Homologs in group_1127

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06435 FBDBKF_06435 100.0 Morganella morganii S1 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
EHELCC_09480 EHELCC_09480 100.0 Morganella morganii S2 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
NLDBIP_09860 NLDBIP_09860 100.0 Morganella morganii S4 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
HKOGLL_07445 HKOGLL_07445 100.0 Morganella morganii S5 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
F4V73_RS15490 F4V73_RS15490 95.3 Morganella psychrotolerans ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
PMI_RS00090 PMI_RS00090 86.7 Proteus mirabilis HI4320 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase

Distribution of the homologs in the orthogroup group_1127

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1127

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2T8 0.0 575 86 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Proteus mirabilis (strain HI4320)
Q7N8W9 0.0 572 86 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJE4 0.0 558 84 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8G9L7 0.0 558 84 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Serratia proteamaculans (strain 568)
B1JKZ5 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ES1 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQF0 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pestis (strain Pestoides F)
Q1CMU8 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R005 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pestis bv. Antiqua (strain Angola)
P58680 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pestis
B2K3M9 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0J0 0.0 557 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMD4 0.0 555 83 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5B7M7 0.0 545 81 0 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Edwardsiella ictaluri (strain 93-146)
Q2NVY3 0.0 540 82 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Sodalis glossinidius (strain morsitans)
A7MIM0 0.0 540 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cronobacter sakazakii (strain ATCC BAA-894)
A6T4G3 0.0 539 82 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y232 0.0 539 82 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Klebsiella pneumoniae (strain 342)
B2VH04 0.0 539 82 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1IRE6 0.0 537 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZVX7 0.0 537 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O9:H4 (strain HS)
B7M0C5 0.0 537 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O8 (strain IAI1)
Q3Z5Y1 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella sonnei (strain Ss046)
Q7UDT8 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella flexneri
Q0T8G5 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella flexneri serotype 5b (strain 8401)
Q32K68 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella dysenteriae serotype 1 (strain Sd197)
Q326J4 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella boydii serotype 4 (strain Sb227)
B2U248 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LVN5 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LFV9 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain SMS-3-5 / SECEC)
B6HYX7 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain SE11)
B7N7Q3 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P62623 0.0 536 81 1 316 1 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain K12)
P62624 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1XBF4 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain K12 / DH10B)
C4ZPV5 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NHD3 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YYC1 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P62625 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O157:H7
B7L4F1 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain 55989 / EAEC)
A7ZHB8 0.0 536 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
P58678 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella typhi
B4TWP0 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella schwarzengrund (strain CVM19633)
C0Q4I9 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella paratyphi C (strain RKS4594)
A9MR43 0.0 535 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q1RGH3 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli (strain UTI89 / UPEC)
A1A777 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O1:K1 / APEC
B7MNN4 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O81 (strain ED1a)
B7MAE9 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI74 0.0 535 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4TIE9 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella heidelberg (strain SL476)
B5RG84 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1N9 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella enteritidis PT4 (strain P125109)
B5FHE3 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella dublin (strain CT_02021853)
Q57TL2 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella choleraesuis (strain SC-B67)
B5F728 0.0 534 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella agona (strain SL483)
A4W6E4 0.0 534 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Enterobacter sp. (strain 638)
