Homologs in group_1311

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08030 FBDBKF_08030 100.0 Morganella morganii S1 hrpB ATP-dependent helicase HrpB
EHELCC_13860 EHELCC_13860 100.0 Morganella morganii S2 hrpB ATP-dependent helicase HrpB
NLDBIP_14305 NLDBIP_14305 100.0 Morganella morganii S4 hrpB ATP-dependent helicase HrpB
HKOGLL_08095 HKOGLL_08095 100.0 Morganella morganii S5 hrpB ATP-dependent helicase HrpB
F4V73_RS12960 F4V73_RS12960 85.2 Morganella psychrotolerans hrpB ATP-dependent helicase HrpB
PMI_RS00975 PMI_RS00975 53.7 Proteus mirabilis HI4320 hrpB ATP-dependent helicase HrpB

Distribution of the homologs in the orthogroup group_1311

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1311

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37024 0.0 820 53 4 815 1 hrpB ATP-dependent RNA helicase HrpB Escherichia coli (strain K12)
Q10752 5.75e-74 265 37 7 431 3 cdc28 Pre-mRNA-splicing factor ATP-dependent RNA helicase-like protein cdc28 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F4JMJ3 1.19e-73 261 38 6 410 2 At4g16680 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH8 Arabidopsis thaliana
O51767 2.77e-72 256 34 5 413 1 hrpA ATP-dependent RNA helicase HrpA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
F4IJV4 3.41e-71 256 36 6 429 2 MEE29 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH6 Arabidopsis thaliana
Q8VY00 1.96e-69 251 35 6 429 1 ESP3 Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH1 Arabidopsis thaliana
Q54MH3 3e-68 248 36 8 440 3 dhx16 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 Dictyostelium discoideum
P36009 5.88e-68 242 35 6 434 1 DHR2 Probable ATP-dependent RNA helicase DHR2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53131 1.79e-67 242 36 8 417 1 PRP43 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP43 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O45244 3.4e-67 244 35 7 447 1 mog-4 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase mog-4 Caenorhabditis elegans
Q38953 5.92e-67 245 37 9 438 1 At3g26560 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH5 Arabidopsis thaliana
O42643 4.2e-66 243 36 9 439 1 prp22 Pre-mRNA-splicing factor ATP-dependent RNA helicase prp22 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O43143 9.26e-66 237 35 8 441 1 DHX15 ATP-dependent RNA helicase DHX15 Homo sapiens
O35286 9.54e-66 237 36 8 422 1 Dhx15 ATP-dependent RNA helicase DHX15 Mus musculus
Q5RAZ4 1.06e-65 237 36 8 422 2 DHX15 ATP-dependent RNA helicase DHX15 Pongo abelii
O60231 2.35e-65 239 36 11 446 1 DHX16 Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 Homo sapiens
Q7YR39 2.37e-65 239 36 11 446 3 DHX16 Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 Pan troglodytes
Q54F05 3.86e-65 239 35 8 435 3 dhx8 ATP-dependent RNA helicase dhx8 Dictyostelium discoideum
Q767K6 4.84e-65 239 35 10 445 3 DHX16 Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 Sus scrofa
O22899 2.38e-64 232 35 10 434 2 At2g47250 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH3 Arabidopsis thaliana
Q7K3M5 3.33e-64 232 36 11 421 2 Dhx15 ATP-dependent RNA helicase DHX15 homolog Drosophila melanogaster
