Homologs in group_2093

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15755 FBDBKF_15755 100.0 Morganella morganii S1 nfnB Nitroreductase
EHELCC_17670 EHELCC_17670 100.0 Morganella morganii S2 nfnB Nitroreductase
NLDBIP_19340 NLDBIP_19340 100.0 Morganella morganii S4 nfnB Nitroreductase
LHKJJB_18110 LHKJJB_18110 100.0 Morganella morganii S3 nfnB Nitroreductase
F4V73_RS07935 F4V73_RS07935 92.2 Morganella psychrotolerans - nitroreductase family protein
PMI_RS07410 PMI_RS07410 64.7 Proteus mirabilis HI4320 - nitroreductase family protein

Distribution of the homologs in the orthogroup group_2093

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2093

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q55233 2.12e-54 175 44 3 205 1 drgA Protein DrgA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P96692 1.2e-24 99 31 6 201 1 mhqN Putative NAD(P)H nitroreductase MhqN Bacillus subtilis (strain 168)
P81102 3.95e-22 92 27 5 201 1 yodC Putative NAD(P)H nitroreductase YodC Bacillus subtilis (strain 168)
P96707 8.19e-19 84 28 7 201 3 ydgI Putative NAD(P)H nitroreductase YdgI Bacillus subtilis (strain 168)
P0DX42 1.19e-14 72 26 6 192 1 cla-er CLA biosynthesis enone reductase Lactiplantibacillus plantarum
Q5HLA1 2.39e-13 69 27 6 199 3 SERP2086 Putative NAD(P)H nitroreductase SERP2086 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34475 2.45e-13 69 24 7 210 1 yfkO Putative NAD(P)H nitroreductase YfkO Bacillus subtilis (strain 168)
Q4L920 3.35e-13 68 27 6 202 3 SH0546 Putative NAD(P)H nitroreductase SH0546 Staphylococcus haemolyticus (strain JCSC1435)
Q8CN23 6.76e-13 68 26 6 198 3 SE_2073 Putative NAD(P)H nitroreductase SE_2073 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q60049 1.69e-11 63 27 7 213 1 nox NADH dehydrogenase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q2FVA4 4.15e-11 63 25 5 198 1 SAOUHSC_02829 Putative NAD(P)H nitroreductase SAOUHSC_02829 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HD30 4.15e-11 63 25 5 198 3 SACOL2534 Putative NAD(P)H nitroreductase SACOL2534 Staphylococcus aureus (strain COL)
Q2FDY2 4.15e-11 63 25 5 198 3 SAUSA300_2462 Putative NAD(P)H nitroreductase SAUSA300_2462 Staphylococcus aureus (strain USA300)
Q99RB2 1.63e-10 61 24 5 198 3 SAV2523 Putative NAD(P)H nitroreductase SAV2523 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q79ZZ6 1.63e-10 61 24 5 198 3 MW2443 Putative NAD(P)H nitroreductase MW2443 Staphylococcus aureus (strain MW2)
Q6G6F2 1.63e-10 61 24 5 198 3 SAS2409 Putative NAD(P)H nitroreductase SAS2409 Staphylococcus aureus (strain MSSA476)
Q2YW87 1.63e-10 61 24 5 198 3 SAB2397c Putative NAD(P)H nitroreductase SAB2397c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3H8 1.63e-10 61 24 5 198 1 SA2311 Putative NAD(P)H nitroreductase SA2311 Staphylococcus aureus (strain N315)
Q4A087 4.73e-09 57 23 7 210 3 SSP0379 Putative NAD(P)H nitroreductase SSP0379 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O25608 1.87e-06 50 23 7 203 1 rdxA Oxygen-insensitive NADPH nitroreductase Helicobacter pylori (strain ATCC 700392 / 26695)
Q1CSR7 7.19e-06 48 23 7 203 3 rdxA Oxygen-insensitive NADPH nitroreductase Helicobacter pylori (strain HPAG1)
B9K712 1.1e-05 47 23 6 175 1 IYD Iodotyrosine deiodinase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q01234 3.37e-05 46 22 9 222 1 nfsB Oxygen-insensitive NAD(P)H nitroreductase Enterobacter cloacae
Q9ZKP7 5.32e-05 45 21 7 203 3 rdxA Oxygen-insensitive NADPH nitroreductase Helicobacter pylori (strain J99 / ATCC 700824)
A4VQH8 0.000138 44 29 1 84 3 PST_3601 Putative NADH dehydrogenase/NAD(P)H nitroreductase PST_3601 Stutzerimonas stutzeri (strain A1501)
O30013 0.000393 43 21 7 203 3 AF_0226 Putative NADH dehydrogenase/NAD(P)H nitroreductase AF_0226 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6T798 0.000509 43 27 1 84 3 rutE Probable malonic semialdehyde reductase RutE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4SHM0 0.000732 42 31 3 90 3 Smal_0358 Putative NADH dehydrogenase/NAD(P)H nitroreductase Smal_0358 Stenotrophomonas maltophilia (strain R551-3)
B2FKV6 0.000894 42 29 2 89 3 Smlt0482 Putative NADH dehydrogenase/NAD(P)H nitroreductase Smlt0482 Stenotrophomonas maltophilia (strain K279a)
A1JMW8 0.001 42 25 1 101 3 rutE Probable malonic semialdehyde reductase RutE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18970
Feature type CDS
Gene nfnB
Product Nitroreductase
Location 4549 - 5169 (strand: -1)
Length 621 (nucleotides) / 206 (amino acids)

