Homologs in group_3272

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07570 FBDBKF_07570 100.0 Morganella morganii S1 adhE Acyl-CoA reductase or other NAD-dependent aldehyde dehydrogenase
NLDBIP_13845 NLDBIP_13845 100.0 Morganella morganii S4 adhE Acyl-CoA reductase or other NAD-dependent aldehyde dehydrogenase
HKOGLL_08555 HKOGLL_08555 100.0 Morganella morganii S5 adhE Acyl-CoA reductase or other NAD-dependent aldehyde dehydrogenase
F4V73_RS13550 F4V73_RS13550 95.8 Morganella psychrotolerans - aldehyde dehydrogenase family protein

Distribution of the homologs in the orthogroup group_3272

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3272

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P41793 0.0 716 75 1 478 1 eutE Acetaldehyde dehydrogenase (acetylating) EutE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77445 0.0 699 76 1 478 3 eutE Acetaldehyde dehydrogenase (acetylating) EutE Escherichia coli (strain K12)
E5Y379 0.0 538 59 3 481 1 adhE Acetaldehyde dehydrogenase (acetylating) Bilophila wadsworthia (strain 3_1_6)
Q9XDN1 2.45e-135 401 45 7 483 1 pduP Propanal dehydrogenase (CoA-propanoylating) Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1VB75 2.26e-130 388 45 7 483 1 pduP Propanal dehydrogenase (CoA-propanoylating) Citrobacter freundii
P33744 1.86e-47 179 33 11 408 1 adhE Aldehyde-alcohol dehydrogenase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P0A9Q7 5.52e-47 177 34 10 369 1 adhE Bifunctional aldehyde-alcohol dehydrogenase AdhE Escherichia coli (strain K12)
P0A9Q8 5.52e-47 177 34 10 369 1 adhE Bifunctional aldehyde-alcohol dehydrogenase AdhE Escherichia coli O157:H7
P38947 1.78e-45 167 30 12 425 1 sucD Succinate-semialdehyde dehydrogenase (acetylating) Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A0A0H2ZM56 1.54e-41 161 30 11 413 1 adhE Aldehyde-alcohol dehydrogenase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0A0H2URT2 1.66e-41 161 30 11 413 3 adhE Aldehyde-alcohol dehydrogenase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q24803 7.85e-40 156 29 10 423 1 ADH2 Aldehyde-alcohol dehydrogenase 2 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
A0A3A6N9T6 1.4e-35 141 26 9 396 1 sqwD Sulfoacetaldehyde dehydrogenase Acholeplasma sp.
Q0K845 1.66e-27 118 28 13 371 1 sauS Sulfoacetaldehyde dehydrogenase (acylating) Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
E5Y8P9 6.28e-26 113 28 8 358 1 sauS Sulfoacetaldehyde dehydrogenase (acylating) Bilophila wadsworthia (strain 3_1_6)
O32507 2.08e-13 75 25 15 451 3 ssdA Succinate-semialdehyde dehydrogenase [NADP(+)] Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B7GFV3 2.78e-12 72 25 10 299 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q58806 6.03e-12 71 24 17 438 1 MJ1411 Lactaldehyde dehydrogenase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5KYR4 3.78e-11 68 25 16 419 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Geobacillus kaustophilus (strain HTA426)
A4IPB2 7.02e-11 67 25 18 421 3 iolA1 Malonate-semialdehyde dehydrogenase 1 Geobacillus thermodenitrificans (strain NG80-2)
Q1GV29 8.85e-11 67 25 9 327 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P23883 8.97e-11 67 24 14 420 1 puuC NADP/NAD-dependent aldehyde dehydrogenase PuuC Escherichia coli (strain K12)
A5YBJ3 2.12e-10 66 24 15 387 3 iolA Malonate-semialdehyde dehydrogenase Lacticaseibacillus casei
Q59931 3.65e-10 65 22 13 405 1 gapN NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6GKD8 4.83e-10 65 23 7 314 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain MRSA252)
Q6LX65 9.59e-10 64 24 10 354 3 MMP1487 Lactaldehyde dehydrogenase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5L3K8 1.07e-09 64 24 9 314 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Geobacillus kaustophilus (strain HTA426)
A4FW36 1.57e-09 63 22 11 357 3 MmarC5_0090 Lactaldehyde dehydrogenase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q7A1Y7 2.71e-09 62 23 7 314 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain MW2)
Q6GCV9 2.71e-09 62 23 7 314 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain MSSA476)
Q7A825 2.71e-09 62 23 7 314 1 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain N315)
Q99X54 2.71e-09 62 23 7 314 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z3F5 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GDP4 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain MRSA252)