P45018 1.13e-63 236 35 6 425 3 hrpA ATP-dependent RNA helicase HrpA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93Y16 2.24e-63 229 34 7 436 1 At1g27900 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH4 Arabidopsis thaliana
O42945 2.94e-63 229 35 8 424 3 prp43 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase prp43 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54NJ4 2.12e-62 227 34 8 419 3 dhx15 Putative ATP-dependent RNA helicase DHX15 Dictyostelium discoideum
Q14562 2.28e-62 232 35 8 435 1 DHX8 ATP-dependent RNA helicase DHX8 Homo sapiens
P43329 2.58e-62 232 32 5 433 1 hrpA ATP-dependent RNA helicase HrpA Escherichia coli (strain K12)
A2A4P0 2.9e-62 231 35 8 435 2 Dhx8 ATP-dependent RNA helicase DHX8 Mus musculus
Q09530 9.53e-62 230 36 9 437 1 mog-5 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase mog-5 Caenorhabditis elegans
Q20875 1.65e-61 224 34 11 446 3 ddx-15 Pre-mRNA-splicing factor ATP-dependent RNA helicase ddx-15 Caenorhabditis elegans
Q17R09 1.87e-61 229 34 7 436 2 DHX38 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 Bos taurus
Q9VL25 3.63e-61 223 34 9 439 1 ath ATP-dependent RNA helicase DHX33 Drosophila melanogaster
Q9LZQ9 3.95e-61 223 34 9 434 2 At3g62310 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH2 Arabidopsis thaliana
Q92620 6.64e-61 227 34 7 436 1 DHX38 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 Homo sapiens
Q03319 3.04e-60 220 33 5 417 3 prh1 Probable ATP-dependent RNA helicase prh1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9BKQ8 7.4e-60 219 35 9 403 3 ddx-35 Probable ATP-dependent RNA helicase DHX35 homolog Caenorhabditis elegans
Q5ZI74 1.13e-59 224 34 9 441 2 DHX30 ATP-dependent RNA helicase DHX30 Gallus gallus
Q14147 1.4e-59 223 34 6 423 1 DHX34 Probable ATP-dependent RNA helicase DHX34 Homo sapiens
P24384 1.42e-59 223 34 7 437 1 PRP22 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP22 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P20095 2.81e-59 220 32 8 437 1 PRP2 Pre-mRNA-splicing factor ATP-dependent RNA helicase-like protein PRP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9DBV3 3.55e-59 222 34 6 423 1 Dhx34 Probable ATP-dependent RNA helicase DHX34 Mus musculus
Q9P774 3.81e-59 222 33 10 448 3 prp16 Pre-mRNA-splicing factor ATP-dependent RNA helicase prp16 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9H5Z1 1.15e-58 216 34 9 425 1 DHX35 Probable ATP-dependent RNA helicase DHX35 Homo sapiens
A1Z9L3 3.43e-58 219 35 8 434 1 pea ATP-dependent RNA helicase DHX8 Drosophila melanogaster
Q5R607 8.85e-58 218 36 10 443 2 DHX30 ATP-dependent RNA helicase DHX30 Pongo abelii
Q7L2E3 9.44e-58 218 36 10 443 1 DHX30 ATP-dependent RNA helicase DHX30 Homo sapiens
P34498 1.37e-57 217 33 6 434 1 mog-1 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase mog-1 Caenorhabditis elegans
Q5RBD4 3.15e-57 212 33 9 425 2 DHX35 Probable ATP-dependent RNA helicase DHX35 Pongo abelii
Q6PE54 9.02e-57 211 32 7 436 1 Dhx40 Probable ATP-dependent RNA helicase DHX40 Mus musculus
Q99PU8 9.7e-57 215 36 10 443 1 Dhx30 ATP-dependent RNA helicase DHX30 Mus musculus