P58679 0.0 533 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BLL3 0.0 533 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella paratyphi A (strain AKU_12601)
A9MYG8 0.0 533 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKI4 0.0 533 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6H5 0.0 533 80 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Salmonella newport (strain SL254)
A8ALT3 0.0 531 81 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D0C6 0.0 526 79 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DF01 0.0 524 79 1 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C4K4R2 5.43e-179 500 74 0 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q65RQ4 7e-178 497 75 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57960 1.14e-176 494 74 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pasteurella multocida (strain Pm70)
Q0TLW2 1.87e-175 491 80 1 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A6VQH8 8.3e-175 489 72 1 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UV08 2.71e-169 475 72 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Histophilus somni (strain 2336)
Q4QLQ5 2.89e-168 473 72 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Haemophilus influenzae (strain 86-028NP)
A5UD69 9.95e-168 471 71 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Haemophilus influenzae (strain PittEE)
A5UID9 1.31e-167 471 71 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Haemophilus influenzae (strain PittGG)
A0KG42 3.78e-166 467 72 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P44976 1.89e-165 465 71 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0BRB3 3.23e-165 465 71 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GYK1 3.23e-165 465 71 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2G8 4.64e-165 464 71 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A4SIX8 2.06e-164 462 71 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aeromonas salmonicida (strain A449)
Q5QZR7 5.75e-164 461 71 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B8F6E6 7.57e-164 461 70 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Glaesserella parasuis serovar 5 (strain SH0165)
Q7VPK4 4.13e-163 459 71 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q1LSS7 9.57e-163 458 69 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q3IE99 2.98e-161 454 69 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudoalteromonas translucida (strain TAC 125)
B6ENC7 2.17e-160 452 68 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aliivibrio salmonicida (strain LFI1238)
Q9KU44 2.71e-160 452 69 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FA63 3.67e-160 452 68 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aliivibrio fischeri (strain MJ11)
Q5E7N1 4.93e-160 451 68 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LUK8 1.68e-159 450 67 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Photobacterium profundum (strain SS9)
Q8EBI7 7.45e-159 449 67 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TJB2 6.34e-158 446 66 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shewanella halifaxensis (strain HAW-EB4)
A1SZP0 8.07e-157 443 67 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1TYZ2 3.15e-156 442 67 2 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A8H1H6 4.64e-156 441 66 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q1R0B2 2.92e-155 439 68 2 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2S9U2 4.42e-155 439 67 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Hahella chejuensis (strain KCTC 2396)
Q88Q89 5.02e-155 439 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KM87 5.02e-155 439 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas putida (strain GB-1)
Q7MNM5 5.55e-155 439 69 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Vibrio vulnificus (strain YJ016)
Q8DET0 5.55e-155 439 69 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Vibrio vulnificus (strain CMCP6)
B0V8K4 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain AYE)
A3M9H2 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VQ53 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain SDF)
B2HZW3 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain ACICU)
B7IAU0 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain AB0057)
B7GVR1 6.91e-155 439 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baumannii (strain AB307-0294)
A5VY55 9.26e-155 438 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JF80 1.62e-154 437 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas putida (strain W619)
Q486R1 5.73e-154 436 67 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q48NK3 7.66e-154 436 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZYJ1 9.02e-154 436 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas syringae pv. syringae (strain B728a)
Q9RBJ0 9.77e-154 436 65 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4K5U7 2.17e-153 435 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q889E1 6.99e-153 434 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C3KDX7 2.02e-152 432 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas fluorescens (strain SBW25)
Q607E5 5.87e-152 431 64 1 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q3K6L8 8.36e-152 431 67 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas fluorescens (strain Pf0-1)
