Homologs in group_620

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01270 FBDBKF_01270 100.0 Morganella morganii S1 trpS tryptophan--tRNA ligase
EHELCC_00275 EHELCC_00275 100.0 Morganella morganii S2 trpS tryptophan--tRNA ligase
NLDBIP_03185 NLDBIP_03185 100.0 Morganella morganii S4 trpS tryptophan--tRNA ligase
HKOGLL_02345 HKOGLL_02345 100.0 Morganella morganii S5 trpS tryptophan--tRNA ligase
F4V73_RS07310 F4V73_RS07310 85.5 Morganella psychrotolerans trpS tryptophan--tRNA ligase
PMI_RS08460 PMI_RS08460 70.0 Proteus mirabilis HI4320 trpS tryptophan--tRNA ligase

Distribution of the homologs in the orthogroup group_620

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_620

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46127 5.3e-132 382 56 2 335 3 trpS Tryptophan--tRNA ligase Clostridium longisporum
Q9CJD1 5.17e-124 362 53 3 339 3 trpS Tryptophan--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q9RVD6 4.73e-122 357 55 1 326 1 trpS2 Tryptophan--tRNA ligase 2 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P67596 3.76e-121 355 53 4 339 3 trpS Tryptophan--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P67595 3.76e-121 355 53 4 339 3 trpS Tryptophan--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q99XH4 3.29e-120 352 52 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus pyogenes serotype M1
P0DG61 4.42e-120 352 52 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P67598 4.42e-120 352 52 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9A2 4.42e-120 352 52 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DG60 4.42e-120 352 52 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8DRR1 2.82e-118 347 51 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DWP7 1.46e-117 346 51 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2J5 1.46e-117 346 51 3 339 3 trpS Tryptophan--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
O83640 4.32e-85 263 45 3 327 3 trpS Tryptophan--tRNA ligase Treponema pallidum (strain Nichols)
Q9Z7A4 4.19e-76 240 41 5 332 3 trpS Tryptophan--tRNA ligase Chlamydia pneumoniae
Q9WYW2 2.25e-73 233 41 5 333 1 trpS Tryptophan--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O84589 4.08e-72 230 38 4 330 1 trpS Tryptophan--tRNA ligase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q821H9 1.56e-71 228 40 4 330 3 trpS Tryptophan--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9PJF5 3.57e-71 228 37 6 340 3 trpS Tryptophan--tRNA ligase Chlamydia muridarum (strain MoPn / Nigg)
O51038 7.84e-69 222 38 4 335 3 trpS Tryptophan--tRNA ligase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9RWV7 1.22e-56 189 34 6 332 3 trpS Tryptophan--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8RGA3 1.55e-46 163 33 6 326 3 trpS Tryptophan--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8DHG3 2.46e-42 152 33 8 338 3 trpS Tryptophan--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5HW79 9.8e-41 148 31 8 328 3 trpS Tryptophan--tRNA ligase Campylobacter jejuni (strain RM1221)
Q9PIB4 9.8e-41 148 31 8 328 1 trpS Tryptophan--tRNA ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q7MT94 5.61e-40 146 32 10 330 3 trpS Tryptophan--tRNA ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
O67115 6.76e-40 147 41 2 214 3 trpS Tryptophan--tRNA ligase Aquifex aeolicus (strain VF5)
O67115 8.15e-16 81 39 0 107 3 trpS Tryptophan--tRNA ligase Aquifex aeolicus (strain VF5)