Q5BJS0 9.93e-57 214 36 10 443 1 Dhx30 ATP-dependent RNA helicase DHX30 Rattus norvegicus
Q2NKY8 2.3e-56 214 36 10 443 2 DHX30 ATP-dependent RNA helicase DHX30 Bos taurus
Q5XI69 2.5e-56 210 32 7 436 2 Dhx40 Probable ATP-dependent RNA helicase DHX40 Rattus norvegicus
F4JRJ6 1.11e-55 207 33 13 453 3 At4g18465 Probable pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH9 Arabidopsis thaliana
Q5R864 1.22e-55 208 32 7 433 2 DHX40 Probable ATP-dependent RNA helicase DHX40 Pongo abelii
Q8IX18 3.03e-55 207 32 7 433 1 DHX40 Probable ATP-dependent RNA helicase DHX40 Homo sapiens
Q80VY9 5.17e-55 205 33 7 428 1 Dhx33 ATP-dependent RNA helicase DHX33 Mus musculus
F4IE66 5.28e-55 206 31 8 450 1 RID1 Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH10 Arabidopsis thaliana
Q9HE06 1.6e-54 203 32 10 415 3 SPAC20H4.09 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase C20H4.09 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q28141 1.93e-54 208 30 9 486 1 DHX9 ATP-dependent RNA helicase A Bos taurus
F4KGU4 5.35e-54 207 34 9 419 3 At5g10370 ATP-dependent RNA helicase DEAH12, chloroplastic Arabidopsis thaliana
Q68FK8 1.25e-53 205 29 9 486 2 dhx9 ATP-dependent RNA helicase A protein Xenopus laevis
Q9H6R0 1.88e-53 201 32 9 431 1 DHX33 ATP-dependent RNA helicase DHX33 Homo sapiens
F4K2E9 4.3e-53 204 30 6 436 1 CUV Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH7 Arabidopsis thaliana
Q08211 2.37e-52 201 30 12 488 1 DHX9 ATP-dependent RNA helicase A Homo sapiens
Q5R874 2.39e-52 201 30 12 488 2 DHX9 ATP-dependent RNA helicase A Pongo abelii
O17438 3.1e-51 189 35 6 345 2 PRP1 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase PRP1 (Fragment) Strongylocentrotus purpuratus
P0CE10 6.35e-51 197 33 10 449 3 At4g01020 ATP-dependent RNA helicase DEAH11, chloroplastic Arabidopsis thaliana
O70133 2.09e-50 196 30 12 488 1 Dhx9 ATP-dependent RNA helicase A Mus musculus
Q06698 5.55e-49 191 29 10 448 1 YLR419W Putative ATP-dependent RNA helicase YLR419W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F4ILR7 3.38e-47 185 30 8 483 2 At2g35920 DExH-box ATP-dependent RNA helicase DExH1 Arabidopsis thaliana
O94536 2.44e-46 183 29 7 455 3 ucp12 Putative ATP-dependent RNA helicase ucp12 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P15938 9.83e-46 181 32 9 445 1 PRP16 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q296Q5 2.44e-43 174 28 15 504 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila pseudoobscura pseudoobscura
Q9HDY4 4.31e-43 172 27 12 496 3 SPAPB1A10.06c Putative ATP-dependent RNA helicase PB1A10.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B4GEU5 7.62e-43 172 28 14 488 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila persimilis
Q3MHU3 1.74e-40 165 28 9 467 2 Tdrd9 ATP-dependent RNA helicase TDRD9 Rattus norvegicus
Q8NDG6 3e-40 164 29 10 467 1 TDRD9 ATP-dependent RNA helicase TDRD9 Homo sapiens
D4A2Z8 4.57e-40 163 28 11 504 1 Dhx36 ATP-dependent DNA/RNA helicase DHX36 Rattus norvegicus
Q5UQ96 4.69e-40 161 28 15 473 1 MIMI_L540 Putative ATP-dependent RNA helicase L540 Acanthamoeba polyphaga mimivirus
Q14BI7 5.77e-40 163 28 9 466 1 Tdrd9 ATP-dependent RNA helicase TDRD9 Mus musculus
