Homologs in group_1310

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08025 FBDBKF_08025 85.6 Morganella morganii S1 sfsA DNA/RNA nuclease SfsA
EHELCC_13855 EHELCC_13855 85.6 Morganella morganii S2 sfsA DNA/RNA nuclease SfsA
NLDBIP_14300 NLDBIP_14300 85.6 Morganella morganii S4 sfsA DNA/RNA nuclease SfsA
LHKJJB_08550 LHKJJB_08550 85.6 Morganella morganii S3 sfsA DNA/RNA nuclease SfsA
HKOGLL_08100 HKOGLL_08100 85.6 Morganella morganii S5 sfsA DNA/RNA nuclease SfsA
PMI_RS00970 PMI_RS00970 61.0 Proteus mirabilis HI4320 sfsA DNA/RNA nuclease SfsA

Distribution of the homologs in the orthogroup group_1310

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1310

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N864 1.23e-118 340 67 0 234 3 sfsA Sugar fermentation stimulation protein homolog Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJP3 5.04e-113 326 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GIY9 7.07e-113 326 65 0 232 3 sfsA Sugar fermentation stimulation protein homolog Serratia proteamaculans (strain 568)
C6DC42 7.35e-112 323 63 0 233 3 sfsA Sugar fermentation stimulation protein homolog Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4TPW0 6.26e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis (strain Pestoides F)
Q1CLV4 6.26e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis bv. Antiqua (strain Nepal516)
P58431 6.26e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis
Q1C3W4 6.26e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pestis bv. Antiqua (strain Antiqua)
Q83SL9 6.78e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein A Shigella flexneri
Q6D1Y1 7.32e-111 320 63 0 233 3 sfsA Sugar fermentation stimulation protein homolog Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q66EF8 8.15e-111 321 63 0 233 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FM16 9.59e-111 321 63 0 234 3 sfsA Sugar fermentation stimulation protein homolog Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1RG44 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain UTI89 / UPEC)
Q8FL24 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLI5 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7J2 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O1:K1 / APEC
B7MP08 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O81 (strain ED1a)
B7MBC9 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UIJ0 1.09e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0T860 1.7e-110 320 63 0 234 3 sfsA Sugar fermentation stimulation protein A Shigella flexneri serotype 5b (strain 8401)
Q32JW1 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Shigella dysenteriae serotype 1 (strain Sd197)
B6HZC1 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain SE11)
P0A823 1.78e-110 320 62 0 234 1 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12)
B1IQJ4 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZW93 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O9:H4 (strain HS)
B1XCC1 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12 / DH10B)
C4ZRN9 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain K12 / MC4100 / BW2952)
B7M187 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O8 (strain IAI1)
B5YZI3 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A824 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O157:H7
B7LGK8 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain 55989 / EAEC)
A7ZHN7 1.78e-110 320 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N815 3.07e-110 319 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LGU8 4e-110 319 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli (strain SMS-3-5 / SECEC)
B7NIA9 4e-110 319 62 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8ALE4 7.68e-109 315 62 0 234 3 sfsA Sugar fermentation stimulation protein homolog Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8ZRQ6 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TXP7 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella schwarzengrund (strain CVM19633)
A9MZU5 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SUB3 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella newport (strain SL254)
B4TK10 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella heidelberg (strain SL476)
B5R3F1 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella enteritidis PT4 (strain P125109)
B5FIY3 8.11e-109 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella dublin (strain CT_02021853)
