Homologs in group_489

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19025 FBDBKF_19025 100.0 Morganella morganii S1 proY L-asparagine transporter or related permease
EHELCC_18770 EHELCC_18770 100.0 Morganella morganii S2 proY L-asparagine transporter or related permease
NLDBIP_18535 NLDBIP_18535 100.0 Morganella morganii S4 proY L-asparagine transporter or related permease
LHKJJB_18640 LHKJJB_18640 100.0 Morganella morganii S3 proY L-asparagine transporter or related permease
F4V73_RS13930 F4V73_RS13930 92.9 Morganella psychrotolerans - amino acid permease
PMI_RS11100 PMI_RS11100 87.8 Proteus mirabilis HI4320 - amino acid permease

Distribution of the homologs in the orthogroup group_489

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_489

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37460 0.0 565 61 2 450 3 proY Proline-specific permease ProY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAE2 0.0 536 60 2 450 1 proY Proline-specific permease ProY Escherichia coli (strain K12)
P0AAE3 0.0 536 60 2 450 3 proY Proline-specific permease ProY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAE4 0.0 536 60 2 450 3 proY Proline-specific permease ProY Escherichia coli O157:H7
O34618 7.05e-164 473 49 2 453 3 ytnA Uncharacterized amino acid permease YtnA Bacillus subtilis (strain 168)
P0CK99 2.33e-130 387 44 3 450 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W822 2.33e-130 387 44 3 450 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain SL1344)
P0A188 2.33e-130 387 44 3 450 3 None Aromatic amino acid transport protein AroP Salmonella typhi
P96704 2.62e-130 387 44 2 442 3 ydgF Uncharacterized transporter YdgF Bacillus subtilis (strain 168)
Q8FL49 2.33e-129 385 43 2 445 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59737 1.01e-128 383 42 2 445 3 aroP Aromatic amino acid transport protein AroP Shigella flexneri
P15993 1.44e-128 382 42 2 445 1 aroP Aromatic amino acid transport protein AroP Escherichia coli (strain K12)
Q8X968 2.95e-128 382 42 2 445 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O157:H7
O06005 4.45e-127 379 44 3 453 3 aapA Amino-acid permease AapA Bacillus subtilis (strain 168)
P24207 1.69e-126 377 42 2 444 1 pheP Phenylalanine-specific permease Escherichia coli (strain K12)
P27837 2.53e-120 362 43 3 447 1 yifK Probable transport protein YifK Escherichia coli (strain K12)
P0A189 8.47e-119 358 43 3 447 3 yifK Probable transport protein YifK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A190 8.47e-119 358 43 3 447 3 yifK Probable transport protein YifK Salmonella typhi
P0AAE0 2.35e-118 357 41 2 450 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli (strain K12)
P0AAE1 2.35e-118 357 41 2 450 3 cycA D-serine/D-alanine/glycine transporter Escherichia coli O157:H7
A0A0H2VDI7 2.66e-112 342 40 2 450 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P54425 1.03e-109 335 43 3 449 3 ybxG Probable threonine/serine transporter YbxG Bacillus subtilis (strain 168)
P39636 9.55e-99 306 38 7 462 2 rocC Amino-acid permease RocC Bacillus subtilis (strain 168)
P39137 5.3e-97 302 37 6 458 2 rocE Amino-acid permease RocE Bacillus subtilis (strain 168)