P99076 3.4e-09 62 22 14 431 1 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain N315)
P63939 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QK44 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain Newman)
Q5HCZ6 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain COL)
Q2YWA6 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IVY0 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain JH9)
Q2FV67 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDV3 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain USA300)
A6U4T5 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain JH1)
A7X6R7 3.4e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HJK3 3.79e-09 62 23 8 315 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain COL)
Q2G1J0 3.79e-09 62 23 8 315 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK94 3.79e-09 62 23 8 315 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain USA300)
Q8NUR2 3.81e-09 62 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain MW2)
C5D4J5 7.18e-09 61 23 10 319 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Geobacillus sp. (strain WCH70)
Q0TKW0 7.79e-09 61 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3IFT7 9.94e-09 61 23 12 411 3 astD1 N-succinylglutamate 5-semialdehyde dehydrogenase 1 Pseudoalteromonas translucida (strain TAC 125)
Q6G6C0 1.2e-08 60 22 14 431 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus aureus (strain MSSA476)
P93338 1.36e-08 60 24 7 269 2 GAPN NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Nicotiana plumbaginifolia
A0A5C1REZ4 1.41e-08 60 22 13 416 3 orf1 Aldehyde dehydrogenase Didymella fabae
Q3C1A6 1.44e-08 60 25 9 300 1 gapN NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Streptococcus equinus
O06478 1.81e-08 60 23 18 454 1 yfmT Benzaldehyde dehydrogenase YfmT Bacillus subtilis (strain 168)
Q8EJ54 1.91e-08 60 25 13 388 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6UVT6 2.39e-08 59 21 9 353 3 Maeo_1030 Lactaldehyde dehydrogenase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
P46562 2.42e-08 60 23 14 356 3 alh-9 Putative aldehyde dehydrogenase family 7 member A1 homolog Caenorhabditis elegans
Q2BN77 2.52e-08 59 23 17 441 1 safD Sulfoacetaldehyde dehydrogenase Neptuniibacter caesariensis
P39616 2.54e-08 59 24 8 283 3 ywdH Putative aldehyde dehydrogenase YwdH Bacillus subtilis (strain 168)
Q2YV11 2.86e-08 59 22 7 322 3 aldA Putative aldehyde dehydrogenase AldA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A9L3U4 3.1e-08 59 24 12 391 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella baltica (strain OS195)
A3D039 3.1e-08 59 24 12 391 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8ES27 3.6e-08 59 22 19 470 3 iolA1 Malonate-semialdehyde dehydrogenase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9SNX8 4.47e-08 58 23 7 269 1 None NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Apium graveolens
Q3IC91 5.26e-08 58 22 12 438 3 astD2 N-succinylglutamate 5-semialdehyde dehydrogenase 2 Pseudoalteromonas translucida (strain TAC 125)
Q12QD2 5.59e-08 58 22 14 419 3 astD1 N-succinylglutamate 5-semialdehyde dehydrogenase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C6DKY5 6.52e-08 58 23 11 412 3 betB Betaine aldehyde dehydrogenase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4IJP9 6.95e-08 58 23 10 320 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Geobacillus thermodenitrificans (strain NG80-2)
A0KST2 6.96e-08 58 22 10 377 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella sp. (strain ANA-3)
Q5QVX3 7.17e-08 58 24 8 291 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4XWE7 7.27e-08 58 26 6 264 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas mendocina (strain ymp)
Q1I6Z5 8.66e-08 58 27 9 270 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas entomophila (strain L48)
A1RNU4 1.07e-07 57 23 8 295 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella sp. (strain W3-18-1)
Q12JA9 1.08e-07 57 22 11 379 3 astD2 N-succinylglutamate 5-semialdehyde dehydrogenase 2 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4Y344 1.12e-07 57 23 11 389 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q1WIQ6 1.16e-07 57 22 7 270 1 ALDH11A3 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Arabidopsis thaliana
