Homologs in group_62

Help

12 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02505 FBDBKF_02505 100.0 Morganella morganii S1 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
FBDBKF_14585 FBDBKF_14585 56.6 Morganella morganii S1 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
EHELCC_02975 EHELCC_02975 100.0 Morganella morganii S2 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
EHELCC_15390 EHELCC_15390 56.6 Morganella morganii S2 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
NLDBIP_00485 NLDBIP_00485 100.0 Morganella morganii S4 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
NLDBIP_15920 NLDBIP_15920 56.6 Morganella morganii S4 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
LHKJJB_15920 LHKJJB_15920 56.6 Morganella morganii S3 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
HKOGLL_01590 HKOGLL_01590 100.0 Morganella morganii S5 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
HKOGLL_15040 HKOGLL_15040 56.6 Morganella morganii S5 roxA Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
F4V73_RS02440 F4V73_RS02440 84.7 Morganella psychrotolerans - cupin domain-containing protein
F4V73_RS07380 F4V73_RS07380 57.6 Morganella psychrotolerans - cupin domain-containing protein
PMI_RS04340 PMI_RS04340 58.2 Proteus mirabilis HI4320 - cupin domain-containing protein

Distribution of the homologs in the orthogroup group_62

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_62

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27431 1.85e-169 480 60 0 372 1 roxA Ribosomal protein uL16 3-hydroxylase Escherichia coli (strain K12)
P44683 2.93e-45 163 33 9 300 1 HI_0396 Probable ribosomal oxygenase HI_0396 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CFC1 5.62e-07 55 25 10 228 2 Riox2 Ribosomal oxygenase 2 Rattus norvegicus
B5DUH6 7.21e-07 55 32 2 77 3 GA27866 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila pseudoobscura pseudoobscura
B4GUZ2 8.73e-07 54 23 7 185 3 GL12933 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila persimilis
A3KP59 1.16e-06 53 31 2 91 2 riox1 Ribosomal oxygenase 1 Danio rerio
Q5ZMM1 7.6e-06 51 31 5 125 2 RIOX1 Ribosomal oxygenase 1 Gallus gallus
B4NP88 9.13e-06 51 36 1 74 3 GK15670 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila willistoni
B4JMQ2 2.33e-05 50 35 1 74 3 GH24285 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila grimshawi
Q16W06 2.73e-05 49 23 10 235 3 AAEL009382 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Aedes aegypti
B0WMG3 3.08e-05 49 28 2 107 3 CPIJ008401 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Culex quinquefasciatus
D3ZU57 3.92e-05 49 34 1 72 1 Riox1 Ribosomal oxygenase 1 Rattus norvegicus
P46327 4.49e-05 48 24 7 234 1 yxbC Uncharacterized protein YxbC Bacillus subtilis (strain 168)
B4M7P8 5.03e-05 49 32 2 83 3 GJ17031 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila virilis
B4Q068 5.3e-05 48 31 2 85 3 GE16340 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila yakuba
A5PK74 5.31e-05 48 34 2 72 2 RIOX1 Ribosomal oxygenase 1 Bos taurus
Q9H6W3 5.33e-05 48 34 2 72 1 RIOX1 Ribosomal oxygenase 1 Homo sapiens
Q9JJF3 5.49e-05 48 34 1 72 1 Riox1 Ribosomal oxygenase 1 Mus musculus
Q54K96 6.72e-05 48 29 4 117 3 jcdg Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Dictyostelium discoideum
B3NU20 7.37e-05 48 35 1 74 3 GG18702 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila erecta
B4R4H1 0.00015 47 34 1 76 3 GD16684 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila simulans
B4I100 0.000151 47 35 3 79 3 GM12339 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila sechellia
B3MSI4 0.000193 47 33 1 77 3 GF20792 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila ananassae
Q7K4H4 0.000326 46 34 1 76 1 NO66 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila melanogaster
B4L6Q5 0.000617 45 33 1 74 3 GI16410 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Drosophila mojavensis
A8XEA2 0.000819 45 31 4 103 3 jmjc-1 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Caenorhabditis briggsae
O01658 0.000833 45 31 4 103 3 jmjc-1 Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 Caenorhabditis elegans

