Homologs in group_1098

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05815 FBDBKF_05815 100.0 Morganella morganii S1 sufD Fe-S cluster assembly protein SufD
EHELCC_11775 EHELCC_11775 100.0 Morganella morganii S2 sufD Fe-S cluster assembly protein SufD
NLDBIP_12115 NLDBIP_12115 100.0 Morganella morganii S4 sufD Fe-S cluster assembly protein SufD
HKOGLL_10590 HKOGLL_10590 100.0 Morganella morganii S5 sufD Fe-S cluster assembly protein SufD
F4V73_RS03510 F4V73_RS03510 81.8 Morganella psychrotolerans sufD Fe-S cluster assembly protein SufD
PMI_RS06835 PMI_RS06835 56.6 Proteus mirabilis HI4320 sufD Fe-S cluster assembly protein SufD

Distribution of the homologs in the orthogroup group_1098

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1098

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77689 8.94e-142 414 54 4 387 1 sufD Iron-sulfur cluster assembly protein SufD Escherichia coli (strain K12)
Q55792 2.35e-36 142 27 9 403 3 slr0076 Iron-sulfur cluster assembly SufBD family protein slr0076 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9LQK7 1.89e-33 134 28 7 334 1 ABCI7 Protein ABCI7, chloroplastic Arabidopsis thaliana
Q49W57 2.08e-17 87 24 0 225 3 SSP1857 Iron-sulfur cluster assembly SufBD family protein SSP1857 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49682 1.72e-16 84 27 2 200 3 ML0594 Iron-sulfur cluster assembly SufBD family protein ML0594 Mycobacterium leprae (strain TN)
Q8CTA3 3.08e-16 84 24 0 225 3 SE_0610 Iron-sulfur cluster assembly SufBD family protein SE_0610 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQP8 4.6e-16 83 24 0 225 3 SERP0500 Iron-sulfur cluster assembly SufBD family protein SERP0500 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L4T1 6.32e-16 83 24 0 225 3 SH2035 Iron-sulfur cluster assembly SufBD family protein SH2035 Staphylococcus haemolyticus (strain JCSC1435)
Q6GIH0 1.01e-15 82 24 0 225 3 SAR0880 Iron-sulfur cluster assembly SufBD family protein SAR0880 Staphylococcus aureus (strain MRSA252)
Q8IIW9 1.29e-15 83 26 4 256 1 SufD Iron-sulfur cluster assembly protein SufD Plasmodium falciparum (isolate 3D7)
Q5HHG8 1.51e-15 82 24 0 225 3 SACOL0918 Iron-sulfur cluster assembly SufBD family protein SACOL0918 Staphylococcus aureus (strain COL)
Q2FZY3 1.51e-15 82 24 0 225 3 SAOUHSC_00851 Iron-sulfur cluster assembly SufBD family protein SAOUHSC_00851 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q99VF9 1.51e-15 82 24 0 225 3 SAV0846 Iron-sulfur cluster assembly SufBD family protein SAV0846 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FIF6 1.51e-15 82 24 0 225 3 SAUSA300_0822 Iron-sulfur cluster assembly SufBD family protein SAUSA300_0822 Staphylococcus aureus (strain USA300)
Q7A1E0 1.51e-15 82 24 0 225 3 MW0799 Iron-sulfur cluster assembly SufBD family protein MW0799 Staphylococcus aureus (strain MW2)
Q6GB09 1.51e-15 82 24 0 225 3 SAS0788 Iron-sulfur cluster assembly SufBD family protein SAS0788 Staphylococcus aureus (strain MSSA476)
Q7A6L4 1.51e-15 82 24 0 225 1 SA0778 Iron-sulfur cluster assembly SufBD family protein SA0778 Staphylococcus aureus (strain N315)
Q2YWN2 1.51e-15 82 24 0 225 3 SAB0778 Iron-sulfur cluster assembly SufBD family protein SAB0778 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WFP5 6.44e-15 79 26 2 201 1 Rv1462 Iron-sulfur cluster assembly SufBD family protein Rv1462 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P59973 6.62e-15 79 26 2 201 3 BQ2027_MB1497 Iron-sulfur cluster assembly SufBD family protein Mb1497 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP4 6.62e-15 79 26 2 201 3 MT1509 Iron-sulfur cluster assembly SufBD family protein MT1509 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32162 2.14e-14 78 24 2 287 3 sufB Iron-sulfur cluster assembly protein SufB Bacillus subtilis (strain 168)
