Homologs in group_1252

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07290 FBDBKF_07290 100.0 Morganella morganii S1 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
EHELCC_03680 EHELCC_03680 100.0 Morganella morganii S2 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
NLDBIP_03680 NLDBIP_03680 100.0 Morganella morganii S4 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
HKOGLL_09465 HKOGLL_09465 100.0 Morganella morganii S5 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
F4V73_RS01475 F4V73_RS01475 81.3 Morganella psychrotolerans - MOSC domain-containing protein
PMI_RS03800 PMI_RS03800 57.5 Proteus mirabilis HI4320 - YcbX family protein

Distribution of the homologs in the orthogroup group_1252

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1252

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P75863 1.25e-149 430 55 0 365 1 ycbX Uncharacterized protein YcbX Escherichia coli (strain K12)
Q9CW42 3.42e-31 124 29 8 282 1 Mtarc1 Mitochondrial amidoxime-reducing component 1 Mus musculus
Q5VT66 2.3e-30 122 30 9 283 1 MTARC1 Mitochondrial amidoxime-reducing component 1 Homo sapiens
Q922Q1 2.25e-29 119 29 9 285 1 Mtarc2 Mitochondrial amidoxime reducing component 2 Mus musculus
O88994 2.56e-29 119 29 9 285 2 Mtarc2 Mitochondrial amidoxime reducing component 2 Rattus norvegicus
Q5U534 1.05e-28 117 27 6 278 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Xenopus laevis
Q1LZH1 2.76e-26 110 28 8 280 2 MTARC2 Mitochondrial amidoxime reducing component 2 Bos taurus
Q9GKW0 3.06e-26 110 28 7 278 2 MTARC2 Mitochondrial amidoxime reducing component 2 Macaca fascicularis
Q58EJ9 7.67e-26 109 26 6 272 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Danio rerio
Q969Z3 2.3e-25 108 27 6 277 1 MTARC2 Mitochondrial amidoxime reducing component 2 Homo sapiens
Q559G8 5.22e-20 95 25 8 286 3 mocos Molybdenum cofactor sulfurase Dictyostelium discoideum
A2VD33 6.65e-20 95 25 9 292 2 mocos Molybdenum cofactor sulfurase Danio rerio
Q14CH1 1.89e-19 93 25 7 275 1 Mocos Molybdenum cofactor sulfurase Mus musculus
Q9C5X8 4.15e-19 92 24 5 255 1 ABA3 Molybdenum cofactor sulfurase Arabidopsis thaliana
Q96EN8 1.12e-18 91 24 8 278 1 MOCOS Molybdenum cofactor sulfurase Homo sapiens
Q9N0E7 3.2e-16 84 24 6 253 2 MOCOS Molybdenum cofactor sulfurase Bos taurus
Q655R6 3.73e-16 83 22 6 257 2 MCSU3 Molybdenum cofactor sulfurase Oryza sativa subsp. japonica
B4L340 6.32e-16 82 24 3 226 3 mal Molybdenum cofactor sulfurase Drosophila mojavensis
B3MZN7 2.13e-15 81 27 10 273 3 mal Molybdenum cofactor sulfurase Drosophila ananassae
Q9VRA2 3.27e-15 80 24 4 226 1 mal Molybdenum cofactor sulfurase Drosophila melanogaster
B4JXP7 4.15e-15 80 24 4 221 3 mal Molybdenum cofactor sulfurase Drosophila grimshawi
Q21657 3.41e-14 77 22 6 247 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis elegans
B3NY19 3.84e-14 77 24 4 226 3 mal Molybdenum cofactor sulfurase Drosophila erecta
B4PYH5 4.32e-14 77 24 4 226 3 mal Molybdenum cofactor sulfurase Drosophila yakuba
Q7QFL7 2.98e-13 74 24 7 249 3 mal Molybdenum cofactor sulfurase Anopheles gambiae
Q8LGM7 3.9e-13 74 21 5 257 2 FLACCA Molybdenum cofactor sulfurase Solanum lycopersicum
