Homologs in group_1367

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08025 FBDBKF_08025 100.0 Morganella morganii S1 sfsA DNA/RNA nuclease SfsA
EHELCC_13855 EHELCC_13855 100.0 Morganella morganii S2 sfsA DNA/RNA nuclease SfsA
NLDBIP_14300 NLDBIP_14300 100.0 Morganella morganii S4 sfsA DNA/RNA nuclease SfsA
HKOGLL_08100 HKOGLL_08100 100.0 Morganella morganii S5 sfsA DNA/RNA nuclease SfsA
F4V73_RS12965 F4V73_RS12965 85.6 Morganella psychrotolerans sfsA DNA/RNA nuclease SfsA
PMI_RS00970 PMI_RS00970 60.2 Proteus mirabilis HI4320 sfsA DNA/RNA nuclease SfsA

Distribution of the homologs in the orthogroup group_1367

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1367

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N864 2.88e-121 347 69 0 232 3 sfsA Sugar fermentation stimulation protein homolog Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GIY9 1.86e-113 327 64 0 232 3 sfsA Sugar fermentation stimulation protein homolog Serratia proteamaculans (strain 568)
C6DC42 3.97e-111 321 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1RG44 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain UTI89 / UPEC)
Q8FL24 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLI5 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7J2 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O1:K1 / APEC
B7MP08 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O81 (strain ED1a)
B7MBC9 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIJ0 3.83e-110 319 61 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83SL9 6.06e-110 318 61 0 231 3 sfsA Sugar fermentation stimulation protein A Shigella flexneri
B7N815 8.69e-110 318 60 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4TPW0 9.99e-110 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis (strain Pestoides F)
Q1CLV4 9.99e-110 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis bv. Antiqua (strain Nepal516)
P58431 9.99e-110 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis
Q1C3W4 9.99e-110 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis bv. Antiqua (strain Antiqua)
Q66EF8 1.13e-109 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pseudotuberculosis serotype I (strain IP32953)
B1LGU8 1.19e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain SMS-3-5 / SECEC)
A7FM16 1.3e-109 318 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q32JW1 1.55e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Shigella dysenteriae serotype 1 (strain Sd197)
Q0T860 1.68e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Shigella flexneri serotype 5b (strain 8401)
B6HZC1 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain SE11)
P0A823 1.93e-109 317 61 0 231 1 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12)
B1IQJ4 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZW93 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O9:H4 (strain HS)
B1XCC1 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12 / DH10B)
C4ZRN9 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12 / MC4100 / BW2952)
B7M187 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O8 (strain IAI1)
B5YZI3 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A824 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O157:H7
B7LGK8 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain 55989 / EAEC)
A7ZHN7 1.93e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NIA9 2.16e-109 317 61 0 231 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q6D1Y1 2.66e-109 317 61 0 232 3 sfsA Sugar fermentation stimulation protein homolog Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JJP3 7.35e-109 316 61 0 232 3 sfsA Sugar fermentation stimulation protein homolog Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B4EUD8 2.63e-108 314 60 0 236 3 sfsA Sugar fermentation stimulation protein homolog Proteus mirabilis (strain HI4320)
Q3Z5L1 1.09e-106 310 62 0 224 3 sfsA Sugar fermentation stimulation protein A Shigella sonnei (strain Ss046)
A8ALE4 1.22e-106 310 59 0 234 3 sfsA Sugar fermentation stimulation protein homolog Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6LMK1 1.85e-106 309 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Photobacterium profundum (strain SS9)