B4HLH4 3.91e-39 160 29 16 510 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila sechellia
P0C7L7 9.02e-39 159 30 12 503 3 UMAG_11114 Putative DEAH-box ATP-dependent helicase UM11114 Ustilago maydis (strain 521 / FGSC 9021)
Q7QCW2 1.05e-38 159 28 16 516 3 spn-E Probable ATP-dependent RNA helicase spindle-E Anopheles gambiae
B4LX81 2.13e-38 158 30 18 475 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila virilis
B4PRJ9 4.55e-38 157 28 12 479 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila yakuba
B4JT42 4.59e-38 157 28 13 475 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila grimshawi
B8A4F4 6.08e-38 157 29 7 408 2 tdrd9 ATP-dependent RNA helicase TDRD9 Danio rerio
Q7Z478 6.18e-38 157 27 11 518 1 DHX29 ATP-dependent RNA helicase DHX29 Homo sapiens
Q581T1 7.46e-38 157 28 9 461 1 REH2 RNA editing associated helicase 2 Trypanosoma brucei brucei (strain 927/4 GUTat10.1)
B3P3W1 1.27e-37 156 29 14 479 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila erecta
Q8VHK9 1.75e-37 155 27 11 504 1 Dhx36 ATP-dependent DNA/RNA helicase DHX36 Mus musculus
A3KMI0 4.76e-36 150 29 14 510 2 dhx29 ATP-dependent RNA helicase dhx29 Xenopus laevis
B4K5R2 6.14e-36 150 29 17 475 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila mojavensis
Q9VF26 7.66e-36 150 29 15 492 2 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila melanogaster
B3M383 8.86e-36 150 27 15 491 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila ananassae
B0XDC4 1.58e-35 149 28 14 496 3 spn-E Probable ATP-dependent RNA helicase spindle-E Culex quinquefasciatus
B4NBB0 6.85e-35 147 28 15 488 3 spn-E Probable ATP-dependent RNA helicase spindle-E Drosophila willistoni
Q16JS8 2.18e-34 145 28 15 483 3 spn-E Probable ATP-dependent RNA helicase spindle-E Aedes aegypti
Q6PGC1 2.23e-34 145 28 12 518 1 Dhx29 ATP-dependent RNA helicase DHX29 Mus musculus
F4IDQ6 1.21e-26 121 34 3 226 1 NIH DExH-box ATP-dependent RNA helicase DExH2 Arabidopsis thaliana
F4IDQ6 1.73e-19 98 34 4 188 1 NIH DExH-box ATP-dependent RNA helicase DExH2 Arabidopsis thaliana
Q6P158 2.51e-26 120 41 3 177 1 DHX57 Putative ATP-dependent RNA helicase DHX57 Homo sapiens
Q6P158 3.19e-26 119 35 5 227 1 DHX57 Putative ATP-dependent RNA helicase DHX57 Homo sapiens
Q05B79 2.57e-26 119 33 3 225 1 DHX36 ATP-dependent DNA/RNA helicase DHX36 Bos taurus
Q05B79 6.38e-21 102 34 4 187 1 DHX36 ATP-dependent DNA/RNA helicase DHX36 Bos taurus
F4INY4 6.17e-26 118 34 5 230 2 HVT1 DExH-box ATP-dependent RNA helicase DExH6 Arabidopsis thaliana
F4INY4 3.31e-23 110 34 3 190 2 HVT1 DExH-box ATP-dependent RNA helicase DExH6 Arabidopsis thaliana
Q6P5D3 7.55e-26 118 36 5 226 1 Dhx57 Putative ATP-dependent RNA helicase DHX57 Mus musculus
Q6P5D3 1.7e-25 117 42 3 171 1 Dhx57 Putative ATP-dependent RNA helicase DHX57 Mus musculus
F4I9Q5 8.45e-26 118 34 3 224 2 At1g58060 DExH-box ATP-dependent RNA helicase DExH7, chloroplastic Arabidopsis thaliana
F4I9Q5 1.99e-21 104 37 5 197 2 At1g58060 DExH-box ATP-dependent RNA helicase DExH7, chloroplastic Arabidopsis thaliana
Q9H2U1 9.88e-26 117 33 3 225 1 DHX36 ATP-dependent DNA/RNA helicase DHX36 Homo sapiens
