Homologs in group_2162

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16270 FBDBKF_16270 100.0 Morganella morganii S1 coaD pantetheine-phosphate adenylyltransferase
EHELCC_16305 EHELCC_16305 100.0 Morganella morganii S2 coaD pantetheine-phosphate adenylyltransferase
NLDBIP_17035 NLDBIP_17035 100.0 Morganella morganii S4 coaD pantetheine-phosphate adenylyltransferase
LHKJJB_16955 LHKJJB_16955 100.0 Morganella morganii S3 coaD pantetheine-phosphate adenylyltransferase
F4V73_RS17320 F4V73_RS17320 91.9 Morganella psychrotolerans coaD pantetheine-phosphate adenylyltransferase
PMI_RS15650 PMI_RS15650 81.4 Proteus mirabilis HI4320 coaD pantetheine-phosphate adenylyltransferase

Distribution of the homologs in the orthogroup group_2162

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2162

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MY37 1.55e-97 281 80 0 160 3 coaD Phosphopantetheine adenylyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8RSX4 1.09e-95 276 81 0 160 3 coaD Phosphopantetheine adenylyltransferase Proteus mirabilis
B4F0X7 1.09e-95 276 81 0 160 3 coaD Phosphopantetheine adenylyltransferase Proteus mirabilis (strain HI4320)
B1JQW9 4.54e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B2JYN7 4.54e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FCT8 4.54e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66GD2 5.35e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSD3 5.47e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pestis (strain Pestoides F)
Q1CD06 5.47e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R678 5.47e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJN9 5.47e-81 239 68 0 159 1 coaD Phosphopantetheine adenylyltransferase Yersinia pestis
Q1C271 5.47e-81 239 68 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JHR9 8.75e-80 236 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P0A6I8 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella flexneri
Q0SYG2 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella flexneri serotype 5b (strain 8401)
Q31UZ2 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TTU8 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LK71 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I3L1 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain SE11)
P0A6I6 7.75e-79 233 67 0 159 1 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain K12)
B1IZF9 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A696 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O9:H4 (strain HS)
B1X968 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain K12 / DH10B)
C4ZXM6 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M4B8 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O8 (strain IAI1)
B5YWD2 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6I7 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O157:H7
B7L747 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZTI5 7.75e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LVJ5 9.97e-79 233 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8ARM1 1.04e-78 233 68 0 158 3 coaD Phosphopantetheine adenylyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1R4V9 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli (strain UTI89 / UPEC)
B7NET8 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FC88 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBH5 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N1T5 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O81 (strain ED1a)
B7MFJ5 4.62e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A9MKP0 6.49e-78 231 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7NPE0 6.71e-78 231 67 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9X980 1.58e-77 230 65 0 161 3 coaD Phosphopantetheine adenylyltransferase Serratia marcescens
Q3YVZ6 1.82e-77 230 66 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella sonnei (strain Ss046)
Q8ZL48 2.26e-77 230 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7ULI9 2.95e-77 229 66 0 159 3 coaD Phosphopantetheine adenylyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4TZX6 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MVM9 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SXD6 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella newport (strain SL254)