B2U2Z0 2.74e-106 309 60 0 231 3 sfsA Sugar fermentation stimulation protein A Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8ZRQ6 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TXP7 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella schwarzengrund (strain CVM19633)
A9MZU5 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SUB3 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella newport (strain SL254)
B4TK10 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella heidelberg (strain SL476)
B5R3F1 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella enteritidis PT4 (strain P125109)
B5FIY3 3.2e-106 309 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella dublin (strain CT_02021853)
Q325Z3 4.02e-106 308 60 0 231 3 sfsA Sugar fermentation stimulation protein A Shigella boydii serotype 4 (strain Sb227)
Q8Z9C1 4.34e-106 308 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella typhi
B7LW53 7.42e-106 308 58 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5BL70 1.15e-105 307 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi A (strain AKU_12601)
Q5PD31 1.15e-105 307 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57T68 1.15e-105 307 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella choleraesuis (strain SC-B67)
A9MPL5 1.27e-105 307 59 0 232 3 sfsA Sugar fermentation stimulation protein A Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F838 6.2e-105 305 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella agona (strain SL483)
B5RHC6 7.23e-105 305 59 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella gallinarum (strain 287/91 / NCTC 13346)
C5BH76 2.84e-104 304 62 0 231 3 sfsA Sugar fermentation stimulation protein homolog Edwardsiella ictaluri (strain 93-146)
A7MGQ7 6.24e-104 303 59 0 231 3 sfsA Sugar fermentation stimulation protein homolog Cronobacter sakazakii (strain ATCC BAA-894)
Q7MHV9 7.24e-104 303 60 1 235 3 sfsA Sugar fermentation stimulation protein homolog Vibrio vulnificus (strain YJ016)
Q2NVQ7 1.4e-103 302 61 0 232 3 sfsA Sugar fermentation stimulation protein homolog Sodalis glossinidius (strain morsitans)
Q9KUC5 1.5e-103 302 59 1 238 3 sfsA Sugar fermentation stimulation protein homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DC06 2.57e-103 301 60 1 235 3 sfsA Sugar fermentation stimulation protein homolog Vibrio vulnificus (strain CMCP6)
A5F980 1.14e-102 300 58 1 239 3 sfsA Sugar fermentation stimulation protein homolog Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VJZ8 1.15e-102 300 57 1 249 3 sfsA Sugar fermentation stimulation protein homolog Vibrio atlanticus (strain LGP32)
A4W6P3 3.35e-102 298 57 0 234 3 sfsA Sugar fermentation stimulation protein homolog Enterobacter sp. (strain 638)
B5Y1P0 8.31e-101 295 57 0 230 3 sfsA Sugar fermentation stimulation protein homolog Klebsiella pneumoniae (strain 342)
Q87LV9 1.36e-100 295 60 1 224 3 sfsA Sugar fermentation stimulation protein homolog Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6T4T5 4.19e-100 293 57 0 230 3 sfsA Sugar fermentation stimulation protein homolog Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MYW9 1.27e-99 292 57 1 236 3 sfsA Sugar fermentation stimulation protein homolog Vibrio campbellii (strain ATCC BAA-1116)
B5FAP6 1.7e-98 289 57 1 235 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio fischeri (strain MJ11)
B6ELD6 6.33e-98 288 57 1 235 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio salmonicida (strain LFI1238)
Q5E2T7 2.68e-97 286 56 1 235 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3ILK5 1.23e-96 285 57 1 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudoalteromonas translucida (strain TAC 125)
A0KP02 4.72e-95 281 57 1 236 3 sfsA Sugar fermentation stimulation protein homolog Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SJ66 4.79e-94 278 56 1 236 3 sfsA Sugar fermentation stimulation protein homolog Aeromonas salmonicida (strain A449)
Q47W67 5.83e-92 273 56 1 230 3 sfsA Sugar fermentation stimulation protein homolog Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0BSG6 6.65e-92 273 59 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A1SSU8 1.17e-90 269 57 1 218 3 sfsA Sugar fermentation stimulation protein homolog Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0HMA6 1.76e-90 269 54 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain MR-4)
Q0HRI1 3.28e-90 268 54 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain MR-7)