Q9H2U1 6.53e-21 102 36 4 168 1 DHX36 ATP-dependent DNA/RNA helicase DHX36 Homo sapiens
Q9C6G0 1.28e-25 117 34 4 225 3 At1g58050 DExH-box ATP-dependent RNA helicase DExH4, chloroplastic Arabidopsis thaliana
Q9C6G0 2.5e-18 94 34 5 197 3 At1g58050 DExH-box ATP-dependent RNA helicase DExH4, chloroplastic Arabidopsis thaliana
P24785 2.22e-25 117 34 3 221 1 mle Dosage compensation regulator mle Drosophila melanogaster
P24785 1.6e-21 104 35 5 191 1 mle Dosage compensation regulator mle Drosophila melanogaster
F4IM84 7.95e-25 115 39 2 178 3 At2g01130 DExH-box ATP-dependent RNA helicase DExH5, mitochondrial Arabidopsis thaliana
F4IM84 2.33e-24 113 34 3 221 3 At2g01130 DExH-box ATP-dependent RNA helicase DExH5, mitochondrial Arabidopsis thaliana
Q04217 1.28e-24 114 33 3 215 1 ECM16 Probable ATP-dependent RNA helicase DHR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q04217 2.5e-24 113 30 8 250 1 ECM16 Probable ATP-dependent RNA helicase DHR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9C813 1.55e-24 114 30 6 262 2 FAS4 ATP-dependent RNA helicase DEAH13 Arabidopsis thaliana
Q9C813 6.83e-20 99 33 2 202 2 FAS4 ATP-dependent RNA helicase DEAH13 Arabidopsis thaliana
O46072 1.75e-24 114 32 7 227 1 kz Probable ATP-dependent RNA helicase kurz Drosophila melanogaster
O46072 1.5e-17 91 31 4 215 1 kz Probable ATP-dependent RNA helicase kurz Drosophila melanogaster
Q924H9 1.78e-24 113 27 10 452 2 Dqx1 ATP-dependent RNA helicase DQX1 Mus musculus
O60114 4.51e-24 112 33 3 206 3 SPBC15C4.05 Uncharacterized helicase C15C4.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O60114 3.87e-20 100 33 3 180 3 SPBC15C4.05 Uncharacterized helicase C15C4.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B2RR83 9.13e-23 108 30 5 276 1 Ythdc2 3'-5' RNA helicase YTHDC2 Mus musculus
B2RR83 2.36e-22 107 36 3 187 1 Ythdc2 3'-5' RNA helicase YTHDC2 Mus musculus
Q5R746 9.17e-23 108 30 5 276 2 YTHDC2 3'-5' RNA helicase YTHDC2 Pongo abelii
Q5R746 2e-22 107 36 3 187 2 YTHDC2 3'-5' RNA helicase YTHDC2 Pongo abelii
Q9H6S0 9.82e-23 108 30 6 288 1 YTHDC2 3'-5' RNA helicase YTHDC2 Homo sapiens
Q9H6S0 2.65e-22 107 36 3 187 1 YTHDC2 3'-5' RNA helicase YTHDC2 Homo sapiens
F4HYJ7 1.04e-22 108 37 2 181 3 At1g48650 DExH-box ATP-dependent RNA helicase DExH3 Arabidopsis thaliana
F4HYJ7 8.01e-21 102 35 2 220 3 At1g48650 DExH-box ATP-dependent RNA helicase DExH3 Arabidopsis thaliana
Q1EHT7 2.64e-22 106 27 13 354 2 Os01g0256800 Zinc finger CCCH domain-containing protein 4 Oryza sativa subsp. japonica
Q8IY37 3.17e-22 106 30 8 241 1 DHX37 Probable ATP-dependent RNA helicase DHX37 Homo sapiens
Q8IY37 1.88e-17 91 37 1 143 1 DHX37 Probable ATP-dependent RNA helicase DHX37 Homo sapiens
P34305 8.84e-22 105 34 2 189 3 rha-2 Putative ATP-dependent RNA helicase rha-2 Caenorhabditis elegans
P34305 1.07e-19 98 32 9 217 3 rha-2 Putative ATP-dependent RNA helicase rha-2 Caenorhabditis elegans
Q8V9U2 8.82e-21 102 25 20 457 3 Mal-080 Putative RNA Helicase B962L African swine fever virus (isolate Tick/Malawi/Lil 20-1/1983)
P0C9A4 1.08e-20 101 26 20 455 3 Ken-084 Putative RNA Helicase B962L African swine fever virus (isolate Pig/Kenya/KEN-50/1950)