B4EUD8 1.18e-108 315 61 0 236 3 sfsA Sugar fermentation stimulation protein homolog Proteus mirabilis (strain HI4320)
Q8Z9C1 1.39e-108 315 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella typhi
B5BL70 2.95e-108 314 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi A (strain AKU_12601)
Q5PD31 2.95e-108 314 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57T68 2.95e-108 314 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella choleraesuis (strain SC-B67)
Q2NVQ7 6.09e-108 313 62 0 235 3 sfsA Sugar fermentation stimulation protein homolog Sodalis glossinidius (strain morsitans)
B5RHC6 1.61e-107 312 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q3Z5L1 1.76e-107 312 63 0 230 3 sfsA Sugar fermentation stimulation protein A Shigella sonnei (strain Ss046)
B5F838 2.19e-107 312 61 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella agona (strain SL483)
B2U2Z0 3.5e-107 311 61 0 234 3 sfsA Sugar fermentation stimulation protein A Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q325Z3 5.14e-107 311 61 0 234 3 sfsA Sugar fermentation stimulation protein A Shigella boydii serotype 4 (strain Sb227)
Q6LMK1 1.95e-106 309 62 0 232 3 sfsA Sugar fermentation stimulation protein homolog Photobacterium profundum (strain SS9)
Q7MHV9 1.99e-106 310 62 1 235 3 sfsA Sugar fermentation stimulation protein homolog Vibrio vulnificus (strain YJ016)
A9MPL5 2.43e-106 309 60 0 234 3 sfsA Sugar fermentation stimulation protein A Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7VJZ8 4.08e-106 309 59 1 250 3 sfsA Sugar fermentation stimulation protein homolog Vibrio atlanticus (strain LGP32)
Q8DC06 4.37e-106 308 62 1 235 3 sfsA Sugar fermentation stimulation protein homolog Vibrio vulnificus (strain CMCP6)
A7MGQ7 9.24e-106 308 61 0 231 3 sfsA Sugar fermentation stimulation protein homolog Cronobacter sakazakii (strain ATCC BAA-894)
C5BH76 3.25e-105 306 63 0 231 3 sfsA Sugar fermentation stimulation protein homolog Edwardsiella ictaluri (strain 93-146)
Q9KUC5 7.83e-105 306 60 1 237 3 sfsA Sugar fermentation stimulation protein homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F980 6.33e-104 303 59 1 239 3 sfsA Sugar fermentation stimulation protein homolog Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7LW53 1.24e-103 302 60 0 234 3 sfsA Sugar fermentation stimulation protein A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4W6P3 2.25e-103 301 60 0 234 3 sfsA Sugar fermentation stimulation protein homolog Enterobacter sp. (strain 638)
A7MYW9 3.88e-102 298 59 1 237 3 sfsA Sugar fermentation stimulation protein homolog Vibrio campbellii (strain ATCC BAA-1116)
B5Y1P0 4.63e-102 298 59 0 235 3 sfsA Sugar fermentation stimulation protein homolog Klebsiella pneumoniae (strain 342)
Q87LV9 7.01e-102 298 59 1 237 3 sfsA Sugar fermentation stimulation protein homolog Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6T4T5 1.52e-101 297 58 0 235 3 sfsA Sugar fermentation stimulation protein homolog Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5FAP6 1.85e-101 297 60 1 233 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio fischeri (strain MJ11)
B6ELD6 1.84e-100 294 60 1 233 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio salmonicida (strain LFI1238)
Q5E2T7 3.87e-100 293 60 1 233 3 sfsA Sugar fermentation stimulation protein homolog Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KP02 6.16e-97 286 58 2 236 3 sfsA Sugar fermentation stimulation protein homolog Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q47W67 1.82e-96 284 59 1 231 3 sfsA Sugar fermentation stimulation protein homolog Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3ILK5 5.68e-96 283 56 1 238 3 sfsA Sugar fermentation stimulation protein homolog Pseudoalteromonas translucida (strain TAC 125)
A4SJ66 1.35e-94 280 58 2 236 3 sfsA Sugar fermentation stimulation protein homolog Aeromonas salmonicida (strain A449)
A1SSU8 2.9e-93 276 60 1 218 3 sfsA Sugar fermentation stimulation protein homolog Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0HMA6 7.54e-93 275 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain MR-4)
B0BSG6 1.24e-92 275 61 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q0HRI1 1.37e-92 274 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain MR-7)
Q07Y03 2.86e-92 273 58 0 223 3 sfsA Sugar fermentation stimulation protein homolog Shewanella frigidimarina (strain NCIMB 400)