A6VH72 1.3e-07 57 22 12 354 3 MmarC7_0731 Lactaldehyde dehydrogenase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q885J7 1.56e-07 57 26 7 270 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5W0D5 1.57e-07 57 26 7 273 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8LK61 1.64e-07 57 23 6 267 1 GAPN NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Triticum aestivum
P94391 1.7e-07 57 22 11 321 2 putC 1-pyrroline-5-carboxylate dehydrogenase 2 Bacillus subtilis (strain 168)
Q3K885 2.16e-07 57 28 10 271 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas fluorescens (strain Pf0-1)
Q8ERF4 2.35e-07 57 21 11 452 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88EI4 2.35e-07 56 26 7 273 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6L285 2.44e-07 56 25 4 201 1 PTO0332 D-glyceraldehyde dehydrogenase (NADP(+)) Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
B8CIT6 2.54e-07 56 22 10 372 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9KAH5 3.16e-07 56 24 17 424 3 iolA Malonate-semialdehyde dehydrogenase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4XPI6 3.51e-07 56 26 6 249 3 betB Betaine aldehyde dehydrogenase Pseudomonas mendocina (strain ymp)
Q9HTJ1 3.93e-07 56 23 9 310 1 betB NAD/NADP-dependent betaine aldehyde dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V5R4 3.93e-07 56 23 9 310 3 betB Betaine aldehyde dehydrogenase Pseudomonas aeruginosa (strain LESB58)
A8F9T1 4.03e-07 56 22 10 318 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus pumilus (strain SAFR-032)
A6VEI4 4.85e-07 55 23 9 310 3 betB Betaine aldehyde dehydrogenase Pseudomonas aeruginosa (strain PA7)
Q02DY9 5.38e-07 55 23 9 310 3 betB Betaine aldehyde dehydrogenase Pseudomonas aeruginosa (strain UCBPP-PA14)
A8FRE9 5.45e-07 55 21 11 378 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella sediminis (strain HAW-EB3)
B0KR47 6.11e-07 55 26 9 276 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas putida (strain GB-1)
P94358 7.39e-07 55 23 10 431 1 aldY Putative aldehyde dehydrogenase AldY Bacillus subtilis (strain 168)
Q488Y0 7.66e-07 55 22 13 420 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5L025 8.1e-07 55 25 18 397 3 iolA1 Malonate-semialdehyde dehydrogenase 1 Geobacillus kaustophilus (strain HTA426)
P81406 8.34e-07 55 23 6 267 1 GAPN NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Pisum sativum
B0TU38 8.81e-07 55 22 11 375 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella halifaxensis (strain HAW-EB4)
B1KDF2 8.97e-07 55 21 10 380 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella woodyi (strain ATCC 51908 / MS32)
Q43272 9.96e-07 54 23 6 267 2 GPN1 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Zea mays
Q48G19 1.06e-06 54 26 7 270 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P62028 1.08e-06 54 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5KYA2 1.14e-06 54 23 8 276 3 proA Gamma-glutamyl phosphate reductase Geobacillus kaustophilus (strain HTA426)
A9BJ18 1.22e-06 54 28 7 204 3 proA Gamma-glutamyl phosphate reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q4V1F6 1.33e-06 54 24 17 429 3 iolA3 Malonate-semialdehyde dehydrogenase 3 Bacillus cereus (strain ZK / E33L)
A7GKJ4 1.33e-06 54 24 10 314 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
P42329 1.42e-06 54 23 16 420 1 aldHT Aldehyde dehydrogenase, thermostable Geobacillus stearothermophilus
B8EBC2 1.61e-06 54 23 10 297 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella baltica (strain OS223)
Q15Y60 1.68e-06 53 22 10 345 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4IPF5 1.72e-06 53 24 15 360 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Geobacillus thermodenitrificans (strain NG80-2)
Q6HP91 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63GS0 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain ZK / E33L)
B9J1L9 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain Q1)
B7HSW8 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain AH187)
C1EV77 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain 03BB102)
B7JM99 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain AH820)
Q81ZF8 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus anthracis