Q15R07 1.56e-151 430 66 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87S87 1.87e-151 430 68 3 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1I4S8 1.95e-151 430 67 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas entomophila (strain L48)
Q0VSD8 6.49e-151 428 67 2 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q3BW40 2.16e-150 427 67 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PN17 2.88e-150 427 67 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas axonopodis pv. citri (strain 306)
Q5H2D9 3.47e-150 427 67 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STC6 3.47e-150 427 67 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P5A8 3.47e-150 427 67 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4XQV8 9.04e-150 426 66 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas mendocina (strain ymp)
B4SP20 1.46e-148 422 66 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Stenotrophomonas maltophilia (strain R551-3)
Q02GC0 1.04e-147 420 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0A0 1.04e-147 420 68 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas aeruginosa (strain LESB58)
B0RY26 1.08e-147 421 66 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas campestris pv. campestris (strain B100)
Q4US42 1.08e-147 421 66 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas campestris pv. campestris (strain 8004)
B2FU83 1.28e-147 420 66 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Stenotrophomonas maltophilia (strain K279a)
Q21HK6 1.39e-147 420 65 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8PBG4 4.31e-147 419 66 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9HVM7 7.01e-147 418 67 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P65194 3.33e-146 417 63 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P65193 3.33e-146 417 63 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xylella fastidiosa (strain 9a5c)
B2I6V0 3.33e-146 417 63 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xylella fastidiosa (strain M23)
B0U3Q7 4.15e-146 416 63 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Xylella fastidiosa (strain M12)
C1DPH8 5.62e-146 416 66 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C4LD10 8.14e-146 416 63 1 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1Q974 2.51e-143 409 62 2 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q82WM1 3.1e-142 407 61 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A5WCZ2 9.52e-141 403 61 2 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Psychrobacter sp. (strain PRwf-1)
Q4FQY8 1.57e-140 402 61 2 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B8GQR4 2.57e-137 394 59 2 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q5P224 3.16e-136 391 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7W9B4 4.22e-136 391 63 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7VYS2 5.78e-136 391 63 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q47BK8 6.2e-136 390 60 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dechloromonas aromatica (strain RCB)
Q7WHF2 7.21e-136 391 63 2 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1K4R4 5.78e-135 388 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Azoarcus sp. (strain BH72)
Q493S1 1.58e-134 387 58 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Blochmanniella pennsylvanica (strain BPEN)
Q62HM8 5.49e-133 384 60 2 307 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Burkholderia mallei (strain ATCC 23344)
Q63WH0 5.49e-133 384 60 2 307 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Burkholderia pseudomallei (strain K96243)
A9M1J9 9.31e-133 383 61 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria meningitidis serogroup C (strain 053442)
Q7NS59 1.02e-132 382 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8D2R2 1.85e-132 382 55 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wigglesworthia glossinidia brevipalpis
B5ERJ7 1.82e-131 379 61 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JBD6 1.82e-131 379 61 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
P58677 1.89e-131 379 57 2 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1KS64 5.49e-131 378 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P65192 5.49e-131 378 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P65191 5.49e-131 378 60 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q12EY5 8.96e-130 375 58 2 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B4RPZ2 1.16e-128 372 59 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria gonorrhoeae (strain NCCP11945)
Q5FAF2 1.16e-128 372 59 2 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1AXS1 6.03e-127 367 58 2 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ruthia magnifica subsp. Calyptogena magnifica
B8D752 2.39e-126 366 56 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57247 2.39e-126 366 56 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8U8 2.39e-126 366 56 2 316 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A2SJA8 1.57e-125 365 58 2 304 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5CVK1 6.5e-125 362 57 2 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q0BNK1 7.69e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A587 7.69e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. holarctica (strain LVS)