Q22307 3.05e-20 100 36 8 179 2 rha-1 ATP-dependent RNA helicase A Caenorhabditis elegans
Q22307 1.02e-15 85 32 5 222 2 rha-1 ATP-dependent RNA helicase A Caenorhabditis elegans
Q89443 1.91e-19 97 25 18 434 2 Ba71V-072 Putative RNA helicase B962L African swine fever virus (strain Badajoz 1971 Vero-adapted)
P0C9A3 2.1e-19 97 25 18 434 3 War-082 Putative RNA Helicase B962L African swine fever virus (isolate Warthog/Namibia/Wart80/1980)
P0C9A2 2.72e-19 97 25 18 434 3 Pret-084 Putative RNA Helicase B962L African swine fever virus (isolate Tick/South Africa/Pretoriuskop Pr4/1996)
O22243 1.09e-17 92 26 9 397 2 At2g47680 DExH-box ATP-dependent RNA helicase DExH8 Arabidopsis thaliana
Q8BZS9 1.21e-17 91 25 9 419 1 Dhx32 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX32 Mus musculus
Q8TE96 2.58e-17 90 26 9 382 1 DQX1 ATP-dependent RNA helicase DQX1 Homo sapiens
Q3ZBE0 4.46e-17 89 26 9 382 2 DQX1 ATP-dependent RNA helicase DQX1 Bos taurus
Q5XH12 1.4e-16 88 23 10 418 2 dhx32 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX32 Xenopus laevis
Q7L7V1 1.61e-15 84 24 8 388 1 DHX32 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX32 Homo sapiens
Q5UR20 1.11e-13 79 21 10 418 3 MIMI_R366 Putative ATP-dependent RNA helicase R366 Acanthamoeba polyphaga mimivirus
Q84934 1.19e-13 79 27 13 329 3 None Genome polyprotein Plum pox potyvirus (strain SK 68)
P17766 1.6e-13 79 27 13 329 3 None Genome polyprotein Plum pox potyvirus (isolate NAT)
P17767 1.73e-13 79 27 13 329 1 None Genome polyprotein Plum pox potyvirus (strain Rankovic)
P13529 1.78e-13 78 27 13 329 1 None Genome polyprotein Plum pox potyvirus (strain D)
Q6XW15 2.62e-13 78 24 19 444 3 None Genome polyprotein Beet mosaic virus
O36979 1.08e-12 76 25 12 333 3 None Genome polyprotein Zucchini yellow mosaic virus (strain Singapore)
Q90069 1.18e-12 75 25 11 325 3 None Genome polyprotein Soybean mosaic virus (strain G2)
P21231 4.2e-12 74 25 9 321 1 None Genome polyprotein Soybean mosaic virus (strain N)
Q04574 4.22e-12 74 25 14 340 3 None Genome polyprotein 1 Barley yellow mosaic virus (isolate Germany)
Q89330 5.51e-12 73 24 13 353 3 None Genome polyprotein Zucchini yellow mosaic virus (strain Reunion Island)
Q01206 1.28e-11 72 26 16 345 3 None Genome polyprotein 1 Barley yellow mosaic virus (strain Japanese II-1)
P17765 1.54e-11 72 25 14 335 3 None Genome polyprotein Bean yellow mosaic virus
P89509 3.92e-11 71 25 11 341 1 None Genome polyprotein Turnip mosaic virus (strain Japanese)
Q65399 4.04e-11 70 25 13 332 2 None Genome polyprotein Bean common mosaic necrosis virus (strain NL-3)
P18247 5.3e-11 70 25 13 322 1 None Genome polyprotein Potato virus Y (strain N)
Q85197 7.44e-11 70 26 12 320 1 None Genome polyprotein Potato virus A
Q02597 1.08e-10 69 24 11 341 1 None Genome polyprotein Turnip mosaic virus (strain Quebec)
Q02963 1.09e-10 69 25 13 322 3 None Genome polyprotein Potato virus Y (strain Hungarian)
O72904 1.15e-10 68 23 12 349 3 NPH2 RNA helicase NPH-II Fowlpox virus (strain NVSL)
P18479 1.2e-10 69 24 13 353 1 None Genome polyprotein Zucchini yellow mosaic virus (strain California)
Q01901 1.52e-09 65 24 13 322 3 None Genome polyprotein Papaya ringspot virus (strain P / mutant HA)