Q9AC05 4.68e-39 144 33 8 335 3 trpS Tryptophan--tRNA ligase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q4UL98 2.29e-38 142 32 8 336 3 trpS Tryptophan--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q7UQA4 3.23e-38 141 31 5 325 3 trpS Tryptophan--tRNA ligase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q92HR1 3.52e-38 141 32 8 336 3 trpS Tryptophan--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q68WR2 6.14e-38 140 32 8 336 3 trpS Tryptophan--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8YXE4 7.14e-38 140 34 9 335 3 trpS Tryptophan--tRNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9ZD76 4.21e-37 139 31 8 336 3 trpS Tryptophan--tRNA ligase Rickettsia prowazekii (strain Madrid E)
Q8Y0A1 3.92e-36 137 35 4 243 3 trpS Tryptophan--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y0A1 4.13e-14 76 32 2 146 3 trpS Tryptophan--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7NCG8 1.23e-35 135 32 9 337 3 trpS Tryptophan--tRNA ligase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q87B10 1.05e-34 134 32 9 321 3 trpS Tryptophan--tRNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7TV34 2.19e-34 131 33 11 342 3 trpS Tryptophan--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
Q9PG74 2.2e-34 133 33 9 308 3 trpS Tryptophan--tRNA ligase Xylella fastidiosa (strain 9a5c)
P73655 2.75e-34 131 33 9 336 3 trpS Tryptophan--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1RIE3 5.83e-34 130 32 7 335 3 trpS Tryptophan--tRNA ligase Rickettsia bellii (strain RML369-C)
Q7W5T6 1.3e-33 132 30 8 334 3 trpS Tryptophan--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGI7 1.3e-33 132 30 8 334 3 trpS Tryptophan--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VZ05 1.47e-33 131 30 8 334 3 trpS Tryptophan--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q891C7 2.61e-33 129 29 10 344 3 trpS Tryptophan--tRNA ligase Clostridium tetani (strain Massachusetts / E88)
Q9JYQ9 7.14e-33 127 29 8 338 3 trpS Tryptophan--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JTQ0 7.61e-32 125 29 9 340 3 trpS Tryptophan--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8PFH5 1.64e-31 125 29 8 320 3 trpS Tryptophan--tRNA ligase Xanthomonas axonopodis pv. citri (strain 306)
P00953 3.07e-31 123 29 9 336 1 trpS Tryptophan--tRNA ligase Geobacillus stearothermophilus
Q88NA1 1.03e-30 124 30 9 328 3 trpS Tryptophan--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8P3Z4 2.35e-30 122 29 9 337 3 trpS Tryptophan--tRNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8XMQ5 1.4e-29 119 28 9 344 3 trpS Tryptophan--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q89W91 1.99e-29 118 28 8 349 3 trpS Tryptophan--tRNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7TTU9 3.82e-29 117 30 8 335 3 trpS Tryptophan--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
Q92SI9 4.05e-29 117 29 11 359 3 trpS Tryptophan--tRNA ligase Rhizobium meliloti (strain 1021)
Q7VBM9 7.46e-29 117 28 8 343 3 trpS Tryptophan--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q87WW4 8.22e-29 118 30 9 330 3 trpS Tryptophan--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7V286 1.48e-28 116 28 10 338 3 trpS Tryptophan--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8NSJ4 1.91e-28 115 29 7 336 3 trpS Tryptophan--tRNA ligase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P67587 2.02e-28 116 29 10 363 3 trpS Tryptophan--tRNA ligase Brucella suis biovar 1 (strain 1330)
P67586 2.02e-28 116 29 10 363 3 trpS Tryptophan--tRNA ligase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q830U2 3.67e-28 115 29 11 338 3 trpS Tryptophan--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
P67594 2.32e-27 112 28 12 338 3 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain MW2)
Q6GAT0 2.32e-27 112 28 12 338 3 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain MSSA476)
P67593 2.32e-27 112 28 12 338 1 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain N315)