P42087 3.7e-96 300 36 4 450 3 hutM Putative histidine permease Bacillus subtilis (strain 168)
Q47689 4.87e-96 300 37 6 452 3 mmuP Probable S-methylmethionine permease Escherichia coli (strain K12)
P40812 6.24e-95 298 36 3 456 3 ansP L-asparagine permease Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O31462 1.22e-93 293 37 11 464 3 ybgF Uncharacterized amino acid permease YbgF Bacillus subtilis (strain 168)
P46349 1.29e-93 293 34 2 453 1 gabP Gamma-aminobutyric acid permease Bacillus subtilis (strain 168)
P77610 4.5e-93 293 35 5 457 3 ansP L-asparagine permease Escherichia coli (strain K12)
P9WQM7 1.8e-88 281 34 3 430 1 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM6 1.8e-88 281 34 3 430 3 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W1 1.8e-88 281 34 3 430 3 ansP2 L-asparagine permease 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A2RNZ6 4.66e-88 280 37 11 451 1 lysP Lysine-specific permease LysP Lactococcus lactis subsp. cremoris (strain MG1363)
P25527 5.43e-85 271 35 5 446 1 gabP Gamma-aminobutyric acid permease Escherichia coli (strain K12)
Q9X7P0 8.61e-85 271 33 6 457 3 ansP L-asparagine permease Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O32257 1.12e-84 270 35 3 405 2 yvbW Uncharacterized amino acid permease YvbW Bacillus subtilis (strain 168)
A2RI86 1.36e-84 270 35 6 447 1 serP2 DL-alanine permease SerP2 Lactococcus lactis subsp. cremoris (strain MG1363)
A2RI87 1.39e-84 270 34 8 461 1 serP1 Serine permease SerP1 Lactococcus lactis subsp. cremoris (strain MG1363)
Q46065 4.5e-80 258 39 6 404 1 aroP Aromatic amino acid transport protein AroP Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A2RI97 3.28e-74 243 34 6 415 3 hisP Histidine permease HisP Lactococcus lactis subsp. cremoris (strain MG1363)
P25737 1e-73 243 34 10 461 1 lysP Lysine-specific permease LysP Escherichia coli (strain K12)
Q9I703 4.26e-73 240 37 8 438 2 bauD Probable GABA permease Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7VEQ4 4.38e-72 238 33 2 398 3 ansP1 L-asparagine permease 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQM9 7.69e-72 238 33 2 403 1 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM8 7.69e-72 238 33 2 403 3 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O74543 1.95e-68 229 33 9 480 3 SPCC777.04 Uncharacterized amino-acid permease C777.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9C0V0 1.35e-64 219 32 7 441 3 SPCPB1C11.02 Probable amino-acid permease PB1C11.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2RMP5 3.68e-62 211 33 5 383 3 fywP Aromatic amino acid permease FywP Lactococcus lactis subsp. cremoris (strain MG1363)
Q6FNY1 1.83e-58 205 30 8 471 3 CAN1 Arginine permease CAN1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P32487 8.34e-58 203 31 5 439 1 LYP1 Lysine-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1D8PK89 1.03e-57 202 33 5 403 2 GAP2 General amino-acid permease GAP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9P5N2 3.27e-57 201 31 8 410 3 aat1 Amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P768 3.7e-56 198 31 11 437 3 SPAP7G5.06 Uncharacterized amino-acid permease P7G5.