O11436 3.86e-09 64 23 11 332 1 None Genome polyprotein Ryegrass mosaic virus (isolate Denmark/Danish)
P90245 9.57e-09 63 25 12 341 3 None Genome polyprotein 1 Barley mild mosaic virus (strain Na1)
P19712 4.87e-08 60 25 12 313 1 None Genome polyprotein Classical swine fever virus (strain Alfort/Tuebingen)
P21530 6.12e-08 60 24 11 314 1 None Genome polyprotein Classical swine fever virus (strain Brescia)
P04517 3.59e-07 58 23 11 319 1 None Genome polyprotein Tobacco etch virus
P89876 5.84e-07 57 25 15 343 3 None Genome polyprotein Lettuce mosaic virus (strain E)
Q96662 9.25e-07 56 23 10 313 1 None Genome polyprotein Bovine viral diarrhea virus (strain CP7)
P31999 1.06e-06 56 23 13 342 2 None Genome polyprotein Lettuce mosaic virus (strain 0 / isolate French)
P12927 1.22e-06 55 25 11 236 1 OPG084 RNA helicase NPH-II Vaccinia virus (strain Western Reserve)
A0A7H0DN56 1.3e-06 55 25 11 236 3 OPG084 RNA helicase NPH-II Monkeypox virus
Q01499 1.59e-06 55 23 9 313 1 None Genome polyprotein Bovine viral diarrhea virus (strain SD-1)
Q9JFC3 1.63e-06 55 25 11 236 2 OPG084 RNA helicase NPH-II Vaccinia virus (strain Tian Tan)
O56075 1.84e-06 55 23 13 328 3 None Genome polyprotein Peanut mottle virus (strain M)
P19711 2.74e-06 55 23 10 313 1 None Genome polyprotein Bovine viral diarrhea virus (isolate NADL)
P20502 3.05e-06 54 25 11 236 2 OPG084 RNA helicase NPH-II Vaccinia virus (strain Copenhagen)
O57193 3.1e-06 54 25 11 236 2 OPG084 RNA helicase NPH-II Vaccinia virus (strain Ankara)
P0DSU6 5.06e-06 53 25 11 236 2 OPG084 RNA helicase NPH-II Variola virus
Q3B8Q1 8.58e-06 53 22 11 345 2 Ddx21 Nucleolar RNA helicase 2 Rattus norvegicus
Q9JIK5 9.7e-06 53 22 14 418 1 Ddx21 Nucleolar RNA helicase 2 Mus musculus
P0DSU5 2.28e-05 52 24 11 236 2 OPG084 RNA helicase NPH-II Variola virus (isolate Human/India/Ind3/1967)
Q98218 5.22e-05 50 27 12 253 3 NPH2 RNA helicase NPH-II Molluscum contagiosum virus subtype 1
Q9SYP1 9.53e-05 50 24 7 221 1 BRR2A DExH-box ATP-dependent RNA helicase DExH12 Arabidopsis thaliana
P09814 0.000148 49 23 13 319 1 None Genome polyprotein Tobacco vein mottling virus
Q465R3 0.000456 47 26 6 188 3 hel308 ATP-dependent DNA helicase Hel308 Methanosarcina barkeri (strain Fusaro / DSM 804)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08545
Feature type CDS
Gene hrpB
Product ATP-dependent helicase HrpB
Location 24216 - 26666 (strand: -1)
Length 2451 (nucleotides) / 816 (amino acids)

Contig

Accession ZDB_365
Length 192330 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1311
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain
PF08482 ATP-dependent helicase C-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1643 Translation, ribosomal structure and biogenesis (J) J HrpA-like RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03579 ATP-dependent helicase HrpB [EC:3.6.4.13] - -

Protein Sequence

