Homologs in group_1073

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06085 FBDBKF_06085 100.0 Morganella morganii S1 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
EHELCC_09130 EHELCC_09130 100.0 Morganella morganii S2 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
NLDBIP_09510 NLDBIP_09510 100.0 Morganella morganii S4 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
HKOGLL_07795 HKOGLL_07795 100.0 Morganella morganii S5 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
F4V73_RS15825 F4V73_RS15825 92.3 Morganella psychrotolerans rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
PMI_RS11355 PMI_RS11355 78.6 Proteus mirabilis HI4320 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM

Distribution of the homologs in the orthogroup group_1073

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1073

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6QNZ6 0.0 631 80 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus sp. (strain Az29)
C7BKL0 0.0 625 79 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus asymbiotica subsp. asymbiotica (strain ATCC 43949 / 3105-77)
Q7N8R4 0.0 622 79 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4F2E7 0.0 616 78 0 365 3 rlmM Ribosomal RNA large subunit methyltransferase M Proteus mirabilis (strain HI4320)
B1JQE8 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667H7 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLA5 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis (strain Pestoides F)
Q1CFD2 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH78 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis
B2JZ47 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CAQ2 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFF7 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9R2P6 0.0 595 77 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Angola)
A8GIF9 0.0 590 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Serratia proteamaculans (strain 568)
C5BHA4 0.0 590 76 1 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Edwardsiella ictaluri (strain 93-146)
A1JPA5 0.0 587 76 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6CC07 0.0 586 76 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Musicola paradisiaca (strain Ech703)
A4WDY6 0.0 584 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Enterobacter sp. (strain 638)
B1LR00 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SMS-3-5 / SECEC)
B6I6K4 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SE11)
B7N740 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ADR6 0.0 583 74 0 363 1 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12)
B1IU35 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3U1 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O9:H4 (strain HS)
B1XDL5 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / DH10B)
C4ZZW1 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / MC4100 / BW2952)
C6UCT5 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / REL606)
C5W8B2 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / BL21-DE3)
B7LXM2 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O8 (strain IAI1)
B7NVV4 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O7:K1 (strain IAI39 / ExPEC)
C6USC2 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5Z4C6 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ADR7 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7
B7LEY3 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain 55989 / EAEC)
A7ZQQ1 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31XI5 0.0 583 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 4 (strain Sb227)
A7MR02 0.0 583 73 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Cronobacter sakazakii (strain ATCC BAA-894)
C6CEU3 0.0 582 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Dickeya chrysanthemi (strain Ech1591)
Q83JW6 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri
Q0T154 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri serotype 5b (strain 8401)
B2TZC9 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R7N4 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain UTI89 / UPEC)
Q8FEE5 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AEZ3 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O1:K1 / APEC
B7MYV7 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O81 (strain ED1a)
B7MLC7 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHM2 0.0 582 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TE53 0.0 581 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LVW4 0.0 581 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32CB2 0.0 580 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella dysenteriae serotype 1 (strain Sd197)
B5XUY0 0.0 580 73 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae (strain 342)
Q3YY51 0.0 580 74 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella sonnei (strain Ss046)
A6TD87 0.0 580 73 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C6DAH1 0.0 578 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AP21 0.0 578 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D8F7 0.0 575 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5RDV8 0.0 571 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7CPW1 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFI3 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhi
B4TUK1 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella schwarzengrund (strain CVM19633)
C0PXG9 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi C (strain RKS4594)
A9N2J6 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T4X5 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella newport (strain SL254)
B5QWR4 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella enteritidis PT4 (strain P125109)
B5FTY5 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella dublin (strain CT_02021853)
Q57KD6 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella choleraesuis (strain SC-B67)
B5BF35 0.0 569 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain AKU_12601)
Q5PEK5 0.0 569 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TGN7 0.0 569 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella heidelberg (strain SL476)
B5F4S7 0.0 568 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella agona (strain SL483)
A9MSA2 0.0 565 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VFX4 0.0 547 70 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NRJ6 0.0 527 67 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Sodalis glossinidius (strain morsitans)
B6EGG2 1.12e-177 500 64 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio salmonicida (strain LFI1238)
Q6LN05 2.51e-176 497 65 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Photobacterium profundum (strain SS9)
Q5E7A8 2.62e-176 496 65 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FAT6 8.26e-176 495 65 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain MJ11)
A7N1H7 3.93e-174 491 65 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio campbellii (strain ATCC BAA-1116)
Q8DFB2 4.95e-174 491 65 1 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain CMCP6)
B7VJ92 5.23e-174 491 63 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio atlanticus (strain LGP32)
Q7MN36 8.42e-173 488 65 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain YJ016)
Q87RT2 3.18e-171 484 65 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1RLU3 1.78e-164 467 62 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain W3-18-1)
A9KTM5 3.44e-164 466 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS195)
A6WL14 3.44e-164 466 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS185)
A3D2C2 4.23e-164 466 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAT7 4.23e-164 466 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS223)
