 ATP-dependent RNA helicase DHH1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXG9 1.55e-57 200 32 3 369 3 DHH1 ATP-dependent RNA helicase DHH1 Saccharomyces cerevisiae (strain YJM789)
Q6FQU5 1.83e-57 199 32 4 392 3 DHH1 ATP-dependent RNA helicase DHH1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q09903 2.05e-57 204 34 7 369 3 drs1 ATP-dependent RNA helicase drs1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6CT85 2.17e-57 199 35 5 381 3 RRP3 ATP-dependent rRNA helicase RRP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q54Y81 2.18e-57 205 33 5 390 2 helB2 ATP-dependent RNA helicase ddx23 Dictyostelium discoideum
A1D1R8 2.23e-57 205 34 7 363 3 drs1 ATP-dependent RNA helicase drs1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q9VHS8 2.25e-57 196 33 3 370 1 CG7483 Eukaryotic initiation factor 4A-III Drosophila melanogaster
P34580 2.29e-57 199 33 3 358 3 T26G10.1 Putative ATP-dependent RNA helicase T26G10.1 Caenorhabditis elegans
Q6BTL5 2.32e-57 204 33 6 359 3 DRS1 ATP-dependent RNA helicase DRS1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A3LRW2 2.51e-57 199 36 9 360 3 DBP3 ATP-dependent RNA helicase DBP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5BFU7 2.59e-57 206 31 4 411 3 dbp10 ATP-dependent RNA helicase dbp10 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8L7S8 2.89e-57 204 34 6 372 1 RH3 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Arabidopsis thaliana
A5DY34 3.01e-57 202 33 8 365 3 DRS1 ATP-dependent RNA helicase DRS1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q0CBE1 3.05e-57 199 31 8 426 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q6BQ61 3.11e-57 198 33 5 389 3 RRP3 ATP-dependent rRNA helicase RRP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q26696 3.39e-57 200 34 6 355 3 HEL64 Putative DEAD-box RNA helicase HEL64 Trypanosoma brucei brucei
Q29S22 3.58e-57 197 32 3 383 2 DDX47 Probable ATP-dependent RNA helicase DDX47 Bos taurus
A7F4L5 3.7e-57 204 35 5 356 3 drs1 ATP-dependent RNA helicase drs1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q5ACU6 3.9e-57 199 34 5 374 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2QY39 3.97e-57 199 33 4 374 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4WWD3 4.05e-57 199 32 3 393 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9CWX9 4.79e-57 197 33 3 374 2 Ddx47 Probable ATP-dependent RNA helicase DDX47 Mus musculus
Q7ZVA6 5.25e-57 196 33 3 370 2 eif4a3 Eukaryotic initiation factor 4A-III Danio rerio
Q7L014 7.4e-57 205 34 6 379 1 DDX46 Probable ATP-dependent RNA helicase DDX46 Homo sapiens
Q0CMM8 8.61e-57 204 31 5 424 3 dbp10 ATP-dependent RNA helicase dbp10 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9H0S4 8.62e-57 196 33 3 373 1 DDX47 Probable ATP-dependent RNA helicase DDX47 Homo sapiens
A6RUH2 9.12e-57 203 35 5 356 3 drs1 ATP-dependent RNA helicase drs1 Botryotinia fuckeliana (strain B05.10)
Q58083 9.45e-57 194 32 8 352 1 MJ0669 Probable ATP-dependent RNA helicase MJ0669 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q569Z5 9.93e-57 204 34 6 379 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Mus musculus
Q2GQ93 1.09e-56 197 32 4 373 3 DHH1 ATP-dependent RNA helicase DHH1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q4WRV2 1.12e-56 203 35 7 362 3 drs1 ATP-dependent RNA helicase drs1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q62780 1.14e-56 204 34 6 379 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Rattus norvegicus
A7EM88 1.65e-56 194 31 3 382 3 fal1 ATP-dependent RNA helicase fal1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A4QU31 1.83e-56 194 31 3 370 3 FAL1 ATP-dependent RNA helicase FAL1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0CZN5 2.26e-56 202 34 7 361 3 drs1 ATP-dependent RNA helicase drs1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q4HW67 2.63e-56 197 31 4 376 3 DHH1 ATP-dependent RNA helicase DHH1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5R6D8 2.83e-56 203 34 6 379 2 DDX46 Probable ATP-dependent RNA helicase DDX46 Pongo abelii
Q4WPE9 2.83e-56 201 32 3 380 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6C347 3.03e-56 193 32 3 370 3 FAL1 ATP-dependent RNA helicase FAL1 Yarrowia lipolytica (strain CLIB 122 / E 150)
A1CX72 3.43e-56 201 32 3 380 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4P9P3 3.45e-56 202 32 5 384 3 DRS1 ATP-dependent RNA helicase DRS1 Ustilago maydis (strain 521 / FGSC 9021)
Q5ACK7 3.69e-56 198 33 6 365 3 DRS1 ATP-dependent RNA helicase DRS1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A5DQF1 3.8e-56 195 33 5 372 3 RRP3 ATP-dependent rRNA helicase RRP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q9VIF6 3.98e-56 196 33 7 384 1 pths ATP-dependent RNA helicase DDX47 Drosophila melanogaster
P27639 4.6e-56 193 33 5 369 2 inf-1 Eukaryotic initiation factor 4A Caenorhabditis elegans
A7TGU7 4.91e-56 195 31 5 392 3 DHH1 ATP-dependent RNA helicase DHH1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P0CQ98 4.95e-56 202 33 7 365 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12895
Feature type CDS
Gene rhlB
Product ATP-dependent RNA helicase RhlB
Location 16785 - 18080 (strand: -1)
Length 1296 (nucleotides) / 431 (amino acids)