B4H0S8 1.07e-12 73 25 4 202 3 mal Molybdenum cofactor sulfurase Drosophila persimilis
Q29GM0 1.76e-12 72 25 4 202 3 mal Molybdenum cofactor sulfurase Drosophila pseudoobscura pseudoobscura
A8X493 3.65e-12 71 21 7 252 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis briggsae
Q16GH0 4.25e-12 71 25 9 248 3 mal1 Molybdenum cofactor sulfurase 1 Aedes aegypti
B0WSX1 5.12e-12 70 23 9 249 3 mal2 Molybdenum cofactor sulfurase 2 Culex quinquefasciatus
Q16P90 2.31e-11 68 25 9 248 3 mal3 Molybdenum cofactor sulfurase 3 Aedes aegypti
B4N1V2 2.82e-11 68 23 2 226 3 mal Molybdenum cofactor sulfurase Drosophila willistoni
A2QIK9 1.5e-09 63 24 16 336 3 hxB Molybdenum cofactor sulfurase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P57274 1.42e-08 55 37 1 81 4 BU177 Uncharacterized ferredoxin-like protein BU177 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P75824 3.55e-08 58 47 2 65 1 hcr NADH oxidoreductase HCR Escherichia coli (strain K12)
A6SRX6 3.74e-08 58 29 7 158 3 hxB Molybdenum cofactor sulfurase Botryotinia fuckeliana (strain B05.10)
Q2UH11 3.95e-08 58 23 14 335 3 hxB Molybdenum cofactor sulfurase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P83522 8.77e-08 53 34 2 85 1 None Ferredoxin Hordeum vulgare
P21394 1.3e-07 56 32 1 87 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
Q16P87 1.92e-07 56 25 8 216 3 mal2 Molybdenum cofactor sulfurase 2 Aedes aegypti
P0ABW3 1.96e-07 51 38 3 84 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli (strain K12)
P0ABW4 1.96e-07 51 38 3 84 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P00228 2.04e-07 53 35 2 85 1 PETF Ferredoxin, chloroplastic Triticum aestivum
A4RK48 3.13e-07 56 23 15 308 3 hxB Molybdenum cofactor sulfurase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q8IU29 1.57e-06 53 20 8 252 2 mal Molybdenum cofactor sulfurase Bombyx mori
Q0J8M2 2.38e-06 50 30 2 86 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. japonica
A2YQD9 2.38e-06 50 30 2 86 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. indica
P45154 3.76e-06 48 36 2 69 4 HI_1309 Uncharacterized ferredoxin-like protein HI_1309 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9TLW0 5.16e-06 48 39 2 69 3 petF Ferredoxin Cyanidium caldarium
P00226 6.93e-06 47 39 1 64 1 None Ferredoxin Sambucus nigra
A1CHL0 6.95e-06 52 21 16 364 3 hxB Molybdenum cofactor sulfurase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P27787 1.56e-05 48 33 3 87 1 FDX1 Ferredoxin-1, chloroplastic Zea mays
P83584 2.88e-05 45 38 2 59 1 None Ferredoxin Solanum lasiocarpum
Q8IED5 3.04e-05 47 38 2 70 1 FD Ferredoxin, apicoplast Plasmodium falciparum (isolate 3D7)
P14937 3.51e-05 45 30 1 72 1 None Ferredoxin, root R-B2 Raphanus sativus
P16972 3.88e-05 46 30 2 86 1 FD2 Ferredoxin-2, chloroplastic Arabidopsis thaliana
Q1QYU6 4.45e-05 48 35 3 84 1 bmoB Glycine betaine monooxygenase reductase subunit Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P15789 4.87e-05 45 36 1 65 1 PETF Ferredoxin Cyanidium caldarium
P46035 6.02e-05 45 31 1 72 3 fdxH Ferredoxin-2 Leptolyngbya boryana