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9URZ4 7.53e-56 197 33 10 418 1 cat1 Cationic amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A1D8PN88 1.09e-55 197 31 5 397 2 HIP1 Amino-acid permease GAP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9P5N4 1.82e-55 196 31 10 419 3 SPBC359.01 Uncharacterized amino-acid permease C359.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P04817 2.46e-55 196 30 5 439 1 CAN1 Arginine permease CAN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O60170 1.4e-54 194 31 6 409 2 meu22 Probable amino-acid permease meu22 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P53388 1.61e-54 194 32 13 429 1 DIP5 Dicarboxylic amino acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5AG77 4.69e-53 190 29 5 405 2 GAP1 Amino-acid permease GAP1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A1D8PMB1 1.84e-52 189 28 4 402 2 GAP5 Amino-acid permease GAP5 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A1D8PPG4 1.19e-49 181 31 11 440 2 CAN3 Probable lysine/arginine permease CAN3 Candida albicans (strain SC5314 / ATCC MYA-2876)
B5BP45 6.4e-49 179 31 10 419 3 SPBC460.01c Uncharacterized amino-acid permease C460.01c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59WB3 8.94e-49 179 30 7 453 2 GAP4 S-adenosylmethionine permease GAP4 Candida albicans (strain SC5314 / ATCC MYA-2876)
P40901 2.35e-48 177 30 8 395 2 isp5 Sexual differentiation process putative amino-acid permease isp5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P34054 2.81e-48 177 29 5 395 2 inda1 Amino-acid permease inda1 Hypocrea atroviridis
Q9HDV2 4.42e-47 174 30 6 397 3 SPBPB2B2.01 Uncharacterized amino-acid permease PB2B2.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P06775 1.46e-46 172 28 4 410 1 HIP1 Histidine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P15380 3.31e-46 172 30 8 408 2 PUT4 Proline-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59WU0 5.16e-46 171 31 9 400 2 CAN2 Probable lysine/arginine permease CAN2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P43059 1.04e-45 170 29 8 409 3 CAN1 Lysine/arginine permease Candida albicans (strain WO-1)
A0A1D8PPI5 1.16e-45 170 29 8 409 2 CAN1 Lysine/arginine permease CAN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9URZ3 1.18e-45 169 29 10 439 3 put4 Probable proline-specific permease put4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38967 2.96e-45 169 29 8 425 1 TAT2 Tryptophan permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18696 9.6e-45 167 27 8 441 2 prnB Proline-specific permease Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P38971 2.44e-44 166 29 6 414 1 ALP1 Basic amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q876K6 8.62e-44 166 27 5 403 3 AGP1 General amino acid permease AGP1 Saccharomyces uvarum (strain ATCC 76518 / CBS 7001 / CLIB 283 / NBRC 10550 / MCYC 623 / NCYC 2669 / NRRL Y-11845)
A6ZTG5 2.76e-43 164 27 5 403 3 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain YJM789)
P41815 6.4e-43 162 28 7 406 1 BAP3 Valine amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25376 9.91e-43 162 27 5 403 1 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P94383 4.97e-42 157 27 6 400 3 ycgH Uncharacterized transporter YcgH Bacillus subtilis (strain 168)