A7NA22 7.69e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4IYW2 8.22e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGK4 8.22e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SES8 8.22e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14I06 8.22e-125 362 53 1 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q4T9 3.45e-123 358 53 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella tularensis subsp. novicida (strain U112)
B4R8T7 7.44e-123 357 54 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Phenylobacterium zucineum (strain HLK1)
Q89QW7 1.52e-122 356 56 2 309 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8K9Z4 2.66e-122 356 53 2 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B0U064 9.95e-122 355 53 2 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5NP61 5.03e-120 351 55 2 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q6N3G0 1.42e-119 348 56 2 307 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9FBM1 1.2e-116 342 53 3 315 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82IE8 3.65e-116 341 53 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
I1WW99 5.9e-116 340 54 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Burkholderia pseudomallei (strain 1026b)
P0DMK8 5.9e-116 340 54 2 309 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Burkholderia pseudomallei (strain K96243)
Q629Z7 5.9e-116 340 54 2 309 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Burkholderia mallei (strain ATCC 23344)
B1W2D7 4.87e-115 338 53 3 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q16AJ6 8.3e-115 337 54 5 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A0LD71 1.6e-114 336 53 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9A345 4.32e-113 333 53 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q0BYQ0 8.2e-113 332 54 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Hyphomonas neptunium (strain ATCC 15444)
A8LLC7 1.6e-112 331 52 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1GDG5 2.58e-112 331 53 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ruegeria sp. (strain TM1040)
B2IED0 8.14e-112 330 54 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q5YQ94 5.08e-111 328 52 4 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nocardia farcinica (strain IFM 10152)
Q6N1Y1 6.83e-111 327 51 4 317 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q89UU5 6.99e-111 327 51 4 313 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0A5I3 7.42e-111 327 51 3 314 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WKF9 7.42e-111 327 51 3 314 1 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKF8 7.42e-111 327 51 3 314 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A3PGE9 2.27e-110 326 53 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A1B842 8.19e-110 324 52 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Paracoccus denitrificans (strain Pd 1222)
Q8NRM2 1.33e-109 324 51 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QCY9 1.33e-109 324 51 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Corynebacterium glutamicum (strain R)
Q5LNJ7 3.07e-109 323 53 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5FUH7 3.45e-109 323 52 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Gluconobacter oxydans (strain 621H)
Q0S489 3.77e-109 323 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhodococcus jostii (strain RHA1)
A0LW20 4.3e-109 323 50 3 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q73FQ1 5.38e-109 322 53 5 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wolbachia pipientis wMel
C1AYI4 8.73e-109 322 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhodococcus opacus (strain B4)
A1TE06 1.21e-108 322 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q73WH6 3.4e-108 321 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
C0R4T5 3.67e-108 320 52 5 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A4T986 4.05e-108 321 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycolicibacterium gilvum (strain PYR-GCK)
Q1B4H4 4.67e-108 320 50 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycobacterium sp. (strain MCS)
A1UKL5 4.67e-108 320 50 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycobacterium sp. (strain KMS)
A3Q4N0 9.08e-108 320 50 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycobacterium sp. (strain JLS)
A0PKQ3 4.51e-107 318 51 4 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycobacterium ulcerans (strain Agy99)
B8EQB9 6.42e-107 317 51 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q8FQP0 8.86e-107 317 52 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P9WKG1 9.16e-107 317 51 3 310 1 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKG0 9.16e-107 317 51 3 310 3 ispH2 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5I1 9.16e-107 317 51 3 310 3 ispH1 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B3CM01 3.38e-106 315 50 5 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
C1A2V7 4.17e-106 316 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q5FFL5 1.08e-105 314 50 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ehrlichia ruminantium (strain Gardel)
Q5HB13 2.18e-105 313 50 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Ehrlichia ruminantium (strain Welgevonden)
Q5PAE7 2.74e-105 314 49 3 307 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Anaplasma marginale (strain St. Maries)