A8H0D9 1.36e-89 266 54 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A6WJL5 1.66e-89 266 56 0 224 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS185)
B8EDX9 1.66e-89 266 56 0 224 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS223)
A1RG72 6.78e-89 265 54 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain W3-18-1)
A4YA56 6.78e-89 265 54 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B3GYW4 9.32e-89 265 57 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N335 9.32e-89 265 57 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A9L2I0 1.26e-88 264 56 0 224 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS195)
Q07Y03 2.57e-88 263 54 1 232 3 sfsA Sugar fermentation stimulation protein homolog Shewanella frigidimarina (strain NCIMB 400)
A0L0Q7 2.74e-88 263 53 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain ANA-3)
A3D8A3 6.03e-88 263 55 0 224 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8EIG4 7.83e-88 262 52 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q15NV0 1.1e-87 262 53 0 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3QHP6 2.24e-87 261 54 0 221 3 sfsA Sugar fermentation stimulation protein homolog Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CTC1 2.08e-86 258 55 0 221 3 sfsA Sugar fermentation stimulation protein homolog Shewanella piezotolerans (strain WP3 / JCM 13877)
A8G079 5.06e-86 258 49 2 253 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sediminis (strain HAW-EB3)
B0TTI7 6.26e-86 257 55 0 221 3 sfsA Sugar fermentation stimulation protein homolog Shewanella halifaxensis (strain HAW-EB4)
Q65T73 7.31e-86 257 51 1 235 3 sfsA Sugar fermentation stimulation protein homolog Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57871 2.54e-84 253 55 0 211 3 sfsA Sugar fermentation stimulation protein homolog Pasteurella multocida (strain Pm70)
Q12JD1 8.82e-84 252 53 1 225 3 sfsA Sugar fermentation stimulation protein homolog Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KEP1 1.57e-83 251 50 2 239 3 sfsA Sugar fermentation stimulation protein homolog Shewanella woodyi (strain ATCC 51908 / MS32)
Q0I1R2 5.9e-82 248 53 0 215 3 sfsA Sugar fermentation stimulation protein homolog Histophilus somni (strain 129Pt)
B0UV57 6.88e-82 247 53 0 215 3 sfsA Sugar fermentation stimulation protein homolog Histophilus somni (strain 2336)
A6VN35 6.66e-81 245 50 1 233 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1S3N2 1.65e-80 244 49 0 232 3 sfsA Sugar fermentation stimulation protein homolog Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2S8X2 4.3e-80 243 51 2 227 3 sfsA Sugar fermentation stimulation protein homolog Hahella chejuensis (strain KCTC 2396)
A5UJ18 1.04e-79 242 49 1 233 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain PittGG)
A5UCK4 1.19e-79 241 49 1 233 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain PittEE)
Q4QL46 1.19e-79 241 49 1 233 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain 86-028NP)
P46457 1.64e-77 236 53 0 211 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5QVQ8 1.68e-76 233 47 0 234 3 sfsA Sugar fermentation stimulation protein homolog Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1TYF4 2.99e-76 233 50 3 241 3 sfsA Sugar fermentation stimulation protein homolog Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A6VCH6 2.35e-75 231 50 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain PA7)
Q21FA3 4.06e-74 227 50 2 231 3 sfsA Sugar fermentation stimulation protein homolog Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4XYB5 6.39e-73 224 50 2 227 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas mendocina (strain ymp)
Q9HV77 7.13e-73 224 49 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1AUE8 9.91e-73 224 48 3 230 3 sfsA Sugar fermentation stimulation protein homolog Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B7V1D3 2.47e-72 223 49 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain LESB58)
Q02FV2 1.08e-71 221 49 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain UCBPP-PA14)
C5BN73 8.79e-70 216 47 3 235 3 sfsA Sugar fermentation stimulation protein homolog Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q48N77 2.07e-69 216 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3K6R5 3.1e-69 215 47 2 238 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain Pf0-1)
