Homologs in group_1037

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05345 FBDBKF_05345 100.0 Morganella morganii S1 hns DNA-binding protein H-NS
EHELCC_12245 EHELCC_12245 100.0 Morganella morganii S2 hns DNA-binding protein H-NS
NLDBIP_12585 NLDBIP_12585 100.0 Morganella morganii S4 hns DNA-binding protein H-NS
HKOGLL_11060 HKOGLL_11060 100.0 Morganella morganii S5 hns DNA-binding protein H-NS
F4V73_RS05800 F4V73_RS05800 86.0 Morganella psychrotolerans hns histone-like nucleoid-structuring protein H-NS
PMI_RS07205 PMI_RS07205 67.2 Proteus mirabilis HI4320 hns histone-like nucleoid-structuring protein H-NS

Distribution of the homologs in the orthogroup group_1037

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1037

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DOA5 1.77e-60 185 68 1 136 1 hns DNA-binding protein H-NS Yersinia enterocolitica
P18818 2.03e-55 172 65 1 135 3 hns DNA-binding protein H-NS Proteus vulgaris
P09120 7.84e-54 168 67 0 136 1 hns DNA-binding protein H-NS Shigella flexneri
P0ACF8 7.84e-54 168 67 0 136 1 hns DNA-binding protein H-NS Escherichia coli (strain K12)
P0ACF9 7.84e-54 168 67 0 136 3 hns DNA-binding protein H-NS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACG0 7.84e-54 168 67 0 136 3 hns DNA-binding protein H-NS Escherichia coli O157:H7
P18955 1.36e-53 167 68 0 135 3 hns DNA-binding protein H-NS Serratia marcescens
P0A1S2 8.59e-52 163 66 0 136 1 hns DNA-binding protein H-NS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NBY9 8.59e-52 163 66 0 136 1 hns DNA-binding protein H-NS Salmonella typhimurium (strain SL1344)
P0A1S3 8.59e-52 163 66 0 136 3 hns DNA-binding protein H-NS Salmonella typhi
A0A0F6B244 8.59e-52 163 66 0 136 1 hns DNA-binding protein H-NS Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PCT5 1.43e-50 160 65 0 136 3 hns DNA-binding protein H-NS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P57360 3e-40 134 52 0 135 3 hns DNA-binding protein H-NS homolog Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P43841 6.34e-39 130 50 1 135 3 hns DNA-binding protein H-NS homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9L5H8 5.34e-36 123 57 1 135 1 hns DNA-binding protein H-NS, plasmid Salmonella typhi
P0ACG3 1.68e-35 122 54 1 135 1 stpA DNA-binding protein StpA Shigella flexneri
P0ACG1 1.68e-35 122 54 1 135 1 stpA DNA-binding protein StpA Escherichia coli (strain K12)
P0ACG2 1.68e-35 122 54 1 135 3 stpA DNA-binding protein StpA Escherichia coli O157:H7
P0A1S4 9.33e-34 117 52 2 135 3 stpA DNA-binding protein StpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1S5 9.33e-34 117 52 2 135 3 stpA DNA-binding protein StpA Salmonella typhi

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12445
Feature type CDS
Gene hns
Product DNA-binding protein H-NS
Location 102845 - 103255 (strand: -1)
Length 411 (nucleotides) / 136 (amino acids)
In genomic island -

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1037
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00816 H-NS histone C-terminal domain
PF22470 H-NS histone-like proteins, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2916 Transcription (K) K DNA-binding protein H-NS

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03746 DNA-binding protein H-NS - -

Protein Sequence

MSESLKPFNNIRTLRAQARESSLEVLEEILEKLTSVVEERRLEESQAQAKEEERTRKLEEFRQLLEKQNINPEELIQSMGTGKTARKSKRAQRPAKYEYIDENGESKTWTGQGRTPAVIKQAIDNEGKSLNDFLIK

Flanking regions ( +/- flanking 50bp)

AATCTATTATTATCTACACACCAGCCAACATTTAATTTGAGACCAGGATTATGAGTGAATCTTTGAAGCCATTTAATAATATCCGTACTCTTCGCGCTCAGGCGAGAGAATCCAGCTTAGAAGTTTTAGAAGAAATTCTGGAAAAGCTGACTTCTGTTGTTGAAGAACGCCGTCTGGAAGAATCCCAGGCTCAGGCTAAAGAAGAAGAGCGCACCCGTAAATTAGAAGAATTCCGTCAGCTGCTTGAAAAGCAGAATATCAACCCGGAAGAATTAATTCAGTCTATGGGTACAGGCAAAACAGCCCGCAAATCCAAGCGTGCTCAGCGCCCTGCCAAATACGAATATATCGATGAAAACGGTGAAAGCAAAACCTGGACCGGCCAGGGCCGTACACCAGCTGTGATCAAACAAGCTATCGATAACGAAGGTAAATCTCTGAACGATTTCTTAATCAAGTAAGTGATAATATCTGCCGGAAAAGCCCTTCTCTGAAGGGCTTTTTTATATCT