Q8EIG4 1.4e-91 272 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8H0D9 4.35e-91 270 56 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B3GYW4 4.97e-91 270 60 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N335 4.97e-91 270 60 2 220 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6WJL5 6.66e-91 270 56 0 226 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS185)
B8EDX9 6.66e-91 270 56 0 226 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS223)
A0L0Q7 6.96e-91 270 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain ANA-3)
A1RG72 4e-90 268 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sp. (strain W3-18-1)
A4YA56 4e-90 268 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L2I0 3.33e-89 266 56 0 226 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS195)
A3D8A3 3.37e-89 266 56 0 226 3 sfsA Sugar fermentation stimulation protein homolog Shewanella baltica (strain OS155 / ATCC BAA-1091)
A3QHP6 5.57e-89 265 53 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q65T73 5.71e-89 265 53 1 236 3 sfsA Sugar fermentation stimulation protein homolog Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B8CTC1 1.73e-88 264 56 0 221 3 sfsA Sugar fermentation stimulation protein homolog Shewanella piezotolerans (strain WP3 / JCM 13877)
P57871 8.86e-88 262 52 1 234 3 sfsA Sugar fermentation stimulation protein homolog Pasteurella multocida (strain Pm70)
B0TTI7 2.97e-87 261 55 0 231 3 sfsA Sugar fermentation stimulation protein homolog Shewanella halifaxensis (strain HAW-EB4)
A8G079 6.64e-87 261 49 1 253 3 sfsA Sugar fermentation stimulation protein homolog Shewanella sediminis (strain HAW-EB3)
Q15NV0 4e-86 258 53 0 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q0I1R2 1.05e-85 257 56 0 215 3 sfsA Sugar fermentation stimulation protein homolog Histophilus somni (strain 129Pt)
B0UV57 1.12e-85 257 56 0 215 3 sfsA Sugar fermentation stimulation protein homolog Histophilus somni (strain 2336)
Q12JD1 1.47e-85 256 52 1 237 3 sfsA Sugar fermentation stimulation protein homolog Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1S3N2 7.72e-85 254 51 0 232 3 sfsA Sugar fermentation stimulation protein homolog Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6VN35 8.81e-85 254 52 1 234 3 sfsA Sugar fermentation stimulation protein homolog Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B1KEP1 2.25e-84 254 55 2 227 3 sfsA Sugar fermentation stimulation protein homolog Shewanella woodyi (strain ATCC 51908 / MS32)
A5UCK4 3.53e-84 253 52 1 234 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain PittEE)
Q4QL46 3.53e-84 253 52 1 234 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain 86-028NP)
A5UJ18 4.89e-84 253 52 1 234 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain PittGG)
Q2S8X2 6.29e-84 253 53 2 227 3 sfsA Sugar fermentation stimulation protein homolog Hahella chejuensis (strain KCTC 2396)
P46457 1.31e-81 246 51 1 234 3 sfsA Sugar fermentation stimulation protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5QVQ8 6.31e-79 239 50 0 231 3 sfsA Sugar fermentation stimulation protein homolog Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A6VCH6 3.46e-77 235 50 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain PA7)
A4XYB5 2.49e-75 231 49 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas mendocina (strain ymp)
A1TYF4 3.4e-75 230 52 1 217 3 sfsA Sugar fermentation stimulation protein homolog Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1AUE8 5.23e-75 229 49 3 230 3 sfsA Sugar fermentation stimulation protein homolog Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q9HV77 2.76e-73 225 48 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q21FA3 3.36e-73 225 50 2 234 3 sfsA Sugar fermentation stimulation protein homolog Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B7V1D3 3.91e-73 225 48 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain LESB58)
Q88DX7 6.31e-73 224 48 2 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q02FV2 1.88e-72 223 48 2 233 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas aeruginosa (strain UCBPP-PA14)
Q39WK9 2.15e-72 223 46 2 234 3 sfsA Sugar fermentation stimulation protein homolog Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
C5BN73 2.76e-72 223 48 3 235 3 sfsA Sugar fermentation stimulation protein homolog Teredinibacter turnerae (strain ATCC 39867 / T7901)