B4T9B9 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella heidelberg (strain SL476)
B5RGF3 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5F8 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FM58 3.51e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella dublin (strain CT_02021853)
C0Q1W7 4.28e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella paratyphi C (strain RKS4594)
Q57IA8 4.28e-77 229 67 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella choleraesuis (strain SC-B67)
A4W515 7.23e-77 228 67 0 158 1 coaD Phosphopantetheine adenylyltransferase Enterobacter sp. (strain 638)
Q329M3 7.56e-77 228 66 0 159 3 coaD Phosphopantetheine adenylyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B5EXD9 1.4e-76 228 66 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella agona (strain SL483)
Q8Z2H1 1.86e-76 228 66 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella typhi
B5BI08 1.86e-76 228 66 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PC10 1.86e-76 228 66 0 158 3 coaD Phosphopantetheine adenylyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8GLE1 2.07e-76 228 66 0 159 3 coaD Phosphopantetheine adenylyltransferase Serratia proteamaculans (strain 568)
C6DIB6 7.13e-75 223 63 0 158 3 coaD Phosphopantetheine adenylyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q9XC89 1.39e-74 223 65 0 158 1 coaD Phosphopantetheine adenylyltransferase Klebsiella pneumoniae
A6TFM5 1.39e-74 223 65 0 158 3 coaD Phosphopantetheine adenylyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XTG9 1.95e-74 222 65 0 158 3 coaD Phosphopantetheine adenylyltransferase Klebsiella pneumoniae (strain 342)
C5B9D9 2.16e-74 222 63 0 161 3 coaD Phosphopantetheine adenylyltransferase Edwardsiella ictaluri (strain 93-146)
Q6DAV2 6.66e-74 221 62 0 158 3 coaD Phosphopantetheine adenylyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VF71 1.63e-72 218 62 0 158 3 coaD Phosphopantetheine adenylyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8VW75 1.82e-71 215 58 0 158 3 coaD Phosphopantetheine adenylyltransferase Photobacterium damsela subsp. piscicida
Q1IGF0 8.94e-69 208 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas entomophila (strain L48)
Q88AH3 9.24e-69 208 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A3QJB0 9.87e-69 208 59 0 157 3 coaD Phosphopantetheine adenylyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0KN77 1.02e-68 208 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas putida (strain GB-1)
Q3K569 1.08e-68 208 57 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas fluorescens (strain Pf0-1)
B1J2E9 1.11e-68 208 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas putida (strain W619)
Q4ZM37 1.2e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q9I6D1 1.78e-68 207 56 0 157 1 coaD Phosphopantetheine adenylyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02U51 1.78e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V2S6 1.78e-68 207 56 0 157 1 coaD Phosphopantetheine adenylyltransferase Pseudomonas aeruginosa (strain LESB58)
C3K3N4 2.01e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas fluorescens (strain SBW25)
Q4K4A7 2.01e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A0L2N9 2.34e-68 207 59 0 161 3 coaD Phosphopantetheine adenylyltransferase Shewanella sp. (strain ANA-3)
A5WAF7 2.67e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88CQ7 2.7e-68 207 56 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0HPJ5 3.4e-68 207 59 0 161 3 coaD Phosphopantetheine adenylyltransferase Shewanella sp. (strain MR-7)
Q0HDB6 3.4e-68 207 59 0 161 3 coaD Phosphopantetheine adenylyltransferase Shewanella sp. (strain MR-4)
B8CVD4 6.01e-68 206 59 0 157 3 coaD Phosphopantetheine adenylyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q6LVM8 7.73e-68 206 57 0 158 3 coaD Phosphopantetheine adenylyltransferase Photobacterium profundum (strain SS9)
B4S2C7 8.16e-68 206 58 0 160 3 coaD Phosphopantetheine adenylyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8FPF5 8.63e-68 206 60 0 155 3 coaD Phosphopantetheine adenylyltransferase Shewanella sediminis (strain HAW-EB3)
A4YCB1 1.02e-67 206 59 0 158 3 coaD Phosphopantetheine adenylyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RE18 1.29e-67 205 59 0 158 3 coaD Phosphopantetheine adenylyltransferase Shewanella sp. (strain W3-18-1)