P38084 7.82e-42 160 28 6 398 1 BAP2 Leu/Val/Ile amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P19145 3.48e-41 158 27 8 420 1 GAP1 General amino-acid permease GAP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P48813 8.53e-41 157 26 8 404 1 GNP1 High-affinity glutamine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1D8PNP3 3.55e-39 152 26 5 410 2 GAP6 Amino-acid permease GAP6 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q12372 1.08e-37 148 25 4 398 1 MMP1 S-methylmethionine permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O59831 1.6e-37 147 28 13 434 3 SPCC965.11c Uncharacterized amino-acid permease C965.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38085 1.31e-35 142 26 7 402 1 TAT1 Valine/tyrosine/tryptophan amino-acid permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43548 1.57e-34 139 23 5 452 1 AGP3 General amino acid permease AGP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08986 1.44e-33 136 27 5 394 1 SAM3 S-adenosylmethionine permease SAM3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92367 2.32e-33 135 25 6 398 3 aap1 Amino-acid permease 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38090 2.37e-33 135 25 7 430 1 AGP2 General amino acid permease AGP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45495 2.21e-30 119 37 0 166 3 None Uncharacterized transporter in pepV 3'region (Fragment) Lactobacillus delbrueckii subsp. lactis
Q03770 8.86e-22 102 24 15 482 1 SSY1 SPS-sensor component SSY1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2RHI9 9.21e-21 97 24 17 479 1 bcaP Branched-chain amino acid permease BcaP Lactococcus lactis subsp. cremoris (strain MG1363)
Q8BLQ7 2.22e-20 97 26 11 420 1 Slc7a4 Cationic amino acid transporter 4 Mus musculus
O43246 5.05e-20 96 27 6 334 1 SLC7A4 Cationic amino acid transporter 4 Homo sapiens
O07576 1.6e-18 91 23 12 469 1 bcaP Branched-chain amino acid permease BcaP Bacillus subtilis (strain 168)
O34739 2.22e-17 87 22 16 469 1 steT Serine/threonine exchanger SteT Bacillus subtilis (strain 168)
Q8GYB4 9.53e-17 86 22 8 414 2 CAT3 Cationic amino acid transporter 3, mitochondrial Arabidopsis thaliana
B0UYF2 1.12e-16 86 25 8 341 3 slc7a14a Probable cationic amino acid transporter Danio rerio
P30825 4.11e-16 84 23 11 415 1 SLC7A1 High affinity cationic amino acid transporter 1 Homo sapiens
Q9ASS7 1.25e-15 82 23 10 411 1 CAT2 Cationic amino acid transporter 2, vacuolar Arabidopsis thaliana
Q8W4K3 2.68e-15 81 24 9 346 1 CAT4 Cationic amino acid transporter 4, vacuolar Arabidopsis thaliana
Q45577 2.97e-15 81 23 14 426 1 aimA Glutamate/serine transporter AimA Bacillus subtilis (strain 168)
P52569 5.26e-15 80 23 12 437 1 SLC7A2 Cationic amino acid transporter 2 Homo sapiens
P18581 5.45e-15 80 24 13 444 1 Slc7a2 Cationic amino acid transporter 2 Mus musculus
A0JNI9 7.65e-15 80 26 12 346 2 SLC7A14 Solute carrier family 7 member 14 Bos taurus
Q8TBB6 9.14e-15 80 26 11 338 1 SLC7A14 Solute carrier family 7 member 14 Homo sapiens
Q6DCE8 1.35e-14 79 22 11 399 2 slc7a2 Cationic amino acid transporter 2 Xenopus laevis
Q8BXR1 2.2e-14 79 25 11 346 1 Slc7a14 Solute carrier family 7 member 14 Mus musculus
B3TP03 2.83e-14 78 21 9 438 2 SLC7A2 Cationic amino acid transporter 2 Gallus gallus