A0R909 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus thuringiensis (strain Al Hakam)
C3L546 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBP4 1.75e-06 53 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus anthracis (strain A0248)
Q9K9B2 1.84e-06 53 21 10 320 1 rocA1 1-pyrroline-5-carboxylate dehydrogenase 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
K9UV87 2.02e-06 53 26 17 364 1 vdh Vanillin dehydrogenase Amycolatopsis sp. (strain ATCC 39116 / 75iv2)
Q9STS1 2.05e-06 53 22 9 320 1 ALDH10A9 Aminoaldehyde dehydrogenase ALDH10A9, peroxisomal Arabidopsis thaliana
Q4K837 2.21e-06 53 27 9 265 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6UQD0 2.26e-06 53 22 15 365 3 Mevan_0796 Lactaldehyde dehydrogenase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A9VRG6 2.35e-06 53 25 11 315 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus mycoides (strain KBAB4)
B1J0W5 2.36e-06 53 23 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q07XY1 2.63e-06 53 22 7 285 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella frigidimarina (strain NCIMB 400)
C3JXY7 2.68e-06 53 29 5 169 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas fluorescens (strain SBW25)
Q8UH56 2.73e-06 53 22 12 405 1 betB Betaine aldehyde dehydrogenase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4A0E7 3.14e-06 53 22 13 428 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A0REB5 3.36e-06 53 25 18 432 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Bacillus thuringiensis (strain Al Hakam)
E9Q3E1 3.39e-06 53 22 14 361 1 Aldh3b2 Aldehyde dehydrogenase family 3 member B2 Mus musculus
Q65KU7 3.48e-06 52 22 10 313 3 proA1 Gamma-glutamyl phosphate reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7UJG5 3.53e-06 53 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B0VST2 3.75e-06 53 26 3 176 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain SDF)
C3K3D2 3.82e-06 53 24 6 253 3 betB Betaine aldehyde dehydrogenase Pseudomonas fluorescens (strain SBW25)
P12693 3.88e-06 52 25 10 274 2 alkH Aldehyde dehydrogenase Pseudomonas oleovorans
A6WST7 3.9e-06 52 23 12 370 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella baltica (strain OS185)
B0V944 3.95e-06 52 27 3 162 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain AYE)
B2HV80 3.95e-06 52 27 3 162 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain ACICU)
B7I896 3.95e-06 52 27 3 162 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain AB0057)
B7GYG4 3.95e-06 52 27 3 162 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain AB307-0294)
Q9S795 4.01e-06 52 23 8 321 1 ALDH10A8 Aminoaldehyde dehydrogenase ALDH10A8, chloroplastic Arabidopsis thaliana
S0ENH1 4.03e-06 52 22 12 403 2 FUS7 Putative aldehyde dehydrogenase FUS7 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P39634 4.04e-06 52 24 12 308 2 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus subtilis (strain 168)
Q2FWX9 4.58e-06 52 21 7 276 1 aldH1 4,4'-diaponeurosporen-aldehyde dehydrogenase Staphylococcus aureus (strain NCTC 8325 / PS 47)
B1JCH3 4.69e-06 52 24 14 410 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas putida (strain W619)
Q81IP0 4.94e-06 52 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H4V1 4.94e-06 52 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain B4264)
B7IUW8 4.94e-06 52 27 13 305 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus cereus (strain G9842)
Q9URW9 5.13e-06 52 20 13 415 3 SPAC922.07c Putative aldehyde dehydrogenase-like protein C922.07c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B7MCD1 5.23e-06 52 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli O45:K1 (strain S88 / ExPEC)
A3M365 5.96e-06 52 27 3 162 3 betB Betaine aldehyde dehydrogenase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q1JPA0 6.14e-06 52 22 11 283 2 ALDH3B1 Aldehyde dehydrogenase family 3 member B1 Bos taurus
B7NK50 6.98e-06 52 22 11 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q92UV7 7.18e-06 52 21 7 269 1 phnY Phosphonoacetaldehyde dehydrogenase Rhizobium meliloti (strain 1021)
Q84LK3 7.41e-06 52 24 9 325 1 BADH2 Betaine aldehyde dehydrogenase 2 Oryza sativa subsp. japonica
B3VMC0 7.41e-06 52 24 9 325 2 BADH2 Betaine aldehyde dehydrogenase 2 Oryza sativa subsp. indica
A0A6J4B898 8.4e-06 52 22 14 414 1 LUC3 Aldehyde dehydrogenase LUC3 Fusarium sp.