A5W965 3.61e-72 223 47 2 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3K6R5 4.12e-72 222 48 2 238 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain Pf0-1)
C1DFI9 1.94e-71 221 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q48N77 3.93e-71 220 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q888P6 1.67e-70 218 47 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6W2V7 5.9e-70 218 48 2 235 3 sfsA Sugar fermentation stimulation protein homolog Marinomonas sp. (strain MWYL1)
C3K238 2.05e-69 216 49 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain SBW25)
B0KHV5 2.84e-69 215 47 2 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain GB-1)
Q1I4Q1 4.48e-69 215 48 1 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas entomophila (strain L48)
Q4K5Z3 3.08e-68 213 48 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B4RYN2 7.77e-68 211 46 2 238 3 sfsA1 Sugar fermentation stimulation protein homolog Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q4ZY77 8.21e-68 211 46 2 232 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas syringae pv. syringae (strain B728a)
B1J2E3 9.26e-68 211 48 2 237 3 sfsA Sugar fermentation stimulation protein homolog Pseudomonas putida (strain W619)
A5GAS3 1.73e-67 210 47 3 230 3 sfsA Sugar fermentation stimulation protein homolog Geotalea uraniireducens (strain Rf4)
P61664 2.71e-67 210 45 3 228 3 sfsA Sugar fermentation stimulation protein homolog Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q2W6W7 7.02e-67 209 47 2 224 3 sfsA Sugar fermentation stimulation protein homolog Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B5EG09 4.54e-66 207 45 3 234 3 sfsA Sugar fermentation stimulation protein homolog Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6E6G4 6.13e-65 204 44 3 234 3 sfsA Sugar fermentation stimulation protein homolog Geobacter sp. (strain M21)
B4R7V3 4.88e-64 202 43 3 237 3 sfsA Sugar fermentation stimulation protein homolog Phenylobacterium zucineum (strain HLK1)
Q1GDR6 9.84e-63 198 44 2 232 3 sfsA Sugar fermentation stimulation protein homolog Ruegeria sp. (strain TM1040)
B8GR29 1.49e-62 198 44 3 225 3 sfsA Sugar fermentation stimulation protein homolog Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B6IWS8 1.19e-61 196 44 3 231 3 sfsA Sugar fermentation stimulation protein homolog Rhodospirillum centenum (strain ATCC 51521 / SW)
Q1QT05 2.41e-61 196 45 4 219 3 sfsA Sugar fermentation stimulation protein homolog Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0VSQ3 3.51e-61 194 43 4 239 3 sfsA Sugar fermentation stimulation protein homolog Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B8HW91 6.32e-61 194 45 2 223 3 sfsA Sugar fermentation stimulation protein homolog Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A7IJY7 8.32e-61 194 44 4 237 3 sfsA Sugar fermentation stimulation protein homolog Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B5EQ42 1.24e-59 191 42 4 232 3 sfsA Sugar fermentation stimulation protein homolog Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7A3 1.24e-59 191 42 4 232 3 sfsA Sugar fermentation stimulation protein homolog Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B9M2P7 2.12e-59 190 42 3 234 3 sfsA Sugar fermentation stimulation protein homolog Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q16BM5 9.12e-59 188 42 3 234 3 sfsA Sugar fermentation stimulation protein homolog Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B0SV28 2.78e-58 187 40 3 228 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter sp. (strain K31)
P58429 3.12e-58 187 43 4 228 3 sfsA Sugar fermentation stimulation protein homolog Agrobacterium fabrum (strain C58 / ATCC 33970)
B0C250 5.86e-58 186 45 3 224 3 sfsA Sugar fermentation stimulation protein homolog Acaryochloris marina (strain MBIC 11017)
A8HT01 1.42e-57 185 41 3 237 3 sfsA Sugar fermentation stimulation protein homolog Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q28VR1 4.48e-57 184 40 1 232 3 sfsA Sugar fermentation stimulation protein homolog Jannaschia sp. (strain CCS1)
Q0AQU7 1.6e-56 182 44 3 225 3 sfsA Sugar fermentation stimulation protein homolog Maricaulis maris (strain MCS10)