Q39WK9 8.57e-69 214 46 2 234 3 sfsA Sugar fermentation stimulation protein homolog Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q888P6 9.31e-69 214 47 2 226 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6W2V7 1.45e-68 214 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Marinomonas sp. (strain MWYL1)
Q88DX7 1.54e-68 213 47 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W965 6.06e-68 212 47 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C3K238 2.07e-67 210 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain SBW25)
C1DFI9 2.29e-67 210 48 2 226 3 sfsA Sugar fermentation stimulation protein homolog Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4ZY77 4.9e-67 209 47 2 226 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas syringae pv. syringae (strain B728a)
P61664 6.83e-67 209 46 3 226 3 sfsA Sugar fermentation stimulation protein homolog Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B8GR29 7.73e-67 209 46 3 226 3 sfsA Sugar fermentation stimulation protein homolog Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q4K5Z3 2.48e-66 207 50 2 222 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5GAS3 5.77e-66 206 46 3 230 3 sfsA Sugar fermentation stimulation protein homolog Geotalea uraniireducens (strain Rf4)
Q1I4Q1 8.02e-66 206 48 1 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas entomophila (strain L48)
B0KHV5 1.14e-65 206 47 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain GB-1)
Q2W6W7 2.94e-65 205 46 2 227 3 sfsA Sugar fermentation stimulation protein homolog Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B5EG09 7.78e-65 204 46 3 234 3 sfsA Sugar fermentation stimulation protein homolog Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B1J2E3 1.26e-64 203 48 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain W619)
Q1GDR6 1.04e-63 201 44 2 232 3 sfsA Sugar fermentation stimulation protein homolog Ruegeria sp. (strain TM1040)
C6E6G4 1.28e-63 201 44 3 234 3 sfsA Sugar fermentation stimulation protein homolog Geobacter sp. (strain M21)
B4RYN2 3.83e-63 199 44 1 236 3 sfsA1 Sugar fermentation stimulation protein homolog Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B4R7V3 4.02e-63 199 44 3 237 3 sfsA Sugar fermentation stimulation protein homolog Phenylobacterium zucineum (strain HLK1)
B6IWS8 5.29e-63 199 47 3 225 3 sfsA Sugar fermentation stimulation protein homolog Rhodospirillum centenum (strain ATCC 51521 / SW)
A7IJY7 5.49e-63 199 44 3 236 3 sfsA Sugar fermentation stimulation protein homolog Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B5EQ42 8.27e-63 199 45 3 231 3 sfsA Sugar fermentation stimulation protein homolog Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7A3 8.27e-63 199 45 3 231 3 sfsA Sugar fermentation stimulation protein homolog Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B0SV28 1.26e-61 196 43 4 229 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter sp. (strain K31)
Q1QT05 2.16e-59 191 46 4 219 3 sfsA Sugar fermentation stimulation protein homolog Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B8HW91 3.48e-59 189 45 2 223 3 sfsA Sugar fermentation stimulation protein homolog Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A8HT01 8.24e-59 189 42 3 236 3 sfsA Sugar fermentation stimulation protein homolog Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B9M2P7 8.71e-59 188 43 4 232 3 sfsA Sugar fermentation stimulation protein homolog Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B9JEJ1 2.5e-58 187 44 3 233 3 sfsA Sugar fermentation stimulation protein homolog Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
P58429 3.36e-58 187 43 3 226 3 sfsA Sugar fermentation stimulation protein homolog Agrobacterium fabrum (strain C58 / ATCC 33970)
Q16BM5 2.35e-57 185 41 3 234 3 sfsA Sugar fermentation stimulation protein homolog Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0AQU7 6.58e-57 184 44 3 225 3 sfsA Sugar fermentation stimulation protein homolog Maricaulis maris (strain MCS10)