A4Y4Y0 1.16e-163 464 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A5UIV9 2.04e-162 461 61 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittGG)
Q0HGM5 4.66e-162 461 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-4)
Q0HSX8 4.92e-162 461 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-7)
A3N049 6.22e-162 460 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P45100 1.98e-161 459 61 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLA4 2.42e-161 459 61 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain 86-028NP)
A0KZ99 2.65e-161 459 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain ANA-3)
B0BNW7 4.11e-161 458 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1B0 4.11e-161 458 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A8H6W1 2.72e-160 456 62 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QGM9 4.73e-160 456 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5UCR5 5.69e-160 455 61 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittEE)
Q8EGQ9 6.25e-160 455 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TPH1 7.67e-160 455 62 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella halifaxensis (strain HAW-EB4)
A1S8C4 2.48e-159 454 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KQX8 4.3e-159 453 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella woodyi (strain ATCC 51908 / MS32)
Q7VLM7 4.03e-157 448 60 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4SQK6 1.01e-155 445 61 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas salmonicida (strain A449)
A0KHE0 1.95e-155 444 60 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6VQ01 1.4e-154 442 59 4 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CN71 1.94e-154 441 59 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Pasteurella multocida (strain Pm70)
A8FYK0 2.52e-154 441 58 3 365 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sediminis (strain HAW-EB3)
Q12L35 2.81e-153 439 58 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C4L9Y9 3.64e-153 438 59 2 367 3 rlmM Ribosomal RNA large subunit methyltransferase M Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q65U59 9.01e-151 432 59 4 361 3 rlmM Ribosomal RNA large subunit methyltransferase M Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C6ANQ9 1.26e-150 432 58 3 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Aggregatibacter aphrophilus (strain NJ8700)
Q07ZE4 1.05e-149 429 57 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella frigidimarina (strain NCIMB 400)
Q0I256 1.21e-148 427 57 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 129Pt)
B0UVZ4 5.3e-148 425 57 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 2336)
A1SV95 1.17e-144 417 53 2 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q3IKB2 2.83e-140 405 53 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas translucida (strain TAC 125)
Q15TS0 7.26e-138 399 54 3 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QW15 2.28e-135 393 54 3 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q47YA5 7.11e-128 374 50 2 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88L23 1.19e-117 348 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KGD7 1.19e-117 348 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain GB-1)
A5W6J0 2.34e-117 347 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1I7B1 4.49e-117 346 50 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas entomophila (strain L48)
Q4KFD4 7.43e-117 346 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q884S1 1.94e-116 345 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZQY7 2.14e-116 345 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. syringae (strain B728a)
C1DEM7 1.14e-115 342 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C3K5G4 1.2e-115 343 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain SBW25)
B1J5D5 1.58e-115 342 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain W619)
Q48GK0 1.31e-114 340 48 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XTK0 1.7e-114 339 48 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas mendocina (strain ymp)
Q3K9C8 2.72e-114 339 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain Pf0-1)
A4VKM0 3.22e-114 338 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Stutzerimonas stutzeri (strain A1501)
Q02K46 6.2e-110 328 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain UCBPP-PA14)
B3PKB3 1e-109 327 45 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Cellvibrio japonicus (strain Ueda107)
Q9I3F4 1.34e-109 327 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVG0 1.34e-109 327 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain LESB58)
A6V7T6 2.91e-109 326 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain PA7)
Q1QUU9 1.66e-108 324 46 2 347 3 rlmM Ribosomal RNA large subunit methyltransferase M Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B4RSU6 3.47e-108 324 43 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q60CL4 1.12e-103 312 46 3 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A6VWM5 1.94e-103 311 44 4 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinomonas sp. (strain MWYL1)
Q8PNZ9 2.45e-100 303 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas axonopodis pv. citri (strain 306)
B2SPV7 8.91e-100 302 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZK8 1.07e-99 301 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5GWE6 1.69e-99 301 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
C4ZJM0 2.88e-99 301 43 3 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Thauera aminoaromatica
Q3BX58 6.94e-99 300 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PCB8 8.63e-99 299 44 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RUG0 8.63e-99 299 44 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain B100)
Q4UR65 8.63e-99 299 44 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain 8004)
A1K471 3.69e-97 296 43 4 347 3 rlmM Ribosomal RNA large subunit methyltransferase M Azoarcus sp. (strain BH72)
Q21LL4 3.65e-96 293 44 4 345 3 rlmM Ribosomal RNA large subunit methyltransferase M Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5P1Y4 1.4e-94 289 44 4 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1U1J4 7.13e-94 287 42 6 364 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B2FPH5 4.16e-91 280 44 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain K279a)
B4SK51 1.59e-90 278 43 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain R551-3)
C5BR43 1.14e-89 276 42 5 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Teredinibacter turnerae (strain ATCC 39867 / T7901)
B0U5D5 2.65e-89 275 41 4 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M12)
Q9PFD0 2.96e-89 275 42 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain 9a5c)
Q87AC0 5.97e-87 269 41 4 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9N9 5.97e-87 269 41 4 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M23)
Q0A8J8 2.52e-82 258 42 6 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
C1DB52 2.06e-76 242 38 7 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Laribacter hongkongensis (strain HLHK9)
A1WXL3 7.7e-76 240 39 10 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Halorhodospira halophila (strain DSM 244 / SL1)
Q2SJS1 1.7e-75 241 36 4 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Hahella chejuensis (strain KCTC 2396)
Q0VP88 4.77e-64 210 39 9 348 3 rlmM Ribosomal RNA large subunit methyltransferase M Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08245
Feature type CDS
Gene rlmM
Product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
Location 174024 - 175121 (strand: 1)
Length 1098 (nucleotides) / 365 (amino acids)

