Homologs in group_90

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09110 FBDBKF_09110 100.0 Morganella morganii S1 fimC P pilus assembly protein, chaperone PapD
FBDBKF_10795 FBDBKF_10795 40.0 Morganella morganii S1 fimC P pilus assembly protein, chaperone PapD
EHELCC_10300 EHELCC_10300 100.0 Morganella morganii S2 fimC P pilus assembly protein, chaperone PapD
EHELCC_15130 EHELCC_15130 40.0 Morganella morganii S2 fimC P pilus assembly protein, chaperone PapD
NLDBIP_10645 NLDBIP_10645 100.0 Morganella morganii S4 fimC P pilus assembly protein, chaperone PapD
NLDBIP_14960 NLDBIP_14960 40.0 Morganella morganii S4 fimC P pilus assembly protein, chaperone PapD
LHKJJB_14385 LHKJJB_14385 40.0 Morganella morganii S3 fimC P pilus assembly protein, chaperone PapD
HKOGLL_13005 HKOGLL_13005 40.0 Morganella morganii S5 fimC P pilus assembly protein, chaperone PapD
HKOGLL_13770 HKOGLL_13770 100.0 Morganella morganii S5 fimC P pilus assembly protein, chaperone PapD
F4V73_RS10840 F4V73_RS10840 86.6 Morganella psychrotolerans - molecular chaperone
PMI_RS02645 PMI_RS02645 39.4 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone

Distribution of the homologs in the orthogroup group_90

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_90

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P35757 1.09e-56 183 43 5 226 3 hifB Chaperone protein HifB Haemophilus influenzae
P45991 1.33e-56 183 42 5 228 3 hifB Chaperone protein HifB Haemophilus influenzae
P33342 9.6e-55 178 41 2 220 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P21646 1.63e-50 167 37 4 226 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P33409 3.53e-44 151 37 4 225 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P33128 7.74e-38 135 36 4 216 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
Q8X5K6 3.2e-36 130 37 7 225 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 1.78e-35 128 38 5 204 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P62609 4.18e-35 127 35 8 229 1 focC Chaperone protein FocC Escherichia coli
P62610 4.18e-35 127 35 8 229 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59590 2.23e-34 126 35 8 226 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P31697 3.66e-33 122 35 8 226 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P37923 4.62e-32 119 33 7 229 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P75749 5.86e-31 117 30 5 231 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P25402 1.73e-29 113 30 4 230 3 fanE Chaperone protein FanE Escherichia coli
P53520 2.55e-28 110 30 7 226 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P15319 3.62e-28 109 32 8 230 1 papD Chaperone protein PapD Escherichia coli
P42914 1.06e-26 105 30 7 225 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P77249 4.55e-26 104 32 9 233 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P77599 4.59e-24 99 33 8 214 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P25401 6.22e-20 88 27 7 232 1 faeE Chaperone protein FaeE Escherichia coli
P26926 1.69e-19 87 30 5 220 1 caf1M Chaperone protein caf1M Yersinia pestis
Q05433 2.21e-19 87 27 6 236 3 clpE Chaperone protein ClpE Escherichia coli
P75856 2.93e-19 86 28 8 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
Q8X5E4 3.09e-19 86 28 8 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P69966 1.87e-18 84 29 7 227 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 1.87e-18 84 29 7 227 3 psaB Chaperone protein PsaB Yersinia pestis
P77616 2.47e-18 84 28 11 232 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P40876 4.99e-18 83 28 5 225 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P53516 2.64e-17 81 29 6 206 3 afaB Chaperone protein AfaB Escherichia coli
P46004 1.33e-16 79 27 7 223 3 aggD Chaperone protein AggD Escherichia coli
P53518 2.96e-16 78 27 5 229 3 cssC Chaperone protein CssC Escherichia coli
P53519 8.93e-16 77 26 6 231 3 cssC Chaperone protein CssC Escherichia coli
P33387 6.69e-15 74 27 5 210 3 sefB Chaperone protein SefB Salmonella enteritidis
P33407 4.26e-14 72 27 10 248 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P46738 5.05e-14 72 28 6 206 3 nfaE Chaperone protein NfaE Escherichia coli
P15483 1.53e-12 68 28 9 212 3 None Chaperone protein CS3-1 Escherichia coli
P42183 3.27e-07 50 29 4 104 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_10710
Feature type CDS
Gene fimC
Product P pilus assembly protein, chaperone PapD
Location 113283 - 113981 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession ZDB_367
Length 191445 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_90
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15540 chaperone protein EcpD - -

Protein Sequence

MKKIILTLLLLTVTFVSPANVIINSTRVIYPQGSKEVPVQLFNTGTQQALVQAWIDDGNPDSTPETANVPFILTPPVVKIDGKNGQQLRVKMTPVQLPADRESLFYLNLLDIPPLPENSADKNMMQIAIRSRIKLFYRPSGLTLSADKAHTRLTFTRDGQHYILKNDSPYHINILGLKETANSRDLAEEGTMIAPYSQFTLPAAAGLPAGNHYSLTLIDDFGAINTYPLSLN

Flanking regions ( +/- flanking 50bp)

TATTTTCAGGCCTCTTTAATTCAGGGGCCTGATTTTTGAAAATACACATCATGAAAAAAATCATCTTAACATTGTTGTTATTAACAGTGACATTTGTCAGTCCGGCAAACGTTATTATTAATTCCACCCGTGTTATTTATCCGCAGGGAAGTAAAGAGGTTCCGGTACAATTATTTAACACCGGAACACAGCAGGCATTAGTCCAGGCATGGATTGATGACGGCAACCCCGATTCCACACCGGAAACGGCGAATGTCCCGTTTATCCTGACACCGCCGGTGGTTAAAATCGACGGTAAAAATGGTCAGCAACTGCGGGTGAAAATGACCCCGGTACAGCTTCCGGCTGACAGAGAGTCCCTGTTTTATCTGAATTTACTGGATATTCCGCCGCTGCCGGAAAACAGTGCCGATAAAAACATGATGCAGATTGCTATCCGCTCCCGCATCAAACTGTTTTACCGCCCTTCCGGCCTGACGCTGAGCGCGGATAAAGCCCACACCCGTCTGACATTCACCCGTGACGGCCAGCACTATATTCTGAAAAATGATTCTCCGTATCATATTAATATTCTCGGCCTGAAAGAGACCGCGAACAGCCGTGATCTGGCGGAAGAAGGCACGATGATTGCACCTTATTCTCAGTTTACGCTGCCTGCCGCAGCCGGATTACCGGCCGGAAATCACTATTCGCTGACACTGATCGACGATTTCGGTGCCATCAATACCTATCCGCTGTCACTGAACTGAACAGCCGCCTGATGCCGCGCCATGTCCGCCGTTTTTCCGCCCTTGTTTCA