Q8DI93 7.46e-57 184 44 3 225 3 sfsA Sugar fermentation stimulation protein homolog Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5LM03 1.97e-56 182 40 2 231 3 sfsA Sugar fermentation stimulation protein homolog Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0VSQ3 3.28e-56 182 41 3 239 3 sfsA Sugar fermentation stimulation protein homolog Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2RWF6 1.44e-55 181 43 5 244 3 sfsA Sugar fermentation stimulation protein homolog Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P73664 6.37e-55 179 42 5 229 3 sfsA Sugar fermentation stimulation protein homolog Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q28VR1 9.51e-55 178 39 1 232 3 sfsA Sugar fermentation stimulation protein homolog Jannaschia sp. (strain CCS1)
Q7NJU8 3.91e-54 176 41 2 221 3 sfsA Sugar fermentation stimulation protein homolog Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B0C250 6.1e-54 176 42 3 223 3 sfsA Sugar fermentation stimulation protein homolog Acaryochloris marina (strain MBIC 11017)
B9JWJ9 6.52e-54 176 41 3 232 3 sfsA Sugar fermentation stimulation protein homolog Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A6X073 8.53e-54 176 41 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q111B4 1.98e-53 175 43 3 225 3 sfsA Sugar fermentation stimulation protein homolog Trichodesmium erythraeum (strain IMS101)
A0LC19 3.17e-53 174 44 2 224 3 sfsA Sugar fermentation stimulation protein homolog Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8G034 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella suis biovar 1 (strain 1330)
B0CH77 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VR48 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M5U3 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57CL5 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus biovar 1 (strain 9-941)
Q2YRG1 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus (strain 2308)
B2S6B8 3.18e-53 174 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus (strain S19)
Q8YHS6 9.6e-53 173 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJP4 9.6e-53 173 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Brucella melitensis biotype 2 (strain ATCC 23457)
A8LKM4 1.14e-52 173 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q11IC3 6.28e-52 171 39 3 235 3 sfsA Sugar fermentation stimulation protein homolog Chelativorans sp. (strain BNC1)
Q3J8V9 1.03e-51 170 41 5 235 3 sfsA Sugar fermentation stimulation protein homolog Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1LWL6 1.79e-51 170 41 5 235 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B8IQU9 2.23e-51 169 41 5 236 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A1WWG6 5.22e-51 169 39 2 237 3 sfsA Sugar fermentation stimulation protein homolog Halorhodospira halophila (strain DSM 244 / SL1)
B1WT42 8.62e-51 168 41 5 223 3 sfsA Sugar fermentation stimulation protein homolog Crocosphaera subtropica (strain ATCC 51142 / BH68)
B0ULY8 1.11e-50 168 38 6 237 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium sp. (strain 4-46)
B8H0Z4 1.11e-50 168 40 3 226 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A4Z6 1.11e-50 168 40 3 226 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B1XPQ9 1.27e-50 168 43 4 225 3 sfsA Sugar fermentation stimulation protein homolog Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B2J9R3 1.81e-50 167 42 4 225 3 sfsA Sugar fermentation stimulation protein homolog Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q5N0C6 3.53e-50 166 43 4 223 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LJ9 3.53e-50 166 43 4 223 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6U9H2 4.16e-50 166 40 3 227 3 sfsA Sugar fermentation stimulation protein homolog Sinorhizobium medicae (strain WSM419)
B7JW59 1.7e-49 165 42 5 224 3 sfsA Sugar fermentation stimulation protein homolog Rippkaea orientalis (strain PCC 8801 / RF-1)
Q0A8P7 3.79e-49 164 43 3 234 3 sfsA Sugar fermentation stimulation protein homolog Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B7L065 4.48e-49 164 39 5 237 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q3A286 4.67e-49 163 42 5 232 3 sfsA Sugar fermentation stimulation protein homolog Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q6AS42 6.28e-49 163 40 3 216 3 sfsA Sugar fermentation stimulation protein homolog Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8YSK0 6.65e-49 163 41 4 225 3 sfsA Sugar fermentation stimulation protein homolog Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O87322 1.01e-48 163 40 3 231 3 sfsA Sugar fermentation stimulation protein homolog Rhizobium meliloti (strain 1021)