Contig

Accession ZDB_364
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1073
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01728 FtsJ-like methyltransferase
PF18125 RlmM ferredoxin-like domain
PF21239 Ribosomal RNA large subunit methyltransferase M, N-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2933 Translation, ribosomal structure and biogenesis (J) J 23S rRNA C2498 (ribose-2'-O)-methylase RlmM

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06968 23S rRNA (cytidine2498-2'-O)-methyltransferase [EC:2.1.1.186] - -

Protein Sequence

MNKIALYCRPGFEKECAAEITDKAGRLEIFGFPRVKENSGYVIFECYQPDDADRIAKEIPFKELIFARQMIVVGELLKNLPENDRISPIMGMLTGVVERAGDLRVEVPDTNEAKELMKFCRKFTVPLRSALRQEKLLLAKENRGRPVIHVFFIAPGCCYVGYSYSNNNSAFYMGIPRLKFPSDAPSRSTLKLEEAFHMFIPYDEWEERLEGGLQAVDLGACPGGWTYQLVKHSMRVQAVDNGPMAESLMETGQVRHLREDGFKFVPTSKNITWLVCDMVEKPAKVAALMTTWMVNGWCRETIFNLKLPMKKRYEEVSHILEKMAAEMKEQGVNALIHAKHLYHDREEITVHVQRVWGAYNPDRVF

Flanking regions ( +/- flanking 50bp)

GTTTTGTGTATTGATTGGCGCGCTGCGTCTAAGGAAAGTGGCTTCCGGCCATGAATAAAATAGCATTATATTGCCGTCCGGGTTTTGAAAAAGAGTGTGCAGCTGAGATCACGGATAAAGCCGGGCGTCTTGAGATTTTTGGTTTCCCGCGGGTGAAAGAGAACAGCGGTTATGTCATTTTTGAATGCTATCAGCCGGATGATGCCGATCGCATTGCAAAAGAGATCCCGTTTAAAGAACTGATTTTTGCCCGTCAGATGATAGTTGTCGGCGAACTGCTGAAAAACTTACCCGAAAATGACCGGATTTCGCCGATCATGGGGATGCTGACCGGCGTGGTGGAGCGTGCGGGTGATCTGCGCGTCGAAGTGCCTGACACCAACGAAGCCAAAGAGCTGATGAAGTTCTGCCGTAAATTCACGGTACCGCTGCGTTCGGCACTGCGTCAGGAAAAACTGCTGCTGGCAAAAGAGAACCGGGGCCGTCCGGTCATTCACGTTTTCTTTATCGCGCCGGGCTGTTGCTATGTCGGTTATTCTTACTCGAATAATAACTCTGCGTTCTACATGGGGATCCCGCGTCTGAAGTTCCCGTCAGATGCACCGAGCCGCTCCACCCTCAAGCTGGAAGAAGCATTTCATATGTTTATTCCGTACGACGAATGGGAAGAGCGTCTGGAAGGCGGATTACAGGCGGTGGACCTGGGGGCATGCCCGGGCGGCTGGACGTATCAGCTGGTGAAACACAGTATGCGTGTTCAGGCCGTGGATAACGGCCCGATGGCCGAAAGTCTGATGGAAACCGGTCAGGTTCGTCATCTCCGTGAGGACGGCTTTAAGTTCGTGCCGACATCCAAAAATATTACCTGGCTGGTCTGCGACATGGTGGAAAAACCGGCGAAAGTGGCCGCGCTGATGACCACCTGGATGGTTAACGGCTGGTGCCGCGAGACGATTTTCAACCTCAAACTGCCGATGAAAAAGCGCTATGAAGAGGTATCTCATATCCTCGAAAAAATGGCTGCTGAAATGAAAGAGCAGGGCGTGAATGCGCTGATCCACGCGAAACATCTGTATCATGACCGTGAGGAAATTACGGTGCATGTCCAGCGGGTGTGGGGTGCATATAACCCGGATCGGGTCTTCTGATGAAAAATCCCGGCAATGATTGCCGGGATTTTTTTTGTATCACTTCACTT