B9KIX9 3.49e-105 313 49 3 307 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Anaplasma marginale (strain Florida)
Q5GTN6 5.11e-105 312 50 5 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q9X781 7.47e-105 312 51 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mycobacterium leprae (strain TN)
Q57EP6 1.3e-104 312 51 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brucella abortus biovar 1 (strain 9-941)
B2S9W9 1.3e-104 312 51 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brucella abortus (strain S19)
Q8G257 1.35e-104 312 51 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brucella suis biovar 1 (strain 1330)
Q6AA89 1.37e-104 311 51 4 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q8YFR1 1.42e-104 312 51 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6NI36 3.79e-104 310 50 4 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6ADV0 4.32e-104 310 52 4 313 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Leifsonia xyli subsp. xyli (strain CTCB07)
Q3J5X0 1.63e-103 308 53 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A6WWG6 3.19e-103 309 51 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P58673 5.05e-103 308 53 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92RG2 5.69e-103 308 52 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhizobium meliloti (strain 1021)
Q6G4C5 9.72e-103 307 52 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B9JAQ2 5.49e-102 305 52 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q6MC97 6.05e-102 304 50 2 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Protochlamydia amoebophila (strain UWE25)
A9IQQ9 3.3e-101 304 50 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6AL80 5.29e-101 302 49 3 304 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A4WVQ4 8.18e-101 301 52 3 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B3PSB9 1.91e-100 301 50 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhizobium etli (strain CIAT 652)
Q985W3 2.32e-100 301 53 4 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1MKH8 4.93e-100 300 50 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7ULU1 5.88e-100 299 50 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q83MR9 9.49e-100 299 49 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Tropheryma whipplei (strain Twist)
A1URX2 1.11e-99 300 50 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6G0C9 1.2e-99 299 51 4 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bartonella quintana (strain Toulouse)
B5ZSV9 1.29e-99 299 50 4 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q83NB2 1.67e-99 298 48 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Tropheryma whipplei (strain TW08/27)
Q11KC7 1.53e-94 286 51 4 285 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chelativorans sp. (strain BNC1)
Q822D9 5.57e-94 284 49 4 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5L5D3 3.51e-93 282 49 4 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia abortus (strain DSM 27085 / S26/3)
Q255J4 1.29e-92 280 48 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia felis (strain Fe/C-56)
Q8G4L8 7.86e-92 280 46 8 327 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bifidobacterium longum (strain NCC 2705)
B0B991 9.01e-91 275 47 3 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B0BAX0 1.16e-90 275 47 3 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
O84867 1.69e-90 275 47 3 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKH8 1.95e-90 275 47 3 309 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q9Z6P2 2.02e-89 272 47 5 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia pneumoniae
Q9PL59 4.06e-88 269 45 3 310 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlamydia muridarum (strain MoPn / Nigg)
P21864 1.23e-87 263 71 2 181 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (Fragment) Pseudomonas fluorescens
Q2GDX3 2.37e-87 266 43 6 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q8F3I3 4.58e-84 259 45 6 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72S57 4.58e-84 259 45 6 311 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8I295 1.67e-76 246 42 4 315 1 LytB 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, apicoplast Plasmodium falciparum (isolate 3D7)
Q72G65 2e-72 230 43 10 329 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SMC8 4.64e-72 229 43 10 329 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9RSG0 2e-71 227 44 11 325 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q67QZ8 8.17e-61 198 39 6 297 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B1HTG5 3.48e-56 187 38 7 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Lysinibacillus sphaericus (strain C3-41)
B7GH78 1.44e-55 186 36 7 294 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A7Z6T1 6.6e-54 181 36 9 305 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q89AV1 2.65e-53 177 37 2 215 5 ispH Putative 4-hydroxy-3-methylbut-2-enyl diphosphate reductase homolog Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P54473 4.79e-53 179 36 8 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus subtilis (strain 168)
A4IR05 6.54e-53 179 35 8 303 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacillus thermodenitrificans (strain NG80-2)
Q9KD37 8.91e-53 178 36 9 294 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5WHC6 4.59e-52 176 33 8 320 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Shouchella clausii (strain KSM-K16)