Q9K5Z5 8.56e-06 52 23 11 302 3 rocA2 1-pyrroline-5-carboxylate dehydrogenase 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8RAE5 9.06e-06 51 24 11 289 3 proA Gamma-glutamyl phosphate reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P17445 9.47e-06 51 22 9 379 1 betB Betaine aldehyde dehydrogenase Escherichia coli (strain K12)
B1XET7 9.47e-06 51 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli (strain K12 / DH10B)
P43353 9.6e-06 51 21 12 348 1 ALDH3B1 Aldehyde dehydrogenase family 3 member B1 Homo sapiens
A9AD19 1.01e-05 51 22 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia multivorans (strain ATCC 17616 / 249)
B3WA82 1.06e-05 51 25 7 204 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus casei (strain BL23)
A4IPN4 1.06e-05 51 23 9 285 3 proA Gamma-glutamyl phosphate reductase Geobacillus thermodenitrificans (strain NG80-2)
Q0T7M9 1.33e-05 51 21 10 414 3 betB Betaine aldehyde dehydrogenase Shigella flexneri serotype 5b (strain 8401)
Q5KYK0 1.37e-05 51 25 15 360 3 iolA3 Malonate-semialdehyde dehydrogenase 3 Geobacillus kaustophilus (strain HTA426)
A7ZWV5 1.38e-05 51 21 10 414 3 betB Betaine aldehyde dehydrogenase Escherichia coli O9:H4 (strain HS)
P48448 1.38e-05 50 21 13 373 1 ALDH3B2 Aldehyde dehydrogenase family 3 member B2 Homo sapiens
A7GVZ7 1.66e-05 50 23 8 294 3 proA Gamma-glutamyl phosphate reductase Campylobacter curvus (strain 525.92)
Q8CN04 1.7e-05 50 22 10 330 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL59 1.7e-05 50 22 10 330 3 rocA 1-pyrroline-5-carboxylate dehydrogenase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1LIJ8 1.94e-05 50 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli (strain SMS-3-5 / SECEC)
Q6HIK3 2.02e-05 50 25 18 432 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81QB6 2.03e-05 50 25 18 432 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Bacillus anthracis
Q65NN2 2.14e-05 50 22 11 320 1 rocA 1-pyrroline-5-carboxylate dehydrogenase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P17202 2.15e-05 50 23 12 321 1 BADH Aminoaldehyde dehydrogenase BADH Spinacia oleracea
B5Z1R1 2.31e-05 50 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q7AH91 2.31e-05 50 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli O157:H7
B7N8L4 2.33e-05 50 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8H8E0 2.44e-05 50 21 8 284 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q4VKV0 2.5e-05 50 23 12 327 1 ald 4,4'-diapolycopene aldehyde oxidase Methylomonas sp.
Q4ZQH8 2.6e-05 50 27 4 169 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas syringae pv. syringae (strain B728a)
P76149 2.62e-05 50 22 10 396 1 sad Succinate semialdehyde dehydrogenase [NAD(P)+] Sad Escherichia coli (strain K12)
O50174 3.12e-05 50 25 12 366 1 astD N-succinylglutamate 5-semialdehyde dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q25417 3.33e-05 50 19 10 381 1 ALDH2 Aldehyde dehydrogenase, mitochondrial Leishmania tarentolae
O57693 3.46e-05 50 24 13 318 1 gapN NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase Thermoproteus tenax
B4TZ91 4.66e-05 49 24 9 289 3 proA Gamma-glutamyl phosphate reductase Salmonella schwarzengrund (strain CVM19633)
A7ZI51 4.84e-05 49 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli O139:H28 (strain E24377A / ETEC)
O59808 4.85e-05 49 21 11 356 2 meu8 Probable betaine aldehyde dehydrogenase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O86447 4.96e-05 49 23 9 280 1 calB Coniferyl aldehyde dehydrogenase Pseudomonas sp. (strain HR199 / DSM 7063)
B7L441 4.97e-05 49 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli (strain 55989 / EAEC)
B6I075 5.01e-05 49 21 10 414 3 betB Betaine aldehyde dehydrogenase Escherichia coli (strain SE11)
