Homologs in group_2666

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04710 FBDBKF_04710 100.0 Morganella morganii S1 rbsB ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain
EHELCC_06000 EHELCC_06000 100.0 Morganella morganii S2 rbsB ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain
NLDBIP_06320 NLDBIP_06320 100.0 Morganella morganii S4 rbsB ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain
HKOGLL_06675 HKOGLL_06675 100.0 Morganella morganii S5 rbsB ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain
F4V73_RS09185 F4V73_RS09185 94.0 Morganella psychrotolerans - substrate-binding domain-containing protein

Distribution of the homologs in the orthogroup group_2666

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2666

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0QYB3 2.04e-38 142 33 7 274 1 xypA Xylitol-binding protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QYB5 9.51e-36 135 31 7 294 1 thpA D-threitol-binding protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P49308 1.45e-31 123 32 5 244 3 mocB Putative rhizopine-binding protein Rhizobium meliloti
P36949 4.33e-27 111 35 5 223 1 rbsB Ribose import binding protein RbsB Bacillus subtilis (strain 168)
P0A2C5 1.29e-26 109 31 9 293 1 rbsB Ribose import binding protein RbsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2C6 1.29e-26 109 31 9 293 3 rbsB Ribose import binding protein RbsB Salmonella typhi
P02925 6.09e-26 108 31 9 293 1 rbsB Ribose import binding protein RbsB Escherichia coli (strain K12)
P44737 4.68e-25 105 31 10 298 1 rbsB Ribose import binding protein RbsB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1G898 3.79e-19 89 29 10 311 1 BgramDRAFT_5566 D-apiose import binding protein Paraburkholderia graminis (strain ATCC 700544 / DSM 17151 / LMG 18924 / NCIMB 13744 / C4D1M)
Q2JZQ5 8.03e-19 89 32 11 273 1 RHE_PF00037 D-apiose import binding protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P23905 1.72e-18 88 27 13 354 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23925 6.05e-18 86 28 11 312 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Citrobacter freundii
A6VKQ8 8.56e-18 85 30 12 292 1 Asuc_0175 D-apiose import binding protein Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P0AEE7 1.08e-17 85 28 11 312 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Shigella flexneri
P0AEE5 1.08e-17 85 28 11 312 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Escherichia coli (strain K12)
P0AEE6 1.08e-17 85 28 11 312 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B9JK76 3.7e-15 78 30 10 267 3 Arad_9233 D-apiose import binding protein Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q8G848 1.23e-14 77 29 6 218 1 fruE Fructose import binding protein FruE Bifidobacterium longum (strain NCC 2705)
P39325 2.72e-13 72 29 9 228 1 ytfQ Galactofuranose-binding protein YtfQ Escherichia coli (strain K12)
P44883 1.02e-12 71 25 15 355 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I2F8 2.38e-10 64 25 7 273 1 rbsB D-ribose/D-allose-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39265 2.03e-09 61 30 7 172 1 alsB D-allose-binding periplasmic protein Escherichia coli (strain K12)
P45047 5.5e-08 57 27 6 195 3 xylF D-xylose-binding periplasmic protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37387 3.56e-06 51 27 6 191 1 xylF D-xylose-binding periplasmic protein Escherichia coli (strain K12)
B0BP99 1.21e-05 50 22 9 229 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q9CN88 0.00024 46 27 11 191 3 purR HTH-type transcriptional repressor PurR Pasteurella multocida (strain Pm70)
P24242 0.000243 46 25 9 202 1 ascG HTH-type transcriptional regulator AscG Escherichia coli (strain K12)
A6VNL0 0.000405 45 26 8 189 3 purR HTH-type transcriptional repressor PurR Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_03200
Feature type CDS
Gene rbsB
Product ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain
Location 222980 - 223981 (strand: 1)
Length 1002 (nucleotides) / 333 (amino acids)

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2666
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF13407 Periplasmic binding protein domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1879 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17205 putative xylitol transport system substrate-binding protein ABC transporters -

Protein Sequence

MKKLTKIAALTALMMGGQAFAAQDNPVKIAVLMYGMKAEFVQLMEKSAKEHPAVKNGEAIITVYDGRYDPMVQNNQAETAIQTKADAIIINPMDYEANIDVVTMANDAKIPVIVTNARLNTDKMTAEVVSDDVLGGYMEAKAVLEKMNCEGNVVIIEGPKGGSGEIQRGEGNDKAIAECGPGKVKVLERKTANWSRAEAMPLMENWLQKHRGKIGGVIAQNDEMALGAIEAIKSAGLNVNDFSIAGVDGVSDAIRSVQEGEMVSILQDANAQMQGSIDLAMKAVKGDKYEPQSKIWVQYADQLKWNDGKDKRYAIPWTQVTKENAQQLLDARK

Flanking regions ( +/- flanking 50bp)

AAACAGCAAAAAACAAAAGCAAAACTACCCTACACAATGAAGGAATGACCATGAAAAAACTGACCAAAATCGCTGCACTGACAGCCCTGATGATGGGCGGACAGGCATTTGCGGCACAGGACAATCCGGTGAAAATTGCCGTTCTGATGTACGGCATGAAAGCTGAATTTGTCCAGTTAATGGAAAAATCCGCAAAAGAGCATCCGGCTGTGAAAAACGGTGAAGCGATCATCACAGTTTATGATGGCCGTTATGATCCGATGGTTCAGAACAACCAGGCGGAAACCGCAATCCAGACCAAAGCCGACGCTATCATCATCAACCCGATGGATTATGAAGCGAATATCGACGTGGTCACTATGGCAAATGACGCCAAAATCCCGGTTATCGTCACCAACGCCCGTCTGAACACCGACAAAATGACCGCAGAAGTGGTGTCTGATGACGTCCTCGGCGGTTATATGGAAGCCAAAGCGGTTCTGGAAAAAATGAACTGTGAAGGTAACGTGGTTATTATCGAAGGGCCAAAAGGCGGCAGCGGTGAAATTCAGCGCGGCGAAGGTAATGACAAAGCGATCGCAGAATGTGGTCCGGGTAAAGTGAAAGTACTGGAGCGCAAAACGGCTAACTGGTCACGCGCGGAAGCGATGCCGCTGATGGAAAACTGGTTACAGAAACACCGTGGTAAAATCGGTGGTGTTATTGCACAGAACGACGAAATGGCACTGGGTGCGATCGAAGCAATCAAATCTGCCGGTCTGAATGTCAATGATTTCTCCATTGCCGGTGTTGACGGCGTGTCTGATGCTATCCGCTCTGTTCAGGAAGGCGAAATGGTCTCCATCCTCCAGGACGCAAATGCACAGATGCAGGGTTCTATCGACCTGGCGATGAAAGCGGTCAAAGGTGACAAATATGAGCCACAGTCCAAAATCTGGGTTCAGTATGCAGACCAGCTGAAATGGAATGACGGTAAAGACAAACGTTACGCGATTCCGTGGACTCAGGTCACCAAAGAAAACGCGCAGCAGTTACTGGATGCCCGTAAATAAATACACTCCGCCGTCTTCTTATGAAGGCGGCGTTTTTTATCCGCCCCCCT