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_01550
Feature type CDS
Gene roxA
Product Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain
Location 297601 - 298722 (strand: -1)
Length 1122 (nucleotides) / 373 (amino acids)

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_62
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF08007 JmjC domain
PF20514 ROXA-like winged helix

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2850 Translation, ribosomal structure and biogenesis (J) J Ribosomal protein L16 Arg81 hydroxylase, contains JmjC domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K18850 50S ribosomal protein L16 3-hydroxylase [EC:1.14.11.47] - -

Protein Sequence

MVNKLNLNWPEFLEKYWQKKPVVLKNAFPDFADPITPDELAGLAMEPEVDSRLVSFIDNKWEASHGPFEDYSQLGEKGWSLLVQAVNHWHMPAAELVKPFRVLPEWRLDDLMISYSVPGGGVGPHIDNYDVFIIQGMGRRRWRVGDALPMRQFCAHPALLHVDPFEPIIDVEMAPGDILYIPPGFPHDGFTFEDTMNYSVGFRGPTGRDLLSSFADYALEQDLGGVNYGDPDLKVRENSGSMESYEVERLRAMMIEMINKPGDFEQWLGRFATTPRHELDIAPSEPPYEPEEVLSALNAGEKLIRLSGLRVLRIGEHFFVNTEGWMTTEIKGADTLCRLTEVGVNELGEALENPVFVAELTEFINQGYWYFDE

Flanking regions ( +/- flanking 50bp)

CGCATTGCTTCTATAATTATCCGCTTATTTCCTCATATAGATGTGGTCACATGGTTAACAAACTGAATCTTAACTGGCCTGAATTTTTAGAAAAATACTGGCAGAAAAAACCCGTTGTACTGAAAAATGCATTTCCTGATTTTGCCGACCCTATCACGCCGGATGAACTGGCCGGCCTGGCTATGGAGCCGGAAGTTGACAGCCGCCTGGTCAGCTTCATTGATAACAAATGGGAAGCGAGTCACGGTCCGTTTGAGGACTACAGCCAGTTAGGTGAAAAAGGATGGTCATTGCTGGTACAGGCTGTCAACCATTGGCATATGCCGGCTGCGGAATTGGTAAAACCGTTCCGCGTGCTGCCTGAGTGGCGTCTTGATGACCTGATGATTTCCTACTCAGTGCCCGGCGGTGGTGTCGGACCACATATTGATAACTATGATGTTTTCATTATCCAGGGCATGGGCCGCCGTCGCTGGCGTGTGGGTGACGCCCTTCCCATGCGTCAGTTCTGCGCACATCCGGCATTACTGCATGTCGACCCGTTTGAGCCGATAATTGATGTGGAAATGGCGCCGGGCGATATTCTGTATATTCCGCCGGGATTCCCTCACGATGGTTTCACCTTCGAAGATACCATGAACTATTCTGTCGGCTTTCGCGGACCGACAGGACGTGATCTGCTGAGCAGCTTTGCAGACTATGCACTGGAACAGGATTTGGGGGGCGTCAATTATGGCGACCCTGACCTGAAAGTACGTGAAAACTCAGGTTCAATGGAATCTTATGAGGTTGAACGCCTGCGTGCCATGATGATTGAAATGATCAACAAGCCAGGTGATTTCGAACAGTGGTTAGGCCGTTTTGCAACTACCCCGCGCCATGAGCTGGATATTGCACCTTCGGAACCGCCGTATGAGCCGGAAGAAGTACTTAGTGCTCTGAATGCCGGTGAAAAACTGATACGACTGAGCGGACTGCGTGTTCTGCGTATCGGGGAACATTTCTTCGTTAATACCGAAGGCTGGATGACCACCGAAATTAAAGGTGCGGATACATTGTGCCGGTTAACCGAAGTCGGCGTGAATGAGCTCGGTGAAGCACTGGAGAACCCGGTTTTTGTTGCGGAATTAACCGAATTTATCAATCAGGGATATTGGTATTTCGACGAATAAGTCACATCAGCCCGACAAGATAAAACACCCGCTGACGGGTGTTTTATCTC