Q3M3I0 1.72e-48 162 40 4 225 3 sfsA Sugar fermentation stimulation protein homolog Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9VZP1 2.19e-48 162 40 6 237 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum extorquens (strain PA1)
B1ZJ47 5.88e-48 161 40 4 234 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B0JWQ4 1.99e-47 159 41 4 223 3 sfsA Sugar fermentation stimulation protein homolog Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q6G3D7 3.51e-47 159 37 3 225 3 sfsA Sugar fermentation stimulation protein homolog Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2JPQ5 1.09e-46 157 38 3 222 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6FZU1 1.21e-46 157 37 3 225 3 sfsA Sugar fermentation stimulation protein homolog Bartonella quintana (strain Toulouse)
A9IU91 1.61e-46 157 35 3 231 3 sfsA Sugar fermentation stimulation protein homolog Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q2JX13 6.11e-46 155 37 3 222 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain JA-3-3Ab)
P61662 1.84e-43 149 36 4 240 3 sfsA Sugar fermentation stimulation protein homolog Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q31CS0 3.14e-42 146 37 6 235 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9312)
Q7U9K2 3.35e-42 146 37 5 229 3 sfsA Sugar fermentation stimulation protein homolog Parasynechococcus marenigrum (strain WH8102)
A8G2S2 7.85e-42 145 37 6 219 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9215)
Q46HB2 7.38e-41 143 38 5 239 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain NATL2A)
A3PAY3 2.27e-40 142 36 5 214 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9301)
Q7V4T9 4.88e-40 141 37 7 233 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9313)
Q3AN08 5.16e-40 141 37 6 222 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9605)
A2C094 8.98e-40 140 38 5 220 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain NATL1A)
Q4FLK0 1.05e-39 139 35 6 223 3 sfsA Sugar fermentation stimulation protein homolog Pelagibacter ubique (strain HTCC1062)
Q7V331 1.08e-39 140 36 7 229 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q3B078 1.22e-39 140 37 7 228 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9902)
A1V9S2 1.34e-39 139 36 3 227 3 sfsA Sugar fermentation stimulation protein homolog Nitratidesulfovibrio vulgaris (strain DP4)
A2CCJ9 1.56e-39 140 37 7 235 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9303)
A5GIF9 2.21e-39 139 37 6 230 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain WH7803)
A2BP61 2.38e-39 139 36 5 214 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain AS9601)
P61663 1.25e-37 134 35 3 227 3 sfsA Sugar fermentation stimulation protein homolog Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0IDE3 2.54e-37 134 37 7 223 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9311)
A2BUP3 8.05e-37 132 34 6 224 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9515)
C6BVP4 8.77e-37 132 35 5 225 3 sfsA Sugar fermentation stimulation protein homolog Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A5GWG7 4.96e-36 130 36 6 226 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain RCC307)
Q7VDS4 5.27e-36 130 37 6 237 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A9BDN4 1.17e-34 127 37 7 237 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9211)
Q30VA9 4.52e-34 125 34 4 221 3 sfsA Sugar fermentation stimulation protein homolog Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0LQP0 5.21e-33 123 35 4 230 3 sfsA Sugar fermentation stimulation protein homolog Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q1MPZ3 8.89e-33 122 30 3 248 3 sfsA Sugar fermentation stimulation protein homolog Lawsonia intracellularis (strain PHE/MN1-00)
A5UM67 5.06e-32 120 33 4 224 3 sfsA Sugar fermentation stimulation protein homolog Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q2RLC7 4.59e-31 117 33 4 222 3 sfsA Sugar fermentation stimulation protein homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B9LD40 1.22e-30 117 33 5 227 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WJ28 1.22e-30 117 33 5 227 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q67QV9 3.02e-30 115 31 5 235 3 sfsA Sugar fermentation stimulation protein homolog Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9KE16 3.42e-30 115 31 6 235 3 sfsA Sugar fermentation stimulation protein homolog Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8XMU5 8.9e-29 111 29 4 225 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain 13 / Type A)