Q797A7 2.88e-14 78 22 16 478 3 mtrA Methylthioribose transporter Bacillus subtilis (strain 168)
P0AA47 2.92e-14 78 25 12 376 1 plaP Low-affinity putrescine importer PlaP Escherichia coli (strain K12)
P0AA48 2.92e-14 78 25 12 376 3 plaP Low-affinity putrescine importer PlaP Escherichia coli O157:H7
B5D5N9 3.88e-14 78 23 12 439 1 Slc7a2 Cationic amino acid transporter 2 Rattus norvegicus
A8I499 7.48e-14 77 22 11 436 2 SLC7A2 Cationic amino acid transporter 2 Sus scrofa
P76037 2.17e-13 75 23 5 265 1 puuP Putrescine importer PuuP Escherichia coli (strain K12)
O07002 2.49e-13 75 25 12 356 1 yveA Aspartate-proton symporter Bacillus subtilis (strain 168)
Q84MA5 1.08e-12 73 20 7 378 1 CAT1 Cationic amino acid transporter 1 Arabidopsis thaliana
O64759 1.17e-12 73 22 9 402 1 CAT5 Cationic amino acid transporter 5 Arabidopsis thaliana
Q9SHH0 1.3e-12 73 20 12 409 2 CAT8 Cationic amino acid transporter 8, vacuolar Arabidopsis thaliana
Q8WY07 3.13e-12 72 21 6 351 1 SLC7A3 Cationic amino acid transporter 3 Homo sapiens
P30823 1.35e-11 70 23 9 396 2 Slc7a1 High affinity cationic amino acid transporter 1 Rattus norvegicus
P70423 1.69e-11 70 24 9 346 1 Slc7a3 Cationic amino acid transporter 3 Mus musculus
Q9LZ20 5.41e-11 68 23 7 290 2 CAT6 Cationic amino acid transporter 6, chloroplastic Arabidopsis thaliana
Q8TCU3 1.59e-10 66 22 9 354 2 SLC7A13 Solute carrier family 7 member 13 Homo sapiens
Q9SQZ0 3.92e-10 65 25 6 256 3 CAT7 Cationic amino acid transporter 7, chloroplastic Arabidopsis thaliana
P60064 1.18e-09 63 24 13 421 3 adiC Arginine/agmatine antiporter Shigella flexneri
P60061 1.18e-09 63 24 13 421 1 adiC Arginine/agmatine antiporter Escherichia coli (strain K12)
P60062 1.18e-09 63 24 13 421 3 adiC Arginine/agmatine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P60063 1.18e-09 63 24 13 421 1 adiC Arginine/agmatine antiporter Escherichia coli O157:H7
P60066 1.31e-09 63 24 10 365 1 adiC Arginine/agmatine antiporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60065 1.31e-09 63 24 10 365 3 adiC Arginine/agmatine antiporter Salmonella typhi
O32204 3.63e-09 62 23 14 433 3 yvsH Putative arginine/ornithine antiporter Bacillus subtilis (strain 168)
Q8ZGS9 4.1e-09 62 23 11 393 3 adiC Arginine/agmatine antiporter Yersinia pestis
O34560 4.99e-09 61 22 7 339 3 yecA Uncharacterized amino acid permease YecA Bacillus subtilis (strain 168)
Q58026 1.55e-08 60 27 6 203 1 MJ0609 Uncharacterized protein MJ0609 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9WTR6 1.19e-07 57 21 16 455 1 Slc7a11 Cystine/glutamate transporter Mus musculus
O08812 1.2e-07 57 29 3 127 1 Slc7a3 Cationic amino acid transporter 3 Rattus norvegicus
Q09143 1.7e-07 57 27 3 177 1 Slc7a1 High affinity cationic amino acid transporter 1 Mus musculus
Q09143 9.79e-06 51 29 1 102 1 Slc7a1 High affinity cationic amino acid transporter 1 Mus musculus
Q9C5D6 2.99e-07 56 18 9 349 2 CAT9 Cationic amino acid transporter 9, chloroplastic Arabidopsis thaliana
Q7TZ67 3.28e-07 56 24 14 357 3 BQ2027_MB2001C Uncharacterized transporter Mb2001c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O87394 4.42e-07 55 22 7 257 3 R00093 Uncharacterized transporter R00093 Rhizobium meliloti (strain 1021)