P67592 2.32e-27 112 28 12 338 3 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HH88 2.32e-27 112 28 12 338 3 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain COL)
Q81TS6 3.19e-27 112 28 10 334 3 trpS Tryptophan--tRNA ligase Bacillus anthracis
Q7VIP6 5.82e-27 111 27 9 344 3 trpS Tryptophan--tRNA ligase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q6GI89 1.03e-26 110 28 12 339 3 trpS Tryptophan--tRNA ligase Staphylococcus aureus (strain MRSA252)
Q97LD6 1.28e-26 110 27 10 347 3 trpS Tryptophan--tRNA ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9K8Y2 1.79e-26 110 28 11 338 3 trpS Tryptophan--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P21656 1.92e-26 110 27 10 337 1 trpS Tryptophan--tRNA ligase Bacillus subtilis (strain 168)
Q7MAE0 3.71e-26 109 27 9 332 3 trpS Tryptophan--tRNA ligase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8FRR3 3.78e-26 109 29 11 347 3 trpS Tryptophan--tRNA ligase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9CYK1 4.77e-26 109 26 8 332 1 Wars2 Tryptophan--tRNA ligase, mitochondrial Mus musculus
P57956 4.89e-26 109 27 9 341 3 trpS Tryptophan--tRNA ligase Pasteurella multocida (strain Pm70)
Q98C31 5.15e-26 109 28 7 353 3 trpS Tryptophan--tRNA ligase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8EK12 5.43e-26 108 26 6 346 3 trpS Tryptophan--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3T099 5.6e-26 109 27 8 332 2 WARS2 Tryptophan--tRNA ligase, mitochondrial Bos taurus
Q5HQH4 7.37e-26 108 27 13 338 3 trpS Tryptophan--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9UGM6 8.21e-26 108 29 10 334 1 WARS2 Tryptophan--tRNA ligase, mitochondrial Homo sapiens
Q6AGQ7 1.18e-25 108 27 6 324 3 trpS Tryptophan--tRNA ligase Leifsonia xyli subsp. xyli (strain CTCB07)
P43835 1.51e-25 107 26 10 340 1 trpS Tryptophan--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KNV7 1.53e-25 107 27 9 347 1 trpS Tryptophan--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9HVX6 1.62e-25 109 28 8 335 3 trpS Tryptophan--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KZA7 1.62e-25 107 27 8 344 3 trpS2 Tryptophan--tRNA ligase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8CT69 1.73e-25 107 26 11 338 3 trpS Tryptophan--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9EYY6 2.05e-25 107 26 7 336 3 trpS Tryptophan--tRNA ligase Klebsiella aerogenes
C0HKD6 2.86e-25 107 26 11 353 2 wars-2 Tryptophan--tRNA ligase, mitochondrial Caenorhabditis elegans
Q7VPB2 5.81e-25 106 26 6 345 3 trpS Tryptophan--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q49901 5.84e-25 106 29 9 345 3 trpS Tryptophan--tRNA ligase Mycobacterium leprae (strain TN)
Q8R9X8 7.84e-25 105 26 9 335 3 trpS Tryptophan--tRNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P0A2P2 1.02e-24 105 26 7 336 3 trpS Tryptophan--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P3 1.02e-24 105 26 7 336 3 trpS Tryptophan--tRNA ligase Salmonella typhi
Q8Y577 2.24e-24 104 29 11 340 3 trpS Tryptophan--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P00954 2.6e-24 104 26 8 338 1 trpS Tryptophan--tRNA ligase Escherichia coli (strain K12)
Q8ZJF2 2.65e-24 104 26 10 341 1 trpS Tryptophan--tRNA ligase Yersinia pestis
Q87L13 3.24e-24 104 26 9 346 3 trpS Tryptophan--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P56396 3.8e-24 103 29 14 336 3 trpS Tryptophan--tRNA ligase Helicobacter pylori (strain ATCC 700392 / 26695)
Q83JA5 5.75e-24 103 26 8 338 3 trpS Tryptophan--tRNA ligase Shigella flexneri
Q8D1X5 6.42e-24 103 26 8 339 3 trpS Tryptophan--tRNA ligase Wigglesworthia glossinidia brevipalpis
P67588 7.54e-24 103 25 8 338 3 trpS Tryptophan--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67589 7.54e-24 103 25 8 338 3 trpS Tryptophan--tRNA ligase Escherichia coli O157:H7