Q2RWF6 6.75e-56 181 40 5 245 3 sfsA Sugar fermentation stimulation protein homolog Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7NJU8 7.3e-56 181 42 2 222 3 sfsA Sugar fermentation stimulation protein homolog Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B9JEJ1 9.54e-56 181 43 3 233 3 sfsA Sugar fermentation stimulation protein homolog Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q5LM03 9.69e-55 178 40 2 231 3 sfsA Sugar fermentation stimulation protein homolog Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B9JWJ9 1.25e-54 178 41 3 236 3 sfsA Sugar fermentation stimulation protein homolog Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8DI93 1.47e-54 178 42 3 226 3 sfsA Sugar fermentation stimulation protein homolog Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A0LC19 2.88e-54 177 42 3 235 3 sfsA Sugar fermentation stimulation protein homolog Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B1XPQ9 3.6e-54 177 44 4 225 3 sfsA Sugar fermentation stimulation protein homolog Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q111B4 5.59e-54 177 42 3 224 3 sfsA Sugar fermentation stimulation protein homolog Trichodesmium erythraeum (strain IMS101)
A1WWG6 1.85e-53 175 40 2 237 3 sfsA Sugar fermentation stimulation protein homolog Halorhodospira halophila (strain DSM 244 / SL1)
B0JWQ4 6.48e-53 174 44 4 223 3 sfsA Sugar fermentation stimulation protein homolog Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0A8P7 1.4e-52 172 43 2 234 3 sfsA Sugar fermentation stimulation protein homolog Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
P73664 2.37e-52 172 40 5 230 3 sfsA Sugar fermentation stimulation protein homolog Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5N0C6 4.26e-52 171 44 5 224 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LJ9 4.26e-52 171 44 5 224 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B1WT42 5.52e-52 171 42 5 224 3 sfsA Sugar fermentation stimulation protein homolog Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7JW59 8.09e-52 171 42 5 224 3 sfsA Sugar fermentation stimulation protein homolog Rippkaea orientalis (strain PCC 8801 / RF-1)
A8LKM4 1.35e-51 170 38 3 233 3 sfsA Sugar fermentation stimulation protein homolog Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q8G034 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella suis biovar 1 (strain 1330)
B0CH77 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VR48 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M5U3 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57CL5 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus biovar 1 (strain 9-941)
Q2YRG1 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus (strain 2308)
B2S6B8 2.64e-51 169 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella abortus (strain S19)
Q8YSK0 2.98e-51 169 42 4 226 3 sfsA Sugar fermentation stimulation protein homolog Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B2J9R3 3.73e-51 169 41 4 226 3 sfsA Sugar fermentation stimulation protein homolog Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q3A286 4.25e-51 169 42 5 232 3 sfsA Sugar fermentation stimulation protein homolog Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6X073 6.54e-51 168 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8YHS6 7.54e-51 168 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJP4 7.54e-51 168 39 3 233 3 sfsA Sugar fermentation stimulation protein homolog Brucella melitensis biotype 2 (strain ATCC 23457)
Q6AS42 9.13e-51 168 38 4 236 3 sfsA Sugar fermentation stimulation protein homolog Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q3J8V9 1.02e-50 168 41 6 237 3 sfsA Sugar fermentation stimulation protein homolog Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3M3I0 1.03e-50 168 41 4 226 3 sfsA Sugar fermentation stimulation protein homolog Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q11IC3 6.54e-50 166 39 3 235 3 sfsA Sugar fermentation stimulation protein homolog Chelativorans sp. (strain BNC1)
B7L065 6.54e-50 166 37 5 241 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum extorquens (strain CM4 / NCIMB 13688)
O87322 1.03e-49 165 39 4 241 3 sfsA Sugar fermentation stimulation protein homolog Rhizobium meliloti (strain 1021)
A6U9H2 1.12e-49 165 39 4 241 3 sfsA Sugar fermentation stimulation protein homolog Sinorhizobium medicae (strain WSM419)
B8IQU9 1.15e-49 165 39 6 238 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q2JPQ5 1.91e-49 165 38 3 224 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain JA-2-3B'a(2-13))
A9VZP1 3.42e-49 164 38 6 241 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum extorquens (strain PA1)