P0AAF1 5.35e-07 55 19 9 371 1 potE Putrescine transporter PotE Escherichia coli (strain K12)
P0AAF2 5.35e-07 55 19 9 371 3 potE Putrescine transporter PotE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q92536 8.7e-07 55 21 16 447 1 SLC7A6 Y+L amino acid transporter 2 Homo sapiens
Q9UM01 9.05e-07 54 23 10 293 1 SLC7A7 Y+L amino acid transporter 1 Homo sapiens
A1L3M3 1.19e-06 54 24 14 312 2 slc7a6 Y+L amino acid transporter 2 Xenopus laevis
Q59I64 1.44e-06 54 22 11 323 2 slc7a6 Y+L amino acid transporter 2 Danio rerio
Q9UPY5 1.51e-06 54 24 15 385 1 SLC7A11 Cystine/glutamate transporter Homo sapiens
P9WQM5 1.6e-06 53 23 14 357 1 Rv1979c Uncharacterized transporter Rv1979c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM4 1.6e-06 53 23 14 357 3 MT2031 Uncharacterized transporter MT2031 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
D3ZMM8 1.86e-06 53 21 15 438 1 Slc7a6 Y+L amino acid transporter 2 Rattus norvegicus
Q8BGK6 1.91e-06 53 21 15 438 1 Slc7a6 Y+L amino acid transporter 2 Mus musculus
Q5PR34 2.71e-06 53 22 6 370 2 slc7a2 Cationic amino acid transporter 2 Danio rerio
Q28I80 3.23e-06 53 23 13 311 2 slc7a6 Y+L amino acid transporter 2 Xenopus tropicalis
Q91WN3 3.48e-06 52 20 12 408 1 Slc7a13 Solute carrier family 7 member 13 Mus musculus
Q5RAG7 3.53e-06 53 24 13 358 2 SLC7A11 Cystine/glutamate transporter Pongo abelii
Q8X845 6.68e-06 52 21 8 346 3 frlA Probable fructoselysine/psicoselysine transporter FrlA Escherichia coli O157:H7
P37034 9.35e-06 51 19 4 204 3 lpg1691 Uncharacterized transporter lpg1691 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P45539 1.05e-05 51 23 10 346 2 frlA Probable fructoselysine/psicoselysine transporter FrlA Escherichia coli (strain K12)
Q9R0S5 1.07e-05 51 23 10 293 1 Slc7a7 Y+L amino acid transporter 1 Rattus norvegicus
Q9Z1K8 2.29e-05 50 24 11 293 1 Slc7a7 Y+L amino acid transporter 1 Mus musculus
Q9CEY5 2.35e-05 50 25 5 219 3 aguD Probable agmatine/putrescine antiporter AguD Lactococcus lactis subsp. lactis (strain IL1403)
Q8VIE6 3.08e-05 50 22 12 345 1 Slc7a12 Solute carrier family 7 member 12 Mus musculus
P63116 4.87e-05 49 22 11 306 1 Slc7a10 Asc-type amino acid transporter 1 Rattus norvegicus
P63115 4.87e-05 49 22 11 306 1 Slc7a10 Asc-type amino acid transporter 1 Mus musculus
Q22397 9.72e-05 48 23 12 281 1 aat-6 Amino acid transporter protein 6 Caenorhabditis elegans
P44768 0.000102 48 22 3 195 3 potE Putrescine transporter PotE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P63350 0.000124 48 20 7 328 3 BQ2027_MB2022C Uncharacterized transporter Mb2022c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQM3 0.000124 48 20 7 328 1 Rv1999c Uncharacterized transporter Rv1999c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM2 0.000124 48 20 7 328 3 MT2055 Uncharacterized transporter MT2055 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AAE8 0.000159 47 21 1 153 1 cadB Cadaverine/lysine antiporter Escherichia coli (strain K12)
P0AAE9 0.000159 47 21 1 153 3 cadB Cadaverine/lysine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF0 0.000159 47 21 1 153 3 cadB Cadaverine/lysine antiporter Escherichia coli O157:H7
Q9FFL1 0.000178 47 23 13 386 1 RMV1 Polyamine transporter RMV1 Arabidopsis thaliana