Q7MH15 8.09e-24 103 26 9 347 3 trpS Tryptophan--tRNA ligase Vibrio vulnificus (strain YJ016)
P9WFT3 9.89e-24 102 28 6 321 1 trpS Tryptophan--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFT2 9.89e-24 102 28 6 321 3 trpS Tryptophan--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67591 9.89e-24 102 28 6 321 3 trpS Tryptophan--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q82HU1 1.12e-23 102 29 8 335 3 trpS2 Tryptophan--tRNA ligase 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q71XG7 1.4e-23 102 28 11 340 3 trpS Tryptophan--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q5E2G5 1.42e-23 102 26 9 347 3 trpS Tryptophan--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8DCT6 1.77e-23 102 26 9 347 3 trpS Tryptophan--tRNA ligase Vibrio vulnificus (strain CMCP6)
Q83HC3 2.17e-23 102 26 8 339 3 trpS Tryptophan--tRNA ligase Tropheryma whipplei (strain TW08/27)
Q9ZJX4 6.45e-23 100 28 11 332 3 trpS Tryptophan--tRNA ligase Helicobacter pylori (strain J99 / ATCC 700824)
Q83FN1 8.38e-23 100 26 8 339 3 trpS Tryptophan--tRNA ligase Tropheryma whipplei (strain Twist)
Q9PQW8 1.11e-22 100 27 9 344 3 trpS Tryptophan--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q98PH7 1.91e-22 99 32 2 170 3 trpS Tryptophan--tRNA ligase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q8UIE8 1.97e-22 99 28 10 363 3 trpS Tryptophan--tRNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q929H5 2.96e-22 98 28 11 340 3 trpS Tryptophan--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8ERU2 3.51e-22 98 27 11 332 3 trpS Tryptophan--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q82E91 3.79e-22 98 28 12 345 3 trpS1 Tryptophan--tRNA ligase 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8RXE9 4.24e-22 99 26 6 341 1 OVA4 Tryptophan--tRNA ligase, chloroplastic/mitochondrial Arabidopsis thaliana
P59466 5.05e-22 98 25 6 326 3 trpS Tryptophan--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7NA61 6.3e-22 98 25 8 344 3 trpS Tryptophan--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P04803 2.01e-20 94 25 8 360 1 MSW1 Tryptophan--tRNA ligase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P57602 2.07e-20 93 23 9 342 3 trpS Tryptophan--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8CJX0 2.28e-19 90 28 8 332 3 trpS1 Tryptophan--tRNA ligase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8EVV1 2.54e-19 90 25 10 339 3 trpS Tryptophan--tRNA ligase Malacoplasma penetrans (strain HF-2)
P75510 5.43e-19 89 25 9 341 1 trpS Tryptophan--tRNA ligase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7VRN5 4.47e-18 87 24 11 340 3 trpS Tryptophan--tRNA ligase Blochmanniella floridana
Q7NAT8 5.03e-18 87 29 2 171 3 trpS Tryptophan--tRNA ligase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
O42875 8.62e-18 86 25 9 355 3 msw1 Tryptophan--tRNA ligase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q86A90 1.28e-17 86 27 7 299 3 wars2 Tryptophan--tRNA ligase, mitochondrial Dictyostelium discoideum
Q8K941 1.9e-17 85 23 9 339 3 trpS Tryptophan--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P47372 2.9e-16 82 25 10 340 3 trpS Tryptophan--tRNA ligase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9HN66 8.45e-13 72 26 9 311 3 trpS2 Tryptophan--tRNA ligase 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q5V4J1 1.31e-08 59 24 13 320 3 tyrS Tyrosine--tRNA ligase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5P7U2 4.76e-08 57 26 15 290 3 tyrS Tyrosine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
O27795 5.1e-08 57 23 9 306 3 tyrS Tyrosine--tRNA ligase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A5UKJ0 5.9e-08 57 25 13 313 3 tyrS Tyrosine--tRNA ligase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