MTYSPVCNIYPALSTALKSAPQVLLQAPTGSGKSTILPLLMLKDESVTGRIIMLEPRRIAARSVAHRLASQLGERPGETVGYRMRGETRISAATRFEVVTEGILVRMLQQDPELSEVSIIILDEFHERNLQADLALALLLDVQSSLRDDLRLLVMSATLDNEQLLSLLPQAEVITAEGRAFPVERRYQPLSAHQPFISEVARAVLQLYQQEEGSVLVFLPGQAEICRLQEQLTGKTDADTLICPLYGALSLKEQQQAIEPPPPGMRKIVLATNIAETSLTIEGVTLVADSCLEKTAQFDPRSGLTRLVRSRISRSSMTQRAGRAGRLAPGICLHLCGQAEAERAAAHSEPEICHSDLAGLVLNLAQWGCREVSQLAWLDTPPAVAVQVAKKLLTEMGCLLPDGGLTAKGEAMAASGTEPRLSALWLYTLNEEPAQIYYAARLIAALEEPSREGNGNLLHDLTHPSARWNKRAHQLLQAAGLPVRKPSHDPDSGWLCRTLLQGFPDRIAGNRGRSGAFLLANGTGAVTDESSPLGNEPGLIAPLILQNDQQANARILKAVPFELSQLTEIAPHLLKTENRLTRDENKGSWQAWQAVTCGQLIIERKPLAAPSDEVVRDALLSWIREQGLSVLPFNEACEQLLIRQQLANDLFPEQPLPAADNDTLLAGLGSWLSPYLTGVRNQQQLAKLDLYGALRQRMDWSQQQWLDAQFPRHFEVPTGTRIPVEYAADKPPVMAVRIQEMYGVRETPVVAQGRLPVTISLLSPAHRPIQVTADLKAFWGGSYREVQKEMKGRYPKHFWPDDPANAQPTKRVKKFM

Flanking regions ( +/- flanking 50bp)

ATGCTACAATGTTGCGCGTCGAAAGTTAAGCAGATAATGATGAGGTTTTTGTGACATATTCCCCCGTTTGTAACATTTATCCGGCACTCAGTACGGCTCTGAAAAGTGCCCCGCAGGTGTTGTTACAGGCTCCGACCGGCAGCGGGAAATCCACTATTCTGCCGTTGCTGATGCTGAAAGACGAATCTGTCACCGGACGGATTATCATGCTGGAGCCCCGCCGTATCGCGGCCCGCAGCGTGGCGCACCGGCTGGCATCGCAGCTCGGGGAGCGTCCGGGGGAAACCGTGGGTTACCGGATGCGCGGTGAAACCAGGATCAGTGCAGCCACCCGGTTTGAGGTTGTTACAGAGGGAATTCTGGTCAGAATGTTACAGCAGGATCCGGAATTATCCGAAGTAAGCATCATTATTCTGGATGAATTCCACGAACGGAATTTACAGGCCGATCTCGCCCTTGCACTGCTGCTGGATGTGCAGTCCTCACTGCGTGATGATTTGCGTCTGCTGGTGATGTCCGCGACCTTAGATAATGAACAGCTGCTGTCCCTGCTGCCGCAGGCGGAGGTGATCACAGCGGAGGGACGGGCTTTCCCGGTGGAGAGACGGTATCAGCCGCTCAGTGCGCATCAGCCTTTTATCAGTGAGGTGGCCCGGGCGGTGTTACAGCTGTATCAGCAGGAGGAAGGCTCTGTGCTGGTGTTTCTGCCGGGACAGGCGGAAATCTGCCGGTTACAGGAGCAACTGACCGGTAAAACGGATGCGGATACCCTTATCTGCCCGCTGTACGGCGCACTTTCCCTGAAAGAACAGCAGCAGGCGATTGAACCGCCGCCGCCCGGTATGCGCAAAATCGTGCTGGCGACCAATATTGCCGAAACCAGTCTGACGATTGAAGGTGTGACACTGGTGGCGGACAGCTGCCTGGAGAAAACCGCACAGTTTGATCCGCGCAGCGGACTGACCAGGCTGGTGCGCAGCCGCATCAGCCGTTCATCGATGACACAGCGTGCCGGTCGCGCCGGACGTCTGGCGCCGGGGATCTGTCTGCATCTGTGCGGACAGGCGGAAGCCGAACGCGCTGCGGCTCACAGTGAGCCTGAAATCTGTCACAGTGATCTCGCCGGGCTGGTGCTGAACCTGGCGCAGTGGGGCTGCCGTGAGGTCTCACAGCTTGCCTGGCTTGATACCCCGCCTGCCGTGGCGGTACAGGTGGCGAAAAAACTACTGACAGAAATGGGTTGTCTTTTGCCTGACGGCGGACTGACCGCCAAAGGTGAGGCAATGGCCGCCTCCGGGACAGAGCCGCGCCTCTCTGCGTTGTGGCTTTATACCCTTAATGAAGAACCGGCACAGATATACTATGCCGCCCGGTTGATTGCCGCGCTGGAAGAGCCTTCCCGTGAGGGTAACGGCAATCTGCTGCATGATCTGACACATCCGTCCGCCCGGTGGAATAAGCGGGCGCACCAGCTGTTGCAGGCCGCCGGTCTGCCGGTCAGAAAACCGTCTCATGATCCGGACAGCGGCTGGCTGTGCCGTACCTTATTACAGGGCTTTCCGGACAGAATCGCCGGTAATCGCGGGCGCTCCGGTGCGTTTCTGCTGGCAAACGGCACCGGCGCGGTTACGGATGAAAGTAGTCCGCTGGGTAATGAGCCCGGACTTATCGCCCCGCTGATCCTGCAAAATGATCAGCAGGCCAATGCACGGATCCTGAAAGCGGTGCCGTTTGAGTTATCACAACTGACAGAAATAGCACCGCACCTGCTGAAAACAGAAAACCGCCTGACCCGTGATGAAAACAAAGGCAGCTGGCAGGCGTGGCAGGCGGTCACCTGCGGGCAGCTGATTATTGAGCGGAAACCGCTGGCGGCACCGTCTGATGAGGTTGTCCGCGATGCGCTGCTCAGTTGGATCCGCGAACAGGGTCTCTCTGTTCTGCCATTCAATGAAGCCTGTGAGCAGTTACTTATCCGCCAGCAGCTGGCAAATGATCTGTTTCCGGAACAGCCGCTGCCGGCGGCGGATAATGATACACTGCTTGCCGGGCTGGGATCCTGGCTGTCGCCGTATCTGACCGGTGTGCGCAATCAGCAGCAGTTGGCAAAGCTGGATTTATACGGCGCGCTGCGTCAGCGGATGGACTGGTCGCAGCAGCAATGGCTTGATGCACAATTCCCGCGTCATTTTGAAGTACCCACCGGCACCCGGATCCCTGTAGAATATGCGGCGGATAAACCGCCGGTGATGGCAGTCCGCATTCAGGAGATGTATGGTGTGCGTGAAACGCCGGTGGTGGCGCAGGGACGGCTGCCGGTGACGATCAGTCTGTTATCCCCCGCACACCGCCCGATACAGGTTACTGCCGACCTGAAAGCCTTCTGGGGCGGGAGCTACCGGGAGGTACAGAAAGAGATGAAAGGGCGCTATCCCAAACATTTCTGGCCGGACGATCCGGCAAATGCACAGCCGACAAAGCGTGTAAAAAAGTTTATGTAAATGCAAAGATAGTCTTTGTTTAACGGATTTTTACTGTGTCTGTTGCCGGA