O50093 2.19e-14 78 24 8 294 3 PH1385 Iron-sulfur cluster assembly SufBD family protein PH1385 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O32165 3.81e-14 77 26 0 180 3 sufD Iron-sulfur cluster assembly protein SufD Bacillus subtilis (strain 168)
Q9TLX2 3.81e-14 77 24 2 239 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Cyanidium caldarium
Q9ZS97 8.46e-14 77 27 1 180 2 ABCI8 Iron-sulfur cluster assembly SufBD family protein ABCI8, chloroplastic Arabidopsis thaliana
Q55790 8.87e-14 76 25 3 233 3 slr0074 Iron-sulfur cluster assembly SufBD family protein slr0074 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P48260 2.67e-13 75 28 2 187 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Cyanophora paradoxa
P35912 3.14e-13 72 28 2 182 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 (Fragment) Galdieria sulphuraria
Q49689 4.17e-13 75 24 6 288 3 ML0593 Iron-sulfur cluster assembly SufBD family protein ML0593 Mycobacterium leprae (strain TN)
Q1XDP7 1.95e-11 69 25 1 180 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Neopyropia yezoensis
P49530 5.28e-11 68 23 2 227 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Trieres chinensis
A0A509AQJ1 5.61e-11 68 23 4 259 1 SufD Iron-sulfur cluster assembly protein SufD Plasmodium berghei (strain Anka)
O78473 6.26e-11 67 25 5 229 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Guillardia theta
P77522 8.6e-11 67 27 0 165 1 sufB Iron-sulfur cluster assembly protein SufB Escherichia coli (strain K12)
Q83KW2 1.01e-10 67 27 0 165 3 sufB Iron-sulfur cluster assembly protein SufB Shigella flexneri
Q25799 1.13e-10 67 22 0 183 1 SufB Iron-sulfur cluster assembly protein SufB Plasmodium falciparum (isolate 3D7)
Q02857 1.47e-10 65 24 3 234 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 (Fragment) Antithamnion sp.
P67126 1.85e-10 66 27 0 157 3 BQ2027_MB1496 Iron-sulfur cluster assembly SufBD family protein Mb1496 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP7 1.85e-10 66 27 0 157 1 Rv1461 Iron-sulfur cluster assembly SufBD family protein Rv1461 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFP6 1.85e-10 66 27 0 157 3 MT1508 Iron-sulfur cluster assembly SufBD family protein MT1508 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P51240 2.02e-10 66 22 1 180 3 ycf24 Iron-sulfur cluster assembly SufBD family protein ycf24 Porphyra purpurea
O27218 1.65e-05 50 24 10 275 3 MTH_1150 Iron-sulfur cluster assembly SufBD family protein MTH_1150 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O30305 2.99e-05 49 27 6 152 3 AF_2365 Iron-sulfur cluster assembly SufBD family protein AF_2365 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q50519 3.83e-05 49 37 0 66 3 None Iron-sulfur cluster assembly SufBD family protein MTH1150 homolog Methanothermobacter thermautotrophicus (strain Winter)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_11975
Feature type CDS
Gene sufD
Product Fe-S cluster assembly protein SufD
Location 14829 - 16133 (strand: 1)
Length 1305 (nucleotides) / 434 (amino acids)
In genomic island -

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1098
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01458 SUF system FeS cluster assembly, SufBD

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0719 Posttranslational modification, protein turnover, chaperones (O) O Fe-S cluster assembly scaffold protein SufB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09015 Fe-S cluster assembly protein SufD - -