O67625 8.14e-52 175 34 5 286 1 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Aquifex aeolicus (strain VF5)
Q5KX24 1.37e-51 175 35 8 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacillus kaustophilus (strain HTA426)
A8FFA1 1.57e-51 175 35 7 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus pumilus (strain SAFR-032)
Q65H97 2.86e-51 174 35 8 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7GSY4 4.65e-51 174 36 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
C5D4R3 6.9e-51 174 35 9 299 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacillus sp. (strain WCH70)
B7HCR2 1.09e-49 171 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain B4264)
B7JN13 1.12e-49 170 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain AH820)
A9VHR7 2.23e-49 169 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus mycoides (strain KBAB4)
B7IYD9 2.35e-49 169 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain G9842)
C0ZL73 4.75e-49 169 35 7 294 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C1ESI2 4.92e-49 169 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain 03BB102)
Q6HDN0 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634Q0 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain ZK / E33L)
B9IY56 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain Q1)
B7HPI8 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain AH187)
Q730P8 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81LU9 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus anthracis
C3LKW7 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8J4 7.86e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus anthracis (strain A0248)
A0RIR1 8.75e-49 168 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacillus thuringiensis (strain Al Hakam)
Q187C6 5.38e-48 165 30 4 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridioides difficile (strain 630)
B5E9S9 5.43e-47 162 33 5 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6E2B3 5.6e-47 162 33 5 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacter sp. (strain M21)
A5GE10 7.76e-47 162 33 6 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geotalea uraniireducens (strain Rf4)
B9E6U8 1.21e-46 162 35 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Macrococcus caseolyticus (strain JCSC5402)
Q71ZL9 7.35e-46 161 34 9 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Listeria monocytogenes serotype 4b (strain F2365)
C1KV98 7.35e-46 161 34 9 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Listeria monocytogenes serotype 4b (strain CLIP80459)
P58676 3.46e-45 159 33 9 317 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C4L3Z5 4.49e-45 158 32 7 301 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B9LZG4 4.63e-45 157 33 6 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q8RA76 2.46e-44 155 34 8 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q39XB6 4.11e-44 155 34 6 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1ANP9 6.17e-44 154 34 8 288 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B1YL84 8.19e-44 155 33 8 301 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A0RQC4 9.92e-44 154 32 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter fetus subsp. fetus (strain 82-40)
B0K197 3.59e-43 152 31 6 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermoanaerobacter sp. (strain X514)
B0K9L0 3.59e-43 152 31 6 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B3E441 5.59e-43 152 33 8 288 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A8MFE2 9.58e-43 151 31 8 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Alkaliphilus oremlandii (strain OhILAs)
Q0STT3 1.07e-42 151 31 6 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium perfringens (strain SM101 / Type A)
P58675 2.09e-42 150 32 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium perfringens (strain 13 / Type A)
Q0TRF3 2.87e-42 150 32 7 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q749Y8 1.12e-41 149 33 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q97I09 9.77e-41 153 30 5 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6Q2R7 1.56e-40 145 29 7 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nitratiruptor sp. (strain SB155-2)
Q8EWR9 2.5e-40 145 30 5 299 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Malacoplasma penetrans (strain HF-2)
B5YEC2 2.89e-40 145 32 10 293 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q3A3D3 1.33e-39 143 30 6 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8RI52 1.63e-39 150 29 5 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B9L9K5 1.88e-39 142 30 9 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A7GXB5 3.45e-39 142 31 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter curvus (strain 525.92)
C4XUD2 4.5e-39 142 30 5 291 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A7ZCD0 4.64e-39 142 30 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter concisus (strain 13826)
A7H3F3 5e-39 142 30 8 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B1ZXD4 1.82e-38 140 31 8 301 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q3Z6U4 5.9e-38 139 32 10 297 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B8E2T7 7.66e-38 139 31 9 292 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q7M8Y6 8.49e-38 138 30 9 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q30S81 1.11e-37 138 30 8 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A7I0N0 1.15e-37 138 31 8 288 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P65185 6.42e-37 136 30 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter pylori (strain ATCC 700392 / 26695)