P0A3D3 7.17e-05 44 31 1 70 1 petF1 Ferredoxin-1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P0A3D2 7.17e-05 44 31 1 70 3 petF Ferredoxin-1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P00241 7.43e-05 44 32 1 68 1 PETF Ferredoxin Cyanidium caldarium
P9WNE9 8.28e-05 47 31 2 101 1 Rv3230c NADPH oxidoreductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNE8 8.28e-05 47 31 2 101 3 MT3327 NADPH oxidoreductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P83583 9.55e-05 44 29 2 85 1 None Ferredoxin Solanum lyratum
P14938 9.71e-05 44 29 2 85 1 None Ferredoxin, leaf L-A Raphanus sativus
Q9ZQG8 0.000106 45 31 1 73 1 FD3 Ferredoxin-3, chloroplastic Arabidopsis thaliana
P04669 0.000118 45 33 1 65 2 PETF Ferredoxin, chloroplastic Silene latifolia subsp. alba
P26395 0.000134 47 29 1 77 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00225 0.000135 43 32 1 64 1 None Ferredoxin Leucaena leucocephala
P83526 0.000141 43 29 2 85 1 None Ferredoxin Nicotiana tabacum
P00254 0.000167 43 32 1 71 1 petF1 Ferredoxin-1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P81372 0.000251 43 32 1 65 1 None Ferredoxin-A Alocasia macrorrhizos
O80429 0.000256 44 29 2 85 1 FDX2 Ferredoxin-2, chloroplastic Zea mays
P14936 0.000256 43 29 1 72 1 None Ferredoxin, root R-B1 Raphanus sativus
P00227 0.000265 43 29 2 85 1 None Ferredoxin Brassica napus
P49522 0.000315 43 28 1 69 3 petF Ferredoxin Trieres chinensis
P00246 0.000322 43 32 1 65 1 None Ferredoxin Arthrospira platensis
P09735 0.000351 42 30 1 70 1 None Ferredoxin Marchantia polymorpha
P00244 0.00039 42 32 1 64 1 None Ferredoxin-1 Aphanizomenon flos-aquae
P27789 0.000414 43 27 2 86 2 FDX5 Ferredoxin-5, chloroplastic Zea mays
P00248 0.000484 42 31 1 74 1 petF Ferredoxin Mastigocladus laminosus
P00252 0.000513 42 31 1 70 1 None Ferredoxin-1 Desmonostoc muscorum
P83582 0.000531 42 32 1 64 1 None Ferredoxin Solanum nigrum
Q43517 0.000672 43 30 2 86 2 SEND33 Ferredoxin-1, chloroplastic Solanum lycopersicum
P83527 0.000685 42 32 1 64 1 None Ferredoxin Capsicum annuum var. annuum
P68641 0.000755 44 30 2 85 3 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pestis
P0A3C8 0.000758 42 30 1 71 1 petF Ferredoxin-1 Nostoc sp. (strain ATCC 29151 / PCC 7119)
P0A3C7 0.000758 42 30 1 71 1 petF Ferredoxin-1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9HTF3 0.000786 44 31 1 83 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZJB2 0.000786 44 31 1 83 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain UCBPP-PA14)
Q66DP5 0.000804 44 30 2 85 1 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
P68165 0.000816 41 31 1 64 1 None Ferredoxin Datura stramonium
P68166 0.000816 41 31 1 64 1 None Ferredoxin Datura quercifolia
P00235 0.00082 41 32 1 64 1 None Ferredoxin-1 Equisetum arvense
P00220 0.000824 41 32 1 64 1 None Ferredoxin Medicago sativa
P00224 0.00084 41 35 2 65 1 None Ferredoxin-2 Spinacia oleracea
P00253 0.00086 41 30 1 71 1 None Ferredoxin Desmonostoc muscorum
Q9FIA7 0.000883 42 38 1 63 1 FD4 Probable ferredoxin-4, chloroplastic Arabidopsis thaliana
P00234 0.000895 41 32 1 64 1 None Ferredoxin-1 Equisetum telmateia
P56408 0.001 41 32 1 64 1 None Ferredoxin Scenedesmus fuscus