P54114 5.15e-05 49 22 8 282 1 ALD3 Aldehyde dehydrogenase [NAD(P)+] 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2G9T9 6.25e-05 48 23 8 333 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q97E62 6.35e-05 48 28 4 155 3 proA Gamma-glutamyl phosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B7N8H4 6.62e-05 48 25 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q63B74 6.67e-05 48 24 18 432 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Bacillus cereus (strain ZK / E33L)
Q8CUQ4 7.08e-05 48 25 10 224 3 proA Gamma-glutamyl phosphate reductase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
W7MWX4 7.22e-05 48 22 13 402 3 FUS7 Putative aldehyde dehydrogenase FUS7 Gibberella moniliformis (strain M3125 / FGSC 7600)
A1JNX6 7.39e-05 48 24 4 185 3 proA Gamma-glutamyl phosphate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1A1U9 7.42e-05 48 24 9 279 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q6FDF8 7.62e-05 48 22 9 310 3 betB Betaine aldehyde dehydrogenase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C5D2V2 7.77e-05 48 23 9 269 3 proA Gamma-glutamyl phosphate reductase Geobacillus sp. (strain WCH70)
P0A390 7.96e-05 48 27 5 170 3 doxF Salicylaldehyde dehydrogenase Pseudomonas sp. (strain C18)
P0A391 7.96e-05 48 27 5 170 3 nahF Salicylaldehyde dehydrogenase Pseudomonas putida
Q8FKI8 9.39e-05 48 22 9 379 3 betB Betaine aldehyde dehydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P80668 9.48e-05 48 21 10 317 1 feaB Phenylacetaldehyde dehydrogenase Escherichia coli (strain K12)
B5BDP7 9.64e-05 48 24 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain AKU_12601)
Q5PF69 9.64e-05 48 24 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7LNF7 9.74e-05 48 25 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q035M3 0.000106 48 25 7 204 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A6VZ85 0.000106 48 24 7 294 3 proA Gamma-glutamyl phosphate reductase Marinomonas sp. (strain MWYL1)
B7M2V6 0.000115 48 22 9 382 3 betB Betaine aldehyde dehydrogenase Escherichia coli O8 (strain IAI1)
P0DXC7 0.000122 48 31 3 138 2 JFQ02_09245 Aspartate-semialdehyde dehydrogenase 1 Pseudomonas canavaninivorans
Q7N7B1 0.00013 48 21 8 310 3 proA Gamma-glutamyl phosphate reductase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NXX7 0.000132 48 23 7 273 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P40861 0.000139 47 24 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5WH11 0.000144 47 22 19 416 3 iolA2 Malonate-semialdehyde dehydrogenase 2 Shouchella clausii (strain KSM-K16)
A4SK35 0.000148 47 23 3 168 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Aeromonas salmonicida (strain A449)
B5Z1I7 0.000158 47 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7N4 0.000158 47 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7
B7NK82 0.000159 47 25 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8Y9Y4 0.000162 47 22 16 419 3 iolA Malonate-semialdehyde dehydrogenase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1BXP1 0.000185 47 22 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia orbicola (strain AU 1054)
A0K608 0.000185 47 22 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia cenocepacia (strain HI2424)
Q802W2 0.000191 47 22 5 190 2 aldh9a1b 4-trimethylaminobutyraldehyde dehydrogenase B Danio rerio
A0KN18 0.000197 47 24 4 168 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q32J27 0.000202 47 25 9 286 3 proA Gamma-glutamyl phosphate reductase Shigella dysenteriae serotype 1 (strain Sd197)
C1KZ99 0.000207 47 22 16 419 3 iolA Malonate-semialdehyde dehydrogenase Listeria monocytogenes serotype 4b (strain CLIP80459)