Contig

Accession ZDB_370
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1325
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0513 Replication, recombination and repair (L) L Superfamily II DNA and RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03732 ATP-dependent RNA helicase RhlB [EC:3.6.4.13] RNA degradation -

Protein Sequence

MSKTHLTDKKFSDFALHTKVVEALDSKGFYNCTPIQALTLPLTINGRDVAGQAQTGTGKTLAFLTSTFHHLLTHPAPEGRKINQPRALIMAPTRELAVQIHSDAEPLSQLTGLKTGLAYGGDGYDKQIKVLDEGVDVIIGTTGRLIDFAKQGRLDLSAIQVVVLDEADRMYDLGFIKDIRWLFRHMPPCAERMNLLFSATLSYRVRELAFEQMNNPEYIEIEPEQRTGHRIKEELFYPSNEEKMRLLQTLLEEEWPDRCIIFANTKHRCEDIWAHLAADGHRVGLLTGDVAQKKRLRILEDFTHGNLDILVATDVAARGLHIPSVTHVFNYDLPDDCEDYVHRIGRTGRAGESGHSISLACEEYALNLPAIEEYTGHPIPVSKYNSDALLTDLPVPKRRRRPPRTGGGQNRRNMPRRSSNGPRHNNNRTKR

Flanking regions ( +/- flanking 50bp)

CAGCGAATAGACTTCCGTAACGCAACATTAAACTGATATTCTACCTAAATATGAGCAAAACACATTTAACAGACAAGAAGTTTTCTGACTTCGCCTTGCATACTAAAGTGGTAGAAGCGCTTGATTCTAAGGGCTTTTATAACTGCACGCCTATTCAGGCGCTGACACTTCCCCTGACGATCAACGGCCGGGATGTTGCAGGACAGGCACAAACAGGAACAGGGAAGACGCTGGCATTTCTGACGTCAACGTTTCATCATTTACTTACCCATCCGGCACCGGAAGGCCGCAAAATCAATCAGCCGCGTGCGCTGATTATGGCCCCGACCCGCGAACTCGCGGTTCAGATCCATTCCGACGCCGAACCACTGTCTCAGCTTACCGGGCTGAAAACCGGCCTGGCTTACGGCGGTGACGGCTACGACAAACAAATCAAAGTGCTGGATGAAGGCGTCGATGTGATTATCGGCACCACCGGGCGCTTAATCGACTTCGCCAAACAGGGCCGTCTCGACCTGAGCGCCATTCAGGTTGTCGTTCTCGATGAAGCTGACCGTATGTACGATCTCGGCTTTATCAAAGATATCCGCTGGCTGTTCCGCCATATGCCGCCATGTGCCGAGCGTATGAACCTGCTGTTCTCCGCGACACTTTCCTACCGCGTCCGTGAGCTCGCATTTGAGCAGATGAACAACCCGGAATACATTGAAATTGAACCGGAACAGCGTACCGGTCACCGGATCAAAGAAGAGTTATTCTATCCGTCCAACGAAGAAAAAATGCGCCTTCTCCAGACACTTCTGGAAGAAGAGTGGCCGGATCGCTGCATTATTTTCGCTAATACCAAACACCGCTGTGAAGATATCTGGGCGCACCTGGCGGCTGACGGCCACCGTGTCGGCCTGCTGACCGGCGATGTGGCGCAGAAAAAACGTCTGCGTATTCTCGAGGATTTCACTCACGGTAATCTGGATATTCTGGTGGCAACGGATGTTGCGGCCCGTGGTCTGCATATCCCGTCAGTAACTCACGTCTTTAACTATGATCTGCCGGATGACTGTGAAGATTACGTTCACCGTATCGGCCGTACCGGGCGTGCCGGGGAAAGTGGTCACTCCATCAGCCTGGCCTGTGAAGAGTACGCACTGAACCTGCCTGCGATTGAAGAATATACCGGCCATCCGATTCCGGTCAGTAAATACAACAGCGATGCACTGCTGACTGATCTGCCGGTGCCGAAGCGCCGCCGTCGTCCGCCGCGCACCGGGGGTGGTCAGAACCGCCGTAATATGCCGCGCCGCAGCAGCAACGGGCCGCGTCATAACAATAACCGCACCAAACGCTGAAGGCTGCCATGCTGAGATCGTCCTCGCTTTATGCTGCCATCGATCTGGGT