P58229 0.000494 46 25 8 234 3 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli O157:H7
P63236 0.000526 46 25 8 234 3 gadC Glutamate/gamma-aminobutyrate antiporter Shigella flexneri
P63235 0.000526 46 25 8 234 1 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli (strain K12)
Q8FHG6 0.000583 45 25 8 234 3 gadC Glutamate/gamma-aminobutyrate antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O53092 0.000609 45 32 3 98 3 arcD Arginine/ornithine antiporter Latilactobacillus sakei
Q01650 0.001 45 23 7 245 1 SLC7A5 Large neutral amino acids transporter small subunit 1 Homo sapiens

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18375
Feature type CDS
Gene proY
Product L-asparagine transporter or related permease
Location 21290 - 22651 (strand: 1)
Length 1362 (nucleotides) / 453 (amino acids)
In genomic island -

Contig

Accession ZDB_705
Length 25512 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_489
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00324 Amino acid permease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1113 Amino acid transport and metabolism (E) E L-asparagine transporter or related permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K16234 histidine transporter - -

Protein Sequence

MKENNTALRRGLTGRHIRFMALGSAIGTGLFYGSAASIEQAGPAVLLAYLIGGAAVFMVMRALGEMAVHHPVPGSFSQYASHYMGPLAGFLTGWNYVFEMLIVCLADVTAFGFYMKLWFPDVDQWIWVLGIVCFIGALNLCHVKIFGEMEFWLSIVKVTAIIAMIVGGAAIMLFGFGQETAHPTGISNLWEFGGFMPNGISGVIASLAIVMFAFGGIEVIGITASEAQNPEKTIPKAINAVPLRILLFYVLTLFILMCIFPWNQIGHNGSPFVQIFEKLNISYAANILNLVVITAAVSAINSDIFGAGRMMYGMAQEGQAPKSFMKLTKNGVPWMTVLVMSAVLLVGVVLNYLIPEKIFIIIASIATFATVWVWLMILLSQVAMRRKMKPEEVKTLKFPVPMWPVAPALTIAFMVFVIALLGYFPDTRVALMVGIAWVVILTVGYFAGVKKRV

Flanking regions ( +/- flanking 50bp)

TTCACATCAGTAAAAACGCTGCTAATCATGACAGCGACAGGATTAATTACATGAAAGAAAATAATACGGCGCTACGACGGGGGCTTACAGGGCGGCACATCCGCTTTATGGCACTCGGATCGGCGATAGGTACCGGCCTGTTTTACGGCTCGGCAGCCTCTATTGAGCAGGCGGGTCCTGCTGTTCTGCTGGCCTACCTTATCGGGGGTGCGGCAGTCTTTATGGTGATGCGTGCGCTGGGCGAAATGGCAGTCCACCATCCGGTACCGGGTTCATTTTCACAATATGCCAGCCATTATATGGGGCCGCTCGCCGGGTTCCTCACCGGCTGGAACTATGTTTTTGAGATGCTGATTGTCTGTCTCGCGGACGTCACCGCCTTCGGCTTCTATATGAAGCTCTGGTTCCCGGATGTCGATCAGTGGATCTGGGTGCTGGGGATTGTGTGTTTCATTGGTGCGCTGAATTTATGTCACGTGAAGATATTCGGGGAGATGGAGTTCTGGCTCTCGATTGTCAAAGTGACCGCAATTATCGCCATGATTGTCGGCGGCGCGGCGATTATGCTGTTCGGCTTCGGCCAGGAAACCGCACATCCTACCGGTATCAGTAACTTATGGGAATTCGGCGGCTTTATGCCGAACGGAATAAGCGGGGTAATAGCCTCACTGGCCATTGTGATGTTTGCCTTCGGCGGCATTGAAGTGATCGGTATCACTGCCAGTGAAGCACAAAACCCGGAAAAAACCATTCCGAAAGCGATCAACGCAGTACCGCTGCGTATTCTGCTGTTCTATGTGCTGACACTGTTTATCCTGATGTGTATCTTCCCGTGGAACCAGATCGGCCATAACGGCAGCCCGTTTGTGCAGATTTTCGAGAAACTGAATATCTCCTACGCTGCTAATATTCTGAACCTCGTGGTGATCACCGCAGCCGTTTCCGCCATTAACAGTGATATCTTCGGCGCAGGCCGGATGATGTACGGCATGGCGCAGGAAGGTCAGGCACCGAAATCCTTTATGAAGCTCACCAAAAACGGTGTGCCGTGGATGACAGTTCTGGTGATGAGTGCAGTTCTGCTGGTCGGCGTGGTGCTTAACTACCTGATCCCGGAAAAAATCTTCATCATTATCGCCTCTATCGCAACCTTCGCGACCGTCTGGGTCTGGCTGATGATTCTGTTATCTCAGGTGGCAATGCGCCGTAAGATGAAACCGGAAGAGGTCAAAACCCTGAAATTCCCTGTACCGATGTGGCCGGTTGCGCCCGCTCTGACCATCGCCTTTATGGTCTTTGTGATCGCCCTTCTGGGTTACTTCCCGGATACACGTGTGGCACTGATGGTGGGGATTGCCTGGGTGGTAATTCTGACTGTTGGTTATTTTGCCGGTGTGAAAAAACGGGTATAAACAGACAGCTCACTGTTCTGAAAACACGAAACCGGGTGAATCATACACCC