C0Q6U2 0.000214 47 23 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi C (strain RKS4594)
Q57ST2 0.000214 47 23 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella choleraesuis (strain SC-B67)
A4W6X5 0.000232 47 23 9 319 3 proA Gamma-glutamyl phosphate reductase Enterobacter sp. (strain 638)
B7VQ28 0.000233 47 22 17 432 3 betB Betaine aldehyde dehydrogenase Vibrio atlanticus (strain LGP32)
Q6D6E0 0.000234 47 22 11 412 3 betB Betaine aldehyde dehydrogenase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O04895 0.000239 47 23 11 321 3 BADH4 Betaine aldehyde dehydrogenase, chloroplastic Amaranthus hypochondriacus
Q83SH9 0.000242 47 24 9 286 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri
Q0T7R6 0.000242 47 24 9 286 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri serotype 5b (strain 8401)
B4SVW6 0.000244 47 23 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella newport (strain SL254)
A6T7T5 0.000263 47 22 6 276 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q39I25 0.000288 47 22 8 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B2JS88 0.000304 47 28 3 152 3 betB Betaine aldehyde dehydrogenase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A6U6Y9 0.000306 47 23 9 279 3 betB Betaine aldehyde dehydrogenase Sinorhizobium medicae (strain WSM419)
Q141D3 0.000317 47 23 8 299 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Paraburkholderia xenovorans (strain LB400)
B1YW19 0.000334 46 22 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia ambifaria (strain MC40-6)
B5EWK6 0.00034 46 23 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella agona (strain SL483)
A0PXA4 0.000341 46 27 4 163 3 proA Gamma-glutamyl phosphate reductase Clostridium novyi (strain NT)
Q9AAL5 0.000352 46 28 3 154 3 astD1 N-succinylglutamate 5-semialdehyde dehydrogenase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P28237 0.000366 46 22 11 320 2 None Betaine aldehyde dehydrogenase, chloroplastic Beta vulgaris
A8AKP4 0.000413 46 23 8 286 3 proA Gamma-glutamyl phosphate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8FKM3 0.000424 46 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1JSQ9 0.000431 46 24 2 149 3 betB Betaine aldehyde dehydrogenase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B4T7Q6 0.000475 46 23 8 273 3 proA Gamma-glutamyl phosphate reductase Salmonella heidelberg (strain SL476)
B0T8I8 0.000475 46 23 8 337 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Caulobacter sp. (strain K31)
Q92EQ7 0.000508 46 22 17 420 3 iolA Malonate-semialdehyde dehydrogenase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8K009 0.000531 46 21 2 179 1 Aldh1l2 Mitochondrial 10-formyltetrahydrofolate dehydrogenase Mus musculus
Q53197 0.000557 46 28 5 153 3 NGR_a01370 Putative aldehyde-dehydrogenase-like protein y4uC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O34660 0.000563 46 20 11 310 3 dhaS Putative aldehyde dehydrogenase DhaS Bacillus subtilis (strain 168)
B1JYT5 0.000583 45 22 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia orbicola (strain MC0-3)
Q0TL73 0.000602 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6D1I4 0.000623 45 20 8 314 3 proA Gamma-glutamyl phosphate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0R4Q0 0.000627 45 23 8 286 3 gabD2 Putative succinate-semialdehyde dehydrogenase [NADP(+)] Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A4XK60 0.000631 45 25 2 154 3 proA Gamma-glutamyl phosphate reductase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q1RFS7 0.000646 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain UTI89 / UPEC)
A1A7V4 0.000646 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O1:K1 / APEC