B1LWL6 8.11e-49 163 37 5 237 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q6FZU1 4.72e-48 161 38 3 225 3 sfsA Sugar fermentation stimulation protein homolog Bartonella quintana (strain Toulouse)
B0ULY8 1.07e-47 160 34 6 238 3 sfsA Sugar fermentation stimulation protein homolog Methylobacterium sp. (strain 4-46)
B8H0Z4 1.09e-47 160 38 3 226 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A4Z6 1.09e-47 160 38 3 226 3 sfsA Sugar fermentation stimulation protein homolog Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B1ZJ47 1.32e-46 157 37 4 234 3 sfsA Sugar fermentation stimulation protein homolog Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9IU91 1.81e-46 157 38 3 225 3 sfsA Sugar fermentation stimulation protein homolog Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q2JX13 2.31e-46 157 37 3 223 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain JA-3-3Ab)
Q6G3D7 3.53e-45 154 37 3 225 3 sfsA Sugar fermentation stimulation protein homolog Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A8G2S2 4.53e-42 146 38 8 240 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9215)
Q31CS0 5.5e-42 145 39 8 240 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9312)
P61662 6.36e-42 145 35 4 240 3 sfsA Sugar fermentation stimulation protein homolog Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7U9K2 2.81e-41 144 37 7 233 3 sfsA Sugar fermentation stimulation protein homolog Parasynechococcus marenigrum (strain WH8102)
Q7V4T9 1.3e-40 142 36 7 236 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9313)
A2CCJ9 1.35e-40 142 38 8 236 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9303)
Q7V331 3.96e-40 141 38 8 229 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A3PAY3 5.13e-40 140 38 5 215 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9301)
Q46HB2 1.28e-39 140 38 7 241 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain NATL2A)
A5GWG7 3.56e-39 139 35 6 236 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain RCC307)
A2BP61 4.44e-39 138 38 5 215 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain AS9601)
A5GIF9 9.59e-39 137 37 7 230 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain WH7803)
Q4FLK0 9.67e-39 137 35 5 221 3 sfsA Sugar fermentation stimulation protein homolog Pelagibacter ubique (strain HTCC1062)
Q3B078 1.65e-38 137 38 8 228 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9902)
A2C094 3.33e-38 136 38 5 220 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain NATL1A)
Q0IDE3 4.84e-38 135 36 8 236 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9311)
Q3AN08 1.17e-37 135 36 7 232 3 sfsA Sugar fermentation stimulation protein homolog Synechococcus sp. (strain CC9605)
A1V9S2 4.07e-37 133 33 3 227 3 sfsA Sugar fermentation stimulation protein homolog Nitratidesulfovibrio vulgaris (strain DP4)
C6BVP4 5.9e-37 132 35 6 224 3 sfsA Sugar fermentation stimulation protein homolog Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A2BUP3 8.68e-37 132 36 6 224 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9515)
P61663 3.08e-36 130 33 3 227 3 sfsA Sugar fermentation stimulation protein homolog Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q7VDS4 1.91e-34 126 36 6 238 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A9BDN4 1.04e-33 124 36 9 236 3 sfsA Sugar fermentation stimulation protein homolog Prochlorococcus marinus (strain MIT 9211)
Q30VA9 1.97e-33 124 33 4 221 3 sfsA Sugar fermentation stimulation protein homolog Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5UM67 5.17e-32 120 34 4 226 3 sfsA Sugar fermentation stimulation protein homolog Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q2RLC7 5.81e-32 119 33 4 222 3 sfsA Sugar fermentation stimulation protein homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A0LQP0 1.25e-31 119 36 4 223 3 sfsA Sugar fermentation stimulation protein homolog Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q1MPZ3 1.33e-31 119 30 3 249 3 sfsA Sugar fermentation stimulation protein homolog Lawsonia intracellularis (strain PHE/MN1-00)
Q5WHX3 7.41e-31 116 32 5 232 3 sfsA Sugar fermentation stimulation protein homolog Shouchella clausii (strain KSM-K16)
Q9KE16 1.23e-29 114 31 5 233 3 sfsA Sugar fermentation stimulation protein homolog Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0Q3Q9 2.76e-28 110 31 3 225 3 sfsA Sugar fermentation stimulation protein homolog Clostridium novyi (strain NT)
Q0SVG3 7.12e-28 108 29 4 227 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain SM101 / Type A)