O59584 1.86e-07 55 24 17 314 1 trpS Tryptophan--tRNA ligase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2FNA1 3.27e-07 54 22 10 305 3 tyrS Tyrosine--tRNA ligase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
P43836 1.01e-06 53 28 10 232 3 tyrS Tyrosine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6AJ82 1.28e-06 53 25 17 318 3 tyrS Tyrosine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q4QL45 1.5e-06 53 28 10 231 3 tyrS Tyrosine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
Q7VN81 2.33e-06 52 27 13 281 3 tyrS Tyrosine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5JEP3 3.62e-06 52 23 13 299 3 trpS Tryptophan--tRNA ligase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8ZTU5 4.48e-06 51 25 13 322 3 trpS Tryptophan--tRNA ligase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q3SLJ8 6.13e-06 51 27 15 300 3 tyrS Tyrosine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
B6YUH1 7.62e-06 50 22 17 341 3 trpS Tryptophan--tRNA ligase Thermococcus onnurineus (strain NA1)
Q9UY11 7.7e-06 50 22 14 296 3 trpS Tryptophan--tRNA ligase Pyrococcus abyssi (strain GE5 / Orsay)
A4WL99 1e-05 50 24 13 317 3 trpS Tryptophan--tRNA ligase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q9CMQ8 1.44e-05 50 26 15 300 3 tyrS Tyrosine--tRNA ligase Pasteurella multocida (strain Pm70)
C6A032 1.97e-05 49 22 12 301 3 trpS Tryptophan--tRNA ligase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q65T71 2.27e-05 49 26 14 284 3 tyrS Tyrosine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q97KY6 2.3e-05 49 27 10 240 3 tyrS2 Tyrosine--tRNA ligase 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B7XHC1 2.44e-05 49 21 8 294 3 EBI_24879 Probable tyrosine--tRNA ligase, cytoplasmic Enterocytozoon bieneusi (strain H348)
Q2KV13 2.69e-05 49 28 10 221 3 tyrS Tyrosine--tRNA ligase Bordetella avium (strain 197N)
A3MX72 2.88e-05 48 23 10 316 3 trpS Tryptophan--tRNA ligase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q8TYF7 3.35e-05 48 26 13 323 3 trpS Tryptophan--tRNA ligase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P32921 4.34e-05 48 25 13 307 1 Wars1 Tryptophan--tRNA ligase, cytoplasmic Mus musculus
Q8KEW9 4.99e-05 48 25 9 221 3 tyrS Tyrosine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A3CYG9 5e-05 48 23 8 234 3 tyrS Tyrosine--tRNA ligase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q39WF4 5.01e-05 48 25 10 220 3 tyrS Tyrosine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6P7B0 5.71e-05 48 25 13 307 1 Wars1 Tryptophan--tRNA ligase, cytoplasmic Rattus norvegicus
Q74E25 6.78e-05 48 25 10 226 3 tyrS Tyrosine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9Y924 6.88e-05 47 23 13 314 1 trpS Tryptophan--tRNA ligase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q5SIH0 0.000133 47 29 12 250 3 tyrS Tyrosine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P83453 0.000133 47 29 12 250 1 tyrS Tyrosine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q88QQ2 0.000145 47 26 11 213 3 tyrS Tyrosine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3JCM3 0.000155 47 26 10 212 3 tyrS Tyrosine--tRNA ligase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5WYX4 0.000168 46 28 4 152 3 tyrS Tyrosine--tRNA ligase Legionella pneumophila (strain Lens)