B7L3Z5 0.000646 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain 55989 / EAEC)
B7MC93 0.000646 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q723T1 0.000694 45 21 16 419 3 iolA Malonate-semialdehyde dehydrogenase Listeria monocytogenes serotype 4b (strain F2365)
B7MQ79 0.000711 45 24 9 286 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O81 (strain ED1a)
C0P9J6 0.000833 45 23 10 322 1 AMADH1A Aminoaldehyde dehydrogenase 1a Zea mays
Q0BGV0 0.000855 45 21 7 296 3 astD N-succinylglutamate 5-semialdehyde dehydrogenase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q04FB2 0.000866 45 25 3 155 3 proA Gamma-glutamyl phosphate reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
C6DCX4 0.001 45 20 8 326 3 proA Gamma-glutamyl phosphate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A5IKB6 0.001 45 20 9 292 3 proA Gamma-glutamyl phosphate reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_09005
Feature type CDS
Gene adhE
Product Acyl-CoA reductase or other NAD-dependent aldehyde dehydrogenase
Location 138703 - 140139 (strand: -1)
Length 1437 (nucleotides) / 478 (amino acids)

Contig

Accession ZDB_365
Length 192330 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3272
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00171 Aldehyde dehydrogenase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1012 Lipid transport and metabolism (I) I Acyl-CoA reductase or other NAD-dependent aldehyde dehydrogenase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04021 aldehyde dehydrogenase Pyruvate metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 -

Protein Sequence

MDQKEIENVVKAVLASMSAGTQPAAASAAPQQAAASQNNGFGVFESLDDAVLAAKEAQKSLKTVEMRNLCIGAIRRAATEHARELAVLAVEETGMGRVEDKLAKNLAQANGTPGVECLRPEVLTGDHGLTLIENAAWGVIASVTPSTNPAATAINNAISMIAGGNSVIFAPHPAAKKVSQRTITILNEAIVAAGGPNNLLVTVAKPDIETAQRLFKYPGIGLLVVTGGDAVVESARKHTNKRLIAAGAGNPPVVVDETADIERAAKAIVHGASFDNNIICADEKVLIAVDCIADKLITEMQRNHAVLLTREQSEKLIPVLLKNVDETGHGTVSRDWVGRDAAKIAAAIGMTVPADTRLLIAETDCKHPFAVTELMMPVLPIIRVKDVDQAIDLAVKLEGGCHHTAAMHSNNISNLNRMANAIDTSIFVKNGPCIAGLGLGGEGWTTMTITTPTGEGVTCARTFVRLRRCTMVDSFRIV

Flanking regions ( +/- flanking 50bp)

TTTCATAAATAAATCGCCGCAACGAGTCACAGAAAGAGGCGTGGGTGAATATGGATCAGAAAGAAATTGAGAATGTGGTAAAAGCGGTTCTGGCCAGCATGAGTGCGGGCACACAACCGGCGGCTGCATCAGCGGCACCACAGCAGGCGGCAGCCTCACAGAATAACGGTTTCGGGGTGTTTGAATCCCTGGATGATGCCGTTCTTGCCGCCAAAGAAGCACAGAAATCATTAAAAACTGTCGAAATGCGTAATCTCTGCATCGGCGCAATCCGCCGTGCGGCAACAGAACATGCCCGCGAACTGGCGGTTCTGGCTGTTGAAGAGACCGGCATGGGCCGCGTGGAAGATAAACTCGCGAAGAACTTAGCACAGGCAAACGGCACCCCGGGTGTTGAGTGTCTGCGTCCTGAAGTGTTAACCGGCGACCACGGTTTAACCTTAATCGAAAATGCGGCATGGGGTGTTATCGCCTCTGTCACACCATCCACTAACCCGGCGGCGACGGCAATCAACAATGCCATCAGTATGATCGCCGGGGGTAACAGTGTGATTTTCGCGCCGCATCCGGCAGCGAAAAAAGTCTCACAGCGCACCATCACGATTCTGAACGAAGCCATTGTTGCCGCAGGCGGCCCGAACAACCTGCTGGTGACTGTCGCCAAACCGGATATCGAAACCGCACAACGTTTATTCAAATATCCGGGGATCGGCCTGCTGGTCGTGACCGGGGGTGATGCGGTGGTGGAATCCGCCCGCAAACACACCAACAAACGTCTGATCGCTGCCGGTGCCGGTAACCCGCCGGTCGTGGTGGATGAAACTGCCGATATCGAACGTGCGGCGAAAGCCATTGTTCACGGTGCATCATTCGATAACAACATCATTTGTGCGGATGAAAAAGTGCTGATCGCGGTTGACTGCATTGCAGACAAACTGATCACCGAAATGCAGCGTAATCACGCGGTATTACTGACCCGCGAACAGAGCGAGAAGCTGATCCCGGTTCTGCTGAAGAATGTTGATGAAACCGGCCACGGCACTGTCAGCCGCGACTGGGTAGGCCGTGATGCAGCGAAAATTGCTGCGGCTATCGGTATGACTGTACCGGCAGATACCCGTCTGCTGATTGCAGAAACCGACTGCAAACATCCGTTTGCTGTCACCGAACTGATGATGCCGGTTCTGCCGATCATCCGCGTGAAAGATGTGGATCAGGCGATTGACCTGGCGGTGAAACTGGAAGGCGGCTGCCATCATACCGCAGCGATGCACTCCAATAACATCAGCAACCTGAACCGCATGGCGAATGCCATCGATACCAGTATTTTCGTGAAAAACGGACCGTGTATTGCCGGTCTGGGACTGGGCGGCGAAGGCTGGACAACCATGACGATCACCACACCGACCGGTGAAGGTGTGACCTGTGCGCGGACGTTCGTTCGTCTGCGCCGCTGCACCATGGTGGATTCATTCCGCATCGTGTAAGCCGCTGCGGTGGGGCCTGCGGGCTTCACCGCTTTTTTCCCGGTTAGTGT