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_09510
Feature type CDS
Gene ycbX
Product N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
Location 45403 - 46527 (strand: 1)
Length 1125 (nucleotides) / 374 (amino acids)

Contig

Accession ZDB_366
Length 191897 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1252
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain
PF03473 MOSC domain
PF03476 MOSC N-terminal beta barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3217 Nucleotide transport and metabolism (F)
Defense mechanisms (V)		 FV N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07140 uncharacterized protein - -

Protein Sequence

MTTTPITLSRLYTFPVKSMKGIRQSQSHAGETGLGFDRNFMITDETGKFITARRYPQMVLFTPVLLSNGIYLRSPEGSGATILFEDFRPDHLPCEVWGNHFTSLLAPEKINQWLCQFFDIPVQLRWLSPQSTRRVKKFPDTAVSFADGYPYLVVNEASFREVQRRCGAGIKIEQFRGNIIVTGAEPFAEDRWKTIQVGDVVFDLKKPCSRCILTTVSTDKGIKHPEMEPFHTLQTFRKAADNDDVDFGMNAIARNSGVIQVGDTVTILETREPRQYQEQEVEKVQAAPAQPEAALELTFNGKLYPVNNQHVLLEQLEGHQVNIPYSCRAGVCGCCKVTLVSGEVTPLKAGAIKENGDILACSCIPKTNITIRHA

Flanking regions ( +/- flanking 50bp)

CCGGGATGCCATTGTGGTATTACTGATAATAACGAAAAGAACGGATAACAATGACGACAACACCCATCACACTCTCCCGTTTATACACCTTTCCTGTGAAGTCAATGAAGGGCATCCGCCAGTCACAGAGCCATGCCGGGGAAACCGGGCTGGGCTTTGACCGCAATTTTATGATAACGGATGAGACCGGAAAATTTATCACCGCCCGCCGCTACCCGCAGATGGTCCTGTTTACCCCGGTGCTGCTGAGCAACGGAATTTACCTGCGCAGCCCGGAAGGCAGCGGCGCCACGATCCTGTTTGAGGATTTCCGTCCTGACCACCTGCCGTGCGAAGTCTGGGGAAACCATTTCACCTCACTGCTTGCACCGGAAAAAATCAATCAGTGGCTGTGTCAGTTCTTTGATATCCCGGTACAGCTGCGCTGGCTCAGCCCGCAATCCACCCGCAGAGTAAAAAAATTCCCGGACACTGCGGTGTCGTTTGCCGACGGTTATCCCTATCTGGTGGTCAATGAAGCCTCTTTCCGTGAGGTGCAGCGTCGCTGCGGTGCCGGTATTAAAATCGAGCAGTTCCGCGGCAATATTATTGTCACTGGTGCAGAGCCGTTTGCGGAAGACCGCTGGAAAACCATTCAGGTCGGTGATGTGGTGTTTGATCTGAAAAAACCGTGCAGCCGCTGTATTCTCACCACTGTCAGTACGGATAAAGGGATTAAACACCCGGAAATGGAGCCGTTCCACACCCTGCAAACCTTCCGGAAAGCCGCAGATAATGATGATGTGGATTTCGGTATGAATGCCATTGCCCGCAACAGTGGTGTGATTCAGGTCGGTGATACCGTCACCATACTGGAAACCCGCGAGCCGCGTCAGTATCAGGAACAGGAAGTGGAAAAGGTGCAGGCCGCGCCCGCACAACCGGAAGCAGCACTGGAACTGACATTCAACGGTAAACTCTACCCGGTGAATAATCAGCACGTCTTACTGGAGCAGCTGGAAGGCCATCAGGTCAATATTCCGTATTCCTGCCGTGCCGGTGTCTGCGGTTGCTGCAAAGTCACGCTGGTCTCCGGCGAAGTGACTCCGCTGAAAGCCGGGGCGATAAAAGAGAACGGCGATATTCTGGCATGCAGTTGTATTCCGAAAACCAATATTACTATTCGTCACGCATAACCGGCCGTCACGAATAACCGGTAAAAAAATACCCCCGGCAGATAAACTAC