Q8XMU5 1.11e-27 108 29 4 227 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain 13 / Type A)
B9LD40 3.55e-27 107 32 5 227 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WJ28 3.55e-27 107 32 5 227 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q0TTL3 8.75e-27 106 29 4 227 3 sfsA Sugar fermentation stimulation protein homolog Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q67QV9 1.13e-26 106 29 4 234 3 sfsA Sugar fermentation stimulation protein homolog Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8R7N6 1.21e-26 105 30 5 230 3 sfsA Sugar fermentation stimulation protein homolog Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A5N3V4 1.95e-26 105 29 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DXI3 1.95e-26 105 29 3 215 3 sfsA Sugar fermentation stimulation protein homolog Clostridium kluyveri (strain NBRC 12016)
B0K5C5 2.44e-26 105 32 4 211 3 sfsA Sugar fermentation stimulation protein homolog Thermoanaerobacter sp. (strain X514)
B0KCE9 2.44e-26 105 32 4 211 3 sfsA Sugar fermentation stimulation protein homolog Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q3AAC8 8.29e-26 103 28 7 242 3 sfsA Sugar fermentation stimulation protein homolog Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q899U6 9.13e-26 103 29 3 228 3 sfsA Sugar fermentation stimulation protein homolog Clostridium tetani (strain Massachusetts / E88)
A3DJP1 1.01e-25 103 30 6 236 3 sfsA Sugar fermentation stimulation protein homolog Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2NFG2 1.24e-25 103 30 5 220 3 sfsA Sugar fermentation stimulation protein homolog Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B8G503 3.11e-25 102 31 5 227 3 sfsA Sugar fermentation stimulation protein homolog Chloroflexus aggregans (strain MD-66 / DSM 9485)
A4J7I8 3.19e-24 99 29 5 227 3 sfsA Sugar fermentation stimulation protein homolog Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6TR01 1.44e-23 97 29 5 223 3 sfsA Sugar fermentation stimulation protein homolog Alkaliphilus metalliredigens (strain QYMF)
Q97MP8 3.38e-22 94 28 4 228 3 sfsA Sugar fermentation stimulation protein homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7G9D8 5.89e-22 93 30 4 216 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IDX1 5.89e-22 93 30 4 216 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Okra / Type B1)
C1FPJ9 7.18e-22 93 30 4 216 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Kyoto / Type A2)
C3KXT3 7.18e-22 93 30 4 216 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain 657 / Type Ba4)
B1KRU0 7.33e-22 93 30 4 216 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Loch Maree / Type A3)
B2V430 5.44e-21 90 31 3 230 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Alaska E43 / Type E3)
A5HXT1 8e-21 90 29 4 231 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQ70 8e-21 90 29 4 231 3 sfsA Sugar fermentation stimulation protein homolog Clostridium botulinum (strain ATCC 19397 / Type A)
Q97VP5 1.31e-20 90 29 6 211 3 sfsA Sugar fermentation stimulation protein homolog Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B2A8L6 4.29e-20 88 27 4 232 3 sfsA Sugar fermentation stimulation protein homolog Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
O27565 5.06e-20 88 27 5 212 3 sfsA Sugar fermentation stimulation protein homolog Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A8MCU7 4.23e-19 85 28 6 221 3 sfsA Sugar fermentation stimulation protein homolog Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A6LQQ3 4.58e-19 85 28 6 234 3 sfsA Sugar fermentation stimulation protein homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8ZT87 1.54e-18 84 25 4 226 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
C4KF50 1.75e-18 84 26 7 230 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N3Q3 1.75e-18 84 26 7 230 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.16.27)
O66469 1.78e-18 84 26 6 224 3 sfsA Sugar fermentation stimulation protein homolog Aquifex aeolicus (strain VF5)
B8I298 2.38e-18 84 28 6 225 3 sfsA Sugar fermentation stimulation protein homolog Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B8FZM2 2.42e-18 84 31 6 219 3 sfsA Sugar fermentation stimulation protein homolog Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q12ZM1 2.75e-18 84 26 6 210 3 sfsA Sugar fermentation stimulation protein homolog Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q24PG6 2.97e-18 83 31 6 219 3 sfsA Sugar fermentation stimulation protein homolog Desulfitobacterium hafniense (strain Y51)
