Homologs in group_2004

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15065 FBDBKF_15065 100.0 Morganella morganii S1 rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
EHELCC_11180 EHELCC_11180 100.0 Morganella morganii S2 rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
NLDBIP_11525 NLDBIP_11525 100.0 Morganella morganii S4 rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
HKOGLL_09995 HKOGLL_09995 100.0 Morganella morganii S5 rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
F4V73_RS12385 F4V73_RS12385 90.9 Morganella psychrotolerans rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
PMI_RS01630 PMI_RS01630 74.5 Proteus mirabilis HI4320 rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase

Distribution of the homologs in the orthogroup group_2004

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2004

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37995 1.39e-135 384 75 1 244 3 rsmE Ribosomal RNA small subunit methyltransferase E Dickeya dadantii (strain 3937)
P0AGL9 5.5e-134 380 76 0 243 3 rsmE Ribosomal RNA small subunit methyltransferase E Shigella flexneri
P0AGL7 5.5e-134 380 76 0 243 1 rsmE Ribosomal RNA small subunit methyltransferase E Escherichia coli (strain K12)
P0AGL8 5.5e-134 380 76 0 243 3 rsmE Ribosomal RNA small subunit methyltransferase E Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44627 1.97e-112 325 66 1 244 1 rsmE Ribosomal RNA small subunit methyltransferase E Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9E4 2.22e-72 224 47 1 243 3 rsmE Ribosomal RNA small subunit methyltransferase E Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57488 2.54e-58 188 42 1 242 3 rsmE Ribosomal RNA small subunit methyltransferase E Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P54461 5.79e-26 104 31 1 225 1 rsmE Ribosomal RNA small subunit methyltransferase E Bacillus subtilis (strain 168)
O50188 7.65e-22 93 30 6 215 3 rsmE Ribosomal RNA small subunit methyltransferase E Mesomycoplasma hyopneumoniae (strain 232)
Q9ZDZ5 7.59e-19 84 33 5 202 3 rsmE Ribosomal RNA small subunit methyltransferase E Rickettsia prowazekii (strain Madrid E)
Q92J59 1.09e-18 85 30 7 229 3 rsmE Ribosomal RNA small subunit methyltransferase E Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P72667 3e-17 82 27 7 232 3 rsmE Ribosomal RNA small subunit methyltransferase E Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGX1 6.29e-15 75 25 4 220 1 rsmE Ribosomal RNA small subunit methyltransferase E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGX0 6.29e-15 75 25 4 220 3 rsmE Ribosomal RNA small subunit methyltransferase E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67203 6.29e-15 75 25 4 220 3 rsmE Ribosomal RNA small subunit methyltransferase E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O66552 2.74e-13 70 28 5 190 1 rsmE Ribosomal RNA small subunit methyltransferase E Aquifex aeolicus (strain VF5)
Q9ZKD2 6.34e-10 60 28 13 243 3 rsmE Ribosomal RNA small subunit methyltransferase E Helicobacter pylori (strain J99 / ATCC 700824)
O51333 5.56e-08 55 22 4 220 3 rsmE2 Ribosomal RNA small subunit methyltransferase E 2 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O25138 2.16e-07 53 26 10 239 3 rsmE Ribosomal RNA small subunit methyltransferase E Helicobacter pylori (strain ATCC 700392 / 26695)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_11385
Feature type CDS
Gene rsmE
Product 16S rRNA (uracil(1498)-N(3))-methyltransferase
Location 61842 - 62573 (strand: 1)
Length 732 (nucleotides) / 243 (amino acids)

Contig

Accession ZDB_368
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2004
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04452 RNA methyltransferase domain
PF20260 RNA methyltransferase PUA domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1385 Translation, ribosomal structure and biogenesis (J) J 16S rRNA U1498 N3-methylase RsmE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09761 16S rRNA (uracil1498-N3)-methyltransferase [EC:2.1.1.193] - -

Protein Sequence

MRIPRIYHPGTLTPGLVTELTDDGANHVARVLRMKTGYSLILFNGTNRIFNAEITDISKKSVSVRVTDEQDDNRESPLSIHLGQVMSRGEKMEFTIQKSVELGVQIITPLISERCGVKLDGERLEKKQQQWQKIAIAACEQCGRNMIPEIRPVQTLEAWCAENDDALKINLHPRASQSINTLPAETAKVRLLIGPEGGLSAEEIAMTAGHQFTDILLGPRVLRTETTALTAITALQVRFGDLG

Flanking regions ( +/- flanking 50bp)

GCAATGTGTATCAACCGGCAGTGTGCCGGCAGAACGTAAAGGATATTTTCATGCGGATCCCGCGCATTTATCACCCCGGCACTTTAACCCCCGGCCTGGTGACTGAACTGACAGATGACGGCGCCAACCATGTTGCCCGTGTGCTCCGGATGAAAACCGGCTATTCCCTGATCCTGTTTAACGGCACCAACCGGATTTTTAATGCCGAAATTACGGATATCAGCAAAAAAAGTGTGTCCGTCCGTGTAACAGATGAGCAGGACGACAACCGCGAATCCCCGCTGTCCATCCATCTCGGACAGGTGATGTCACGCGGCGAAAAAATGGAATTCACCATTCAGAAATCCGTTGAACTGGGTGTTCAGATTATTACCCCCCTGATCTCTGAACGCTGTGGTGTTAAACTGGACGGTGAACGGCTGGAGAAAAAACAGCAGCAGTGGCAGAAAATTGCCATCGCCGCCTGCGAGCAGTGCGGACGTAACATGATTCCGGAGATCCGCCCGGTGCAGACCCTGGAAGCATGGTGTGCAGAAAATGATGATGCTCTGAAAATAAATTTACATCCGCGCGCATCACAAAGTATCAATACTCTGCCCGCAGAAACCGCTAAAGTGCGATTGCTGATTGGCCCGGAAGGCGGGCTGTCAGCAGAGGAAATCGCGATGACCGCCGGTCATCAGTTTACCGACATATTATTAGGGCCGCGTGTATTACGCACAGAAACCACCGCGCTCACTGCAATCACCGCATTGCAGGTGCGTTTCGGCGATCTGGGTTAAGGAGAAAAAATGATCAAGCTCGGTATTGTGATGGATCCTATCGATTCCAT