Contig

Accession ZDB_710
Length 17998 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2093
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00881 Nitroreductase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0778 Energy production and conversion (C) C Nitroreductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15976 putative NAD(P)H nitroreductase [EC:1.-.-.-] - -

Protein Sequence

MNVIDAVRQRRATKKFDPDFVIPLNEKKALLSLAMENAPSAFNLQHWRPLLVEDPAQRRNIRKVGWDQPQMTDASMLVILCGDVAAWSSRPREIWRDADPLERDFMVNAVDNYYRGKPETQRDEIMRSAGIFAQTLMLLAKAQGYDSCPMDGFDFNAVAEVIDLPENYEICLMVAIGKSAGEPYPRIGKLPFDQLVSIDRFHPDMP

Flanking regions ( +/- flanking 50bp)

TTATGGTAAATAAATCATCCGGATAATAAATGGAATAAACAGGAGTCTGTATGAATGTTATTGATGCCGTGCGTCAGCGCAGAGCAACCAAGAAGTTTGATCCTGATTTTGTGATCCCGCTTAACGAGAAGAAAGCACTACTGTCACTGGCGATGGAAAATGCCCCGAGTGCCTTTAACCTTCAGCACTGGCGGCCGCTGCTGGTGGAGGATCCGGCACAACGCCGCAATATCCGCAAAGTGGGCTGGGATCAGCCGCAGATGACGGACGCCTCCATGCTGGTGATTTTATGCGGTGATGTGGCAGCCTGGAGTTCCCGTCCCCGTGAAATCTGGCGTGATGCCGACCCGCTGGAGCGGGATTTTATGGTCAATGCGGTTGATAACTACTATCGCGGTAAACCGGAAACCCAGCGTGATGAAATTATGCGCAGTGCCGGTATTTTTGCCCAGACGCTGATGCTGCTGGCAAAAGCGCAGGGCTATGACAGTTGTCCGATGGACGGATTTGATTTTAATGCGGTGGCTGAAGTCATTGATCTGCCGGAAAACTATGAAATCTGCCTGATGGTGGCGATTGGTAAATCCGCCGGTGAGCCTTATCCGCGTATCGGTAAACTGCCTTTTGATCAACTGGTCAGCATTGACCGTTTTCATCCTGATATGCCGTAACATTATCTGCCTGTCTCCGGCTGCTGTCTCCCGGCAGCCGTCTCCTTTCA