A6URQ1 0.000242 45 21 15 329 3 tyrS Tyrosine--tRNA ligase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q9RR63 0.000243 46 30 10 198 3 tyrS Tyrosine--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6M0K7 0.000305 45 21 11 317 3 tyrS Tyrosine--tRNA ligase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q3BNC2 0.000308 45 28 5 164 3 tyrS Tyrosine--tRNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5ZY07 0.000332 45 28 4 152 3 tyrS Tyrosine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9I5Q3 0.000337 45 27 11 213 3 tyrS2 Tyrosine--tRNA ligase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q475S5 0.000366 45 28 11 216 3 tyrS Tyrosine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3IQU8 0.000384 45 23 9 291 3 tyrS Tyrosine--tRNA ligase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q5X7H7 0.00039 45 28 4 152 3 tyrS Tyrosine--tRNA ligase Legionella pneumophila (strain Paris)
Q57834 0.000436 45 22 12 302 1 tyrS Tyrosine--tRNA ligase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3ABU4 0.000464 45 24 14 287 3 tyrS Tyrosine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2RHS8 0.000541 45 26 10 226 3 tyrS Tyrosine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q7W3Z8 0.000558 45 27 10 221 3 tyrS Tyrosine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q3JNS0 0.000576 45 27 10 221 3 tyrS Tyrosine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
Q7VUW5 0.000599 45 27 10 221 3 tyrS Tyrosine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WFD0 0.000678 45 27 10 221 3 tyrS Tyrosine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3A220 0.000683 44 29 6 154 3 tyrS Tyrosine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q60AU5 0.000781 44 25 7 226 3 tyrS Tyrosine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q889Y8 0.001 44 26 9 216 3 tyrS Tyrosine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K517 0.001 44 27 12 218 3 tyrS Tyrosine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_04700
Feature type CDS
Gene trpS
Product tryptophan--tRNA ligase
Location 221938 - 222951 (strand: -1)
Length 1014 (nucleotides) / 337 (amino acids)
In genomic island -

Contig

Accession ZDB_361
Length 286024 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_620
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00579 tRNA synthetases class I (W and Y)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0180 Translation, ribosomal structure and biogenesis (J) J Tryptophanyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01867 tryptophanyl-tRNA synthetase [EC:6.1.1.2] Aminoacyl-tRNA biosynthesis -

Protein Sequence

MSVHHTQSVILTGDRITGPLHLGHYTGSLQQRVRLQHSAVQYILMADMQGLTDNGAQPEKVNRYFYDVAADYLAAGIDPARSVICLQSALPALAELTLLYLNLVSVSRLERNPTVKQEIIQKQFSRTLPAGFLIYPVSQAADITAFKADLVPVGEDQLPMIEQTNEIVSKINHVTGQELLVHCRAEVGKTGRLPGIDGNGKMSKSLGNAINLSVSADDLTRAVNAMFTDPQHLRVSDPGRIEGNVVFAYLDAFHPDTALVAEMKARYQAGGLGDRECKSVLNECLQALLAPIREERARLMADKSYLLSVIRRGTEKAREVTQQTLDQVKRGMGLLIF

Flanking regions ( +/- flanking 50bp)

ATATTGCATTCACCCCGGCGGCCTCTGATCACAATAAAAGAGGAAATCGTATGTCTGTTCATCACACCCAATCCGTTATTCTGACCGGCGACCGTATCACCGGGCCGTTACACCTCGGACACTATACCGGCTCGCTGCAACAGCGGGTCAGACTTCAGCATTCTGCCGTGCAGTATATTCTGATGGCGGATATGCAGGGACTGACGGATAACGGTGCGCAACCCGAAAAAGTAAACCGTTATTTTTATGATGTAGCGGCGGATTACCTGGCGGCAGGCATCGATCCCGCCCGTTCTGTGATTTGCCTGCAATCGGCGCTGCCCGCACTGGCTGAACTGACACTGCTGTATCTCAATCTGGTGAGCGTTTCCCGGCTGGAGCGGAATCCGACGGTTAAACAGGAAATCATTCAGAAGCAGTTCTCCCGTACACTGCCGGCCGGATTTCTGATTTATCCGGTCAGCCAGGCGGCGGATATCACTGCGTTTAAAGCTGATCTGGTGCCGGTCGGGGAAGATCAACTGCCGATGATTGAACAAACCAATGAGATTGTCAGCAAAATCAATCATGTTACCGGGCAGGAATTACTGGTTCACTGCCGTGCTGAAGTCGGTAAAACCGGCCGCCTGCCGGGGATTGACGGTAACGGTAAGATGTCCAAATCACTGGGAAATGCCATTAATCTCTCTGTCAGTGCGGATGACCTGACGCGTGCCGTCAATGCTATGTTTACCGATCCGCAGCATCTGCGGGTGTCTGATCCCGGCCGGATTGAGGGCAATGTGGTGTTTGCGTATCTTGATGCGTTTCATCCGGATACAGCCCTGGTTGCTGAGATGAAAGCCCGTTATCAGGCGGGCGGTTTAGGCGACAGGGAGTGCAAATCAGTGCTGAACGAGTGCCTGCAGGCACTGCTGGCACCGATCCGTGAGGAGCGGGCGCGGCTGATGGCGGATAAGTCTTATCTGCTCTCGGTTATCCGCCGCGGGACAGAAAAAGCGCGGGAAGTGACACAGCAGACGCTGGATCAGGTAAAAAGAGGAATGGGGCTGCTTATTTTTTGAACCGCATTTTTTGCGGATTATGCTGAATAAGCAGGATGCGATTGATTCCC