B1Y8T9 3.57e-18 83 27 6 227 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
C3MTF2 5.49e-18 83 26 7 230 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
A1RVP3 6.66e-18 82 28 6 225 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q8U1K8 1.16e-17 82 27 4 207 1 sfsA Sugar fermentation stimulation protein homolog Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A8MKA7 1.25e-17 82 28 6 226 3 sfsA Sugar fermentation stimulation protein homolog Alkaliphilus oremlandii (strain OhILAs)
C3MN93 1.39e-17 82 26 7 230 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
A3MSH9 2.92e-17 80 26 4 226 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
A4WJL8 3.52e-16 78 26 4 230 3 sfsA Sugar fermentation stimulation protein homolog Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
P58430 9.44e-15 74 23 4 229 3 sfsA Sugar fermentation stimulation protein homolog Enterococcus mundtii
A6LL86 2.69e-14 72 24 8 231 3 sfsA Sugar fermentation stimulation protein homolog Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q036H7 1e-13 71 26 5 230 3 sfsA Sugar fermentation stimulation protein homolog Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W9M6 1e-13 71 26 5 230 3 sfsA Sugar fermentation stimulation protein homolog Lacticaseibacillus casei (strain BL23)
B9KB80 3.61e-13 69 25 8 216 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q6KZZ4 5.08e-13 69 23 5 224 3 sfsA Sugar fermentation stimulation protein homolog Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q4JBN3 1.79e-12 67 24 8 239 3 sfsA Sugar fermentation stimulation protein homolog Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q97AV6 6.23e-12 66 25 6 212 3 sfsA Sugar fermentation stimulation protein homolog Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A5IJK9 1.19e-11 65 24 7 214 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L8S9 2.48e-11 64 24 7 214 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga sp. (strain RQ2)
Q9WZ35 3e-11 64 24 7 214 3 sfsA Sugar fermentation stimulation protein homolog Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9YEX9 1.32e-10 62 24 8 225 3 sfsA Sugar fermentation stimulation protein homolog Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9HK14 3.31e-10 61 24 6 201 3 sfsA Sugar fermentation stimulation protein homolog Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P58432 7.38e-08 54 23 7 227 3 sfsA Sugar fermentation stimulation protein homolog Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
O28756 2.1e-05 47 28 8 174 3 sfsA Sugar fermentation stimulation protein homolog Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12965
Feature type CDS
Gene sfsA
Product DNA/RNA nuclease SfsA
Location 205805 - 206515 (strand: 1)
Length 711 (nucleotides) / 236 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1310
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03749 Sugar fermentation stimulation protein RE domain
PF17746 SfsA N-terminal OB domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1489 Carbohydrate transport and metabolism (G)
Signal transduction mechanisms (T)		 GT DNA-binding protein, stimulates sugar fermentation

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06206 sugar fermentation stimulation protein A - -

Protein Sequence

MEFHPPLQAGTLIQRYKRFLADIITQDGSTITIHCANTGAMTGCATPGDTVWYSESANAKRKYPHSWELTQTQDGHLICVNTLRANQLVSEALMQSQIPELAGYQTQAQEVRYGSENSRIDFLLTDQHKTPCYIEVKSVTLLENEQGYFPDTVTLRGQKHLRELQAIAEAGNRAVLFFAVLHSGIESVSGAAHIDKKYSSLLQQAVLSGMEIICYKMRITPDGIRVDEKIPFVFTG

Flanking regions ( +/- flanking 50bp)

TGTAGCATTGCCGCCCCCTGAAAAGTGCAATCACATTGACAGGAGTTGCTATGGAGTTTCATCCCCCGTTACAGGCGGGGACGCTGATTCAGCGTTATAAGCGTTTTCTTGCGGATATTATCACGCAGGACGGCAGCACTATCACCATTCATTGTGCCAATACCGGCGCGATGACGGGCTGCGCAACACCGGGTGATACGGTCTGGTATTCCGAATCCGCCAATGCGAAGCGCAAGTATCCGCACAGTTGGGAGCTGACACAGACGCAGGACGGACATCTGATTTGTGTTAATACCCTGAGGGCGAATCAGCTGGTGAGTGAAGCGCTGATGCAGTCGCAAATCCCGGAGCTTGCCGGGTATCAAACTCAGGCACAGGAAGTAAGATACGGCAGCGAAAACAGCCGGATAGATTTTTTACTGACGGATCAGCATAAAACGCCCTGCTACATTGAGGTAAAATCCGTCACATTGCTGGAAAACGAACAAGGTTATTTTCCCGATACCGTAACTTTACGTGGACAAAAACACTTACGTGAGTTACAAGCAATTGCTGAAGCGGGAAACCGTGCAGTTCTCTTTTTTGCTGTACTGCATTCAGGGATTGAGTCAGTATCAGGAGCCGCACACATTGATAAAAAATATTCATCACTATTGCAGCAGGCAGTACTATCCGGAATGGAAATTATCTGCTACAAGATGCGCATAACACCGGATGGCATCAGGGTTGATGAAAAAATACCCTTTGTATTCACGGGGTGAATATCAGTTTTTTTTAATAATAAGTAGGATGTTTTGTTAGCTGTGGGCGA