P65186 6.42e-37 136 30 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter pylori (strain J99 / ATCC 700824)
Q1CSL3 6.42e-37 136 30 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter pylori (strain HPAG1)
B6JMP4 6.42e-37 136 30 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter pylori (strain P12)
A1VZM8 8.35e-37 135 29 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q5HUR4 8.53e-37 135 29 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter jejuni (strain RM1221)
A8FLU3 8.53e-37 135 29 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P0C632 9.38e-37 135 29 7 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A9BGS3 1.46e-36 135 29 7 294 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
A6TRF9 1.59e-36 135 31 8 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Alkaliphilus metalliredigens (strain QYMF)
A6Q7P9 3.29e-36 134 31 9 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Sulfurovum sp. (strain NBC37-1)
B9KD74 5.6e-36 134 28 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A5FPY7 1.45e-35 132 31 9 297 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B2UUG0 1.98e-35 132 29 7 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter pylori (strain Shi470)
Q3ZYL6 2.1e-35 132 31 9 297 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Dehalococcoides mccartyi (strain CBDB1)
A7HCQ8 2.12e-35 132 29 5 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Anaeromyxobacter sp. (strain Fw109-5)
Q8A625 2.31e-35 132 32 8 287 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B4UEK4 4.23e-35 131 29 4 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Anaeromyxobacter sp. (strain K)
A8F7S0 1.94e-34 129 28 9 288 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q316F5 1.69e-33 127 30 3 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B1LBI2 8.64e-33 125 30 10 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermotoga sp. (strain RQ2)
B8J3G9 9.78e-33 125 28 4 282 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
B8DMK7 1.07e-32 125 31 4 286 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q9X1F7 1.11e-32 125 30 10 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q895G2 1.27e-32 130 29 6 303 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium tetani (strain Massachusetts / E88)
B9K8E2 1.99e-32 124 32 11 290 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q64PU1 2.39e-32 124 31 8 277 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacteroides fragilis (strain YCH46)
Q5L9K3 2.39e-32 124 31 8 277 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B6YQB8 3e-32 124 29 8 277 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q7VJV5 1.85e-31 122 28 9 291 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A5IME1 2.11e-31 121 29 10 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q11YY5 3.28e-30 119 27 8 296 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6L1P5 1.17e-29 117 29 8 278 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A1VHK1 1.62e-26 108 28 6 298 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nitratidesulfovibrio vulgaris (strain DP4)
C5CIU9 2.11e-26 108 27 9 300 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q72G08 4.13e-26 107 28 5 295 1 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q73NQ6 4.59e-26 107 29 11 289 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A6LIB3 3.03e-25 105 28 8 288 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B1XPG7 4.59e-25 107 28 10 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8DK29 7.86e-25 106 28 10 345 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7NG74 2.1e-24 105 27 10 350 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B7KEG3 4.22e-24 104 28 11 337 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Gloeothece citriformis (strain PCC 7424)
Q55643 4.37e-24 103 28 11 337 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5N249 2.05e-23 102 28 10 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31S64 2.05e-23 102 28 10 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4S4X8 2.61e-23 101 26 8 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q10WA8 6.22e-23 101 26 11 343 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Trichodesmium erythraeum (strain IMS101)
B7K4V8 7.07e-23 100 27 11 337 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Rippkaea orientalis (strain PCC 8801 / RF-1)
A4SGC0 9.46e-23 99 26 9 308 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B3QSU2 9.76e-23 99 25 10 320 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B4SCU0 1.26e-22 99 27 8 312 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8KFN9 1.52e-22 99 26 9 322 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B0JVA7 1.54e-22 100 26 11 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7MWK6 1.83e-22 98 29 8 284 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B0C4N8 2.45e-22 99 27 11 351 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Acaryochloris marina (strain MBIC 11017)