Q0SVG3 1.32e-28 110 29 4 225 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain SM101 / Type A)
Q8R7N6 2.51e-28 110 32 5 216 3 sfsA Sugar fermentation stimulation protein homolog Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0Q3Q9 2.82e-28 110 32 3 213 3 sfsA Sugar fermentation stimulation protein homolog Clostridium novyi (strain NT)
A5N3V4 4.91e-28 109 29 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DXI3 4.91e-28 109 29 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium kluyveri (strain NBRC 12016)
B8G503 5.85e-28 110 32 6 231 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q5WHX3 7.86e-28 108 29 4 229 3 sfsA Sugar fermentation stimulation protein homolog Shouchella clausii (strain KSM-K16)
B0K5C5 8.98e-28 108 33 4 211 3 sfsA Sugar fermentation stimulation protein homolog Thermoanaerobacter sp. (strain X514)
B0KCE9 8.98e-28 108 33 4 211 3 sfsA Sugar fermentation stimulation protein homolog Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q0TTL3 1.51e-27 108 29 4 225 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q899U6 2.38e-27 107 29 3 224 3 sfsA Sugar fermentation stimulation protein homolog Clostridium tetani (strain Massachusetts / E88)
A8MKA7 3.5e-25 102 29 5 229 3 sfsA Sugar fermentation stimulation protein homolog Alkaliphilus oremlandii (strain OhILAs)
A8MCU7 1.92e-24 100 31 6 221 3 sfsA Sugar fermentation stimulation protein homolog Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A3DJP1 5.5e-24 99 30 5 216 3 sfsA Sugar fermentation stimulation protein homolog Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A7G9D8 1.04e-23 98 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IDX1 1.04e-23 98 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Okra / Type B1)
B1KRU0 1.22e-23 97 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Loch Maree / Type A3)
C1FPJ9 1.27e-23 97 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Kyoto / Type A2)
C3KXT3 1.27e-23 97 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain 657 / Type Ba4)
Q24PG6 1.69e-23 97 32 6 223 3 sfsA Sugar fermentation stimulation protein homolog Desulfitobacterium hafniense (strain Y51)
Q97MP8 2.06e-23 97 30 4 219 3 sfsA Sugar fermentation stimulation protein homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B2V430 2.92e-23 97 30 3 230 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Alaska E43 / Type E3)
B8FZM2 3.41e-23 96 32 6 223 3 sfsA Sugar fermentation stimulation protein homolog Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A6TR01 4.08e-23 96 27 4 222 3 sfsA Sugar fermentation stimulation protein homolog Alkaliphilus metalliredigens (strain QYMF)
Q3AAC8 1.66e-22 94 27 6 231 3 sfsA Sugar fermentation stimulation protein homolog Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5HXT1 2.23e-22 94 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQ70 2.23e-22 94 28 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain ATCC 19397 / Type A)
Q2NFG2 4.68e-22 94 29 4 212 3 sfsA Sugar fermentation stimulation protein homolog Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A4J7I8 7.36e-22 93 27 5 227 3 sfsA Sugar fermentation stimulation protein homolog Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B2A8L6 2.97e-21 91 26 4 232 3 sfsA Sugar fermentation stimulation protein homolog Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q8ZT87 8.77e-21 90 26 4 226 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
O66469 1.73e-20 89 28 7 225 3 sfsA Sugar fermentation stimulation protein homolog Aquifex aeolicus (strain VF5)
B1Y8T9 3.28e-20 89 28 5 228 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
A3MSH9 9.72e-20 87 27 4 226 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
A6LQQ3 1.27e-19 87 28 6 225 3 sfsA Sugar fermentation stimulation protein homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8U1K8 3.17e-19 86 27 4 218 1 sfsA Sugar fermentation stimulation protein homolog Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q97VP5 3.26e-19 86 27 6 231 3 sfsA Sugar fermentation stimulation protein homolog Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A1RVP3 9.86e-19 84 27 6 229 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