Protein Sequence

MAGLLTNSERALKRREVSERNLAAMGRIEQLIAQHPLSGHAAQHWQQAQKTGFPAFHQEDWHYTSLTPLLEADYQDKTGTLNVLPEAVLTSLNAYRIVLVDGVFAPQWSDADFGVFELSVADRHSEFPAPVNGEIFLHLTESLAQTPLMIRVKAGAQAEKPLYIVNISTAHNDFLNMRHSRYHLDIGANAAVSVIEHFISPDEQSAHFTGARMTANVGENSDFRHLKLGFENPQAYHFAHNDLVIAAHARVESTSFLLGGKLTRHHTSTQLNGEGIVLAMNSLVLPKHGEIADTRTYLEHNKGYCESRQRHKTIVMDNSRAVFNGMIKVAPHALKTDGQMTNNNLLLGRKAEIDTKPQLEIYADDVKCSHGATVGRIDEEQLFYLRTRGIAEKAAKQMIILAFAAELTDAISDEVLNNVVMARIRQSLDQGDKQ

Flanking regions ( +/- flanking 50bp)

CATCAAATCCGGTGATTTCTCACTGGCGAAAAAACTGGAGGAGCAGGGATATGGCTGGCTTATTGACCAACAGTGAACGCGCGCTGAAACGCCGCGAAGTCAGTGAGCGCAATCTGGCCGCAATGGGGCGGATAGAACAGCTTATCGCGCAGCATCCGCTCTCCGGGCACGCCGCGCAGCACTGGCAGCAGGCACAGAAAACCGGCTTCCCGGCCTTTCATCAGGAAGACTGGCATTATACGTCGCTGACACCATTGCTGGAGGCAGATTATCAGGATAAGACCGGAACACTGAACGTCTTACCGGAGGCGGTGCTGACCTCACTGAATGCATACCGCATAGTGCTGGTGGACGGTGTATTTGCCCCGCAGTGGAGTGATGCGGATTTTGGTGTGTTTGAGTTATCAGTGGCTGATCGCCACAGTGAATTCCCGGCACCGGTTAACGGCGAGATTTTCCTGCACCTGACTGAAAGCCTGGCGCAGACACCGTTAATGATCCGCGTGAAAGCCGGCGCACAGGCGGAAAAACCCCTGTATATCGTGAATATTTCAACGGCACATAATGATTTTCTGAATATGCGCCACAGCCGCTATCACCTCGATATCGGTGCGAATGCGGCTGTCTCTGTGATTGAGCACTTTATCAGCCCGGATGAACAATCAGCCCATTTCACCGGGGCGCGGATGACCGCGAACGTGGGAGAAAACAGTGATTTCCGCCATCTGAAACTGGGGTTTGAAAACCCGCAGGCGTACCATTTTGCCCATAATGATTTGGTGATCGCCGCCCATGCCCGTGTGGAAAGCACCAGTTTCCTGCTCGGCGGTAAACTGACCCGGCATCACACCAGCACACAGCTTAACGGCGAAGGTATTGTGCTGGCCATGAACAGCCTTGTGCTGCCGAAACACGGCGAAATCGCTGATACCCGCACGTACCTGGAACATAACAAAGGGTACTGTGAAAGCCGCCAGCGCCATAAAACCATTGTGATGGATAACAGCCGTGCGGTATTTAACGGCATGATTAAAGTGGCACCGCATGCACTGAAAACAGACGGCCAGATGACCAACAATAACCTGTTACTGGGCCGGAAAGCAGAAATCGATACCAAACCGCAGCTGGAAATCTATGCCGATGATGTGAAGTGCAGCCACGGTGCGACGGTCGGGCGGATTGATGAGGAACAGCTGTTTTATCTGCGCACACGCGGGATCGCGGAAAAAGCCGCGAAGCAGATGATCATCCTCGCGTTTGCTGCGGAACTGACTGATGCGATCAGCGATGAAGTCCTGAATAACGTGGTGATGGCGCGTATCCGTCAGTCGCTGGATCAGGGGGATAAACAGTAATGAGTTATTCAGCACAACAGCGGCGGGCAGACTTCCCGGTACTGGCCGGG