B3QQE0 4.35e-22 97 26 11 326 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A5GIF7 4.68e-22 98 27 11 347 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain WH7803)
A0A7J6F8C5 9.37e-22 98 27 12 361 2 HDR 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic Cannabis sativa
A0A2Z5WA18 1.23e-21 98 27 10 348 1 HDR 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic Botryococcus braunii
Q0IDE5 1.52e-21 97 27 10 344 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain CC9311)
Q46HB0 1.56e-21 97 25 10 352 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain NATL2A)
A2C096 1.56e-21 97 25 10 352 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain NATL1A)
B2S3D9 1.91e-21 96 25 7 329 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Treponema pallidum subsp. pallidum (strain SS14)
O83558 1.91e-21 96 25 7 329 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Treponema pallidum (strain Nichols)
A2CCK3 2.41e-21 96 26 9 353 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9303)
Q3B241 2.81e-21 95 25 6 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3M8X6 3.13e-21 96 26 11 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P58674 4.32e-21 95 26 11 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5GWG3 8.34e-21 95 27 10 345 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain RCC307)
Q3AN10 9.28e-21 95 27 11 343 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain CC9605)
B8HWD3 1.29e-20 94 26 11 343 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q7V4T7 1.82e-20 94 26 9 347 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9313)
A1BDJ5 1.98e-20 93 26 9 319 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B1WTZ2 3.37e-20 93 28 10 344 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q3B080 5.05e-20 92 26 9 348 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Synechococcus sp. (strain CC9902)
B3EFF5 5.55e-20 92 27 10 306 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q3AT23 1.05e-19 91 24 7 314 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium chlorochromatii (strain CaD3)
Q7U9K4 1.67e-19 91 26 10 349 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Parasynechococcus marenigrum (strain WH8102)
A9BDN6 1.68e-19 91 25 11 352 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9211)
Q6AVG6 2.26e-19 91 27 12 355 2 ISPH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic Oryza sativa subsp. japonica
Q94B35 3.54e-19 90 27 13 356 1 ISPH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic Arabidopsis thaliana
Q7VDS2 9.89e-19 89 26 11 348 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q31CR8 1.73e-18 88 26 11 344 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9312)
A3PAY5 1.8e-18 88 25 10 348 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9301)
B3EM42 1.97e-18 87 25 9 320 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Chlorobium phaeobacteroides (strain BS1)
B2IZV5 2.44e-18 88 25 11 337 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7V329 3.39e-18 87 26 10 342 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2BP63 5.91e-18 87 26 12 347 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain AS9601)
A2BUP5 3.01e-16 82 25 10 340 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Prochlorococcus marinus (strain MIT 9515)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_07895
Feature type CDS
Gene ispH
Product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
Location 90263 - 91213 (strand: 1)
Length 951 (nucleotides) / 316 (amino acids)

Contig

Accession ZDB_364
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1127
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02401 LytB protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0761 Lipid transport and metabolism (I) I 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03527 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase [EC:1.17.7.4] Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
C5 isoprenoid biosynthesis, non-mevalonate pathway

Protein Sequence

MRILLANPRGFCAGVDRAISIVERALELYGAPIYVRHEVVHNRYVVNDLRERGAIFIEEIAEVPDNAILIFSAHGVSQAIRQEARSRNLTMLFDATCPLVTKVHMEVARASRKGKEAILIGHAGHPEVEGTMGQYNNPEGGMYLVESPEDVWKLNVKDEENLSFMTQTTLSVDDTSEVIDALNARFPKIIGPRKDDICYATTNRQEAVRDLAGQADLVLVVGSKNSSNSNRLAELAQRVGKPSYLIDSADDINPAWLRDVDTIGLTAGASAPDVLVQQVISRLQELGADEISQLEGREENIIFEVPKELRVDIKEV

Flanking regions ( +/- flanking 50bp)

GTTGAATTTTTGTTTTACTGCCCGTCCGGGCGATGGTTTGGAGGCTGAACGTGCGTATTTTACTGGCTAACCCGCGGGGGTTCTGTGCAGGTGTTGACCGGGCAATCAGTATTGTGGAGCGGGCGCTGGAGTTATACGGTGCGCCTATCTACGTCCGTCATGAAGTCGTGCACAACCGCTATGTGGTCAATGATCTGCGTGAGCGCGGCGCGATTTTTATTGAGGAAATCGCAGAAGTGCCGGATAACGCCATTCTGATCTTCTCCGCCCACGGTGTCTCGCAGGCGATCCGCCAGGAAGCGCGTTCCCGTAATCTCACCATGCTGTTTGATGCCACCTGTCCGCTGGTCACCAAAGTGCATATGGAAGTGGCCCGCGCCAGCCGCAAAGGCAAAGAAGCGATTCTGATCGGCCACGCCGGGCATCCGGAAGTGGAAGGAACGATGGGGCAGTACAACAACCCGGAAGGCGGCATGTATCTGGTGGAATCCCCGGAAGATGTGTGGAAACTGAACGTCAAAGATGAAGAAAACCTCAGCTTTATGACGCAGACCACACTGTCTGTCGATGATACCTCCGAAGTCATTGATGCGCTGAATGCCCGTTTCCCGAAAATCATCGGGCCGCGCAAAGACGATATCTGCTATGCCACCACCAACCGCCAGGAAGCAGTGCGGGATCTGGCGGGTCAGGCAGATCTGGTGCTGGTGGTTGGCTCTAAAAACTCATCAAACTCCAACCGGCTGGCGGAGCTGGCGCAGCGGGTCGGAAAACCGTCTTATCTGATTGATTCTGCCGATGACATTAATCCCGCCTGGCTGCGTGATGTGGATACTATCGGCCTGACGGCCGGGGCATCCGCACCGGATGTGCTGGTACAGCAGGTGATCAGCCGTCTTCAGGAACTGGGGGCGGATGAAATCAGTCAGCTCGAGGGGCGTGAGGAAAATATTATCTTTGAAGTCCCGAAAGAGTTACGGGTGGATATCAAAGAAGTCTGACACAGCAAAGCAGAACGCAGGTTCTGCTTTTTTTTGTCTGCAGTCCGGTA