O27565 3.79e-18 83 27 5 210 3 sfsA Sugar fermentation stimulation protein homolog Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B8I298 5.54e-18 82 27 5 207 3 sfsA Sugar fermentation stimulation protein homolog Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q12ZM1 7.14e-18 82 27 7 219 3 sfsA Sugar fermentation stimulation protein homolog Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A4WJL8 1.26e-17 82 27 4 226 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
C4KF50 1.28e-17 82 26 7 231 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N3Q3 1.28e-17 82 26 7 231 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.16.27)
C3MTF2 4.46e-17 80 26 7 231 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MN93 1.12e-16 79 25 7 231 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
Q036H7 2.94e-16 78 28 5 230 3 sfsA Sugar fermentation stimulation protein homolog Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W9M6 2.94e-16 78 28 5 230 3 sfsA Sugar fermentation stimulation protein homolog Lacticaseibacillus casei (strain BL23)
P58430 3.59e-16 78 24 4 229 3 sfsA Sugar fermentation stimulation protein homolog Enterococcus mundtii
Q4JBN3 4.79e-15 74 26 8 230 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
A5IJK9 1.36e-14 73 25 7 226 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A6LL86 1.97e-14 73 24 8 231 3 sfsA Sugar fermentation stimulation protein homolog Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B1L8S9 2.5e-14 72 25 7 226 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga sp. (strain RQ2)
Q9WZ35 4.45e-14 72 25 7 226 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B9KB80 3.87e-13 69 26 7 219 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q97AV6 3.45e-12 67 25 6 211 3 sfsA Sugar fermentation stimulation protein homolog Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q9HK14 1.84e-11 65 26 6 193 3 sfsA Sugar fermentation stimulation protein homolog Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9YEX9 7.62e-11 63 26 7 200 3 sfsA Sugar fermentation stimulation protein homolog Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P58432 3.53e-10 61 25 8 227 3 sfsA Sugar fermentation stimulation protein homolog Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q6KZZ4 6.71e-09 57 22 4 204 3 sfsA Sugar fermentation stimulation protein homolog Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
O28756 1.24e-05 48 27 7 174 3 sfsA Sugar fermentation stimulation protein homolog Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08550
Feature type CDS
Gene sfsA
Product DNA/RNA nuclease SfsA
Location 26759 - 27469 (strand: 1)
Length 711 (nucleotides) / 236 (amino acids)
In genomic island -

Contig

Accession ZDB_365
Length 192330 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1367
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03749 Sugar fermentation stimulation protein RE domain
PF17746 SfsA N-terminal OB domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1489 Carbohydrate transport and metabolism (G)
Signal transduction mechanisms (T)
GT DNA-binding protein, stimulates sugar fermentation

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06206 sugar fermentation stimulation protein A - -

Protein Sequence

MEFHPPLQAGTLVQRYKRFLADIITQDGRTITIHCANTGAMTGCATPGDTVWYSESANAKRKYPHSWELTQTQAGHLICVNTMQANRVVAEAIAQNRIPELAGYQTLAQEVRYGSESSRVDFLLTDPQKKPCYVEVKSVTLLENGHGYFPDTVTLRGQKHLRELQAIAEAGNRAVLFFAVLHSGIEAVSDAAHIDKKYSSLLQQASQSGTEVICYRMRMTPDGITAGEKIPFAFMG

Flanking regions ( +/- flanking 50bp)

TGTAGCATTGCCGCCCCCTGAAAAGTGCAGTCACATTGACAGGAGTTACGATGGAATTTCATCCCCCGTTACAGGCGGGCACGCTGGTGCAGCGTTACAAACGTTTTCTGGCGGATATTATCACGCAGGACGGGCGCACCATCACCATTCATTGTGCCAATACCGGCGCGATGACAGGCTGTGCCACGCCGGGTGATACCGTCTGGTATTCCGAATCCGCCAATGCAAAGCGCAAGTACCCGCACAGCTGGGAACTGACGCAGACACAGGCAGGGCATCTGATTTGTGTGAATACCATGCAGGCGAACCGGGTGGTGGCAGAAGCCATTGCACAGAACCGGATACCGGAACTTGCCGGGTATCAGACGCTGGCACAGGAAGTAAGATACGGCAGTGAAAGCAGCCGGGTTGATTTTTTACTGACCGATCCGCAGAAAAAGCCCTGCTATGTCGAGGTGAAATCCGTCACGCTGCTGGAAAACGGACACGGTTATTTTCCCGACACCGTAACTTTACGTGGACAAAAACACTTGCGTGAGTTACAAGCAATTGCTGAAGCGGGAAATCGTGCTGTTCTGTTTTTTGCTGTACTGCATTCAGGGATTGAGGCCGTATCGGACGCAGCACACATTGATAAAAAATATTCATCACTTTTGCAGCAGGCATCACAGTCCGGAACTGAAGTAATTTGTTACAGAATGCGGATGACACCGGACGGCATCACTGCCGGAGAAAAGATACCCTTTGCATTCATGGGGTGAATATCAATTTTTTTAATAATAAATAGGATGTTTTGTGAGTTGCGGAGTGA