B0TMZ9 1.48e-67 205 59 0 157 3 coaD Phosphopantetheine adenylyltransferase Shewanella halifaxensis (strain HAW-EB4)
Q3IHU4 2.09e-67 205 60 0 159 3 coaD Phosphopantetheine adenylyltransferase Pseudoalteromonas translucida (strain TAC 125)
B1KL36 4.04e-67 204 59 0 157 3 coaD Phosphopantetheine adenylyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A8HA30 8.98e-67 203 59 0 157 3 coaD Phosphopantetheine adenylyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
C1DIB2 9.81e-67 203 55 0 155 3 coaD Phosphopantetheine adenylyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A0KEN4 1.12e-66 203 56 0 160 3 coaD Phosphopantetheine adenylyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A7MQ98 1.13e-66 202 63 0 158 3 coaD Phosphopantetheine adenylyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
A4STC9 1.23e-66 202 56 0 160 3 coaD Phosphopantetheine adenylyltransferase Aeromonas salmonicida (strain A449)
A4Y022 1.81e-66 202 55 0 157 3 coaD Phosphopantetheine adenylyltransferase Pseudomonas mendocina (strain ymp)
A9KWX0 4.49e-66 201 60 0 151 3 coaD Phosphopantetheine adenylyltransferase Shewanella baltica (strain OS195)
Q8E8I0 6.44e-66 201 60 0 151 3 coaD Phosphopantetheine adenylyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2NQU5 1.16e-65 200 56 0 158 3 coaD Phosphopantetheine adenylyltransferase Sodalis glossinidius (strain morsitans)
A6WUF6 1.69e-65 200 60 0 151 3 coaD Phosphopantetheine adenylyltransferase Shewanella baltica (strain OS185)
B8EDR6 1.69e-65 200 60 0 151 3 coaD Phosphopantetheine adenylyltransferase Shewanella baltica (strain OS223)
A3CYP1 2.32e-65 199 60 0 151 3 coaD Phosphopantetheine adenylyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q5QUN6 4.87e-65 199 59 0 158 3 coaD Phosphopantetheine adenylyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q07W63 6.98e-65 198 55 0 160 3 coaD Phosphopantetheine adenylyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q12SS1 2.51e-64 197 56 0 159 3 coaD Phosphopantetheine adenylyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q15ZV3 1.14e-63 195 56 0 158 3 coaD Phosphopantetheine adenylyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7MPS0 3.82e-62 191 54 0 155 3 coaD Phosphopantetheine adenylyltransferase Vibrio vulnificus (strain YJ016)
Q8DDY6 3.82e-62 191 54 0 155 3 coaD Phosphopantetheine adenylyltransferase Vibrio vulnificus (strain CMCP6)
B0V8I3 5.31e-62 191 54 0 156 1 coaD Phosphopantetheine adenylyltransferase Acinetobacter baumannii (strain AYE)
B2HUN5 5.31e-62 191 54 0 156 1 coaD Phosphopantetheine adenylyltransferase Acinetobacter baumannii (strain ACICU)
A1U6M5 4.64e-61 189 50 0 158 3 coaD Phosphopantetheine adenylyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B0VTH7 5.96e-61 188 53 0 156 1 coaD Phosphopantetheine adenylyltransferase Acinetobacter baumannii (strain SDF)
C3LQI4 9.53e-61 188 54 0 155 3 coaD Phosphopantetheine adenylyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KVC4 9.53e-61 188 54 0 155 3 coaD Phosphopantetheine adenylyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F408 9.53e-61 188 54 0 155 3 coaD Phosphopantetheine adenylyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C5BLM4 1.96e-60 187 53 0 154 3 coaD Phosphopantetheine adenylyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q6F8K0 2.78e-60 187 53 0 156 3 coaD Phosphopantetheine adenylyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B6EPN7 5.93e-60 186 51 0 158 3 coaD Phosphopantetheine adenylyltransferase Aliivibrio salmonicida (strain LFI1238)
Q5E8L9 5.99e-60 186 51 0 161 3 coaD Phosphopantetheine adenylyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q31EA3 1.79e-59 184 49 0 157 3 coaD Phosphopantetheine adenylyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
C4K764 4.55e-59 183 51 0 156 3 coaD Phosphopantetheine adenylyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B8D8A3 7.23e-59 183 50 1 160 3 coaD Phosphopantetheine adenylyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57643 7.23e-59 183 50 1 160 3 coaD Phosphopantetheine adenylyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8E6 7.23e-59 183 50 1 160 3 coaD Phosphopantetheine adenylyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q60CN9 2.36e-58 182 48 0 158 3 coaD Phosphopantetheine adenylyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SN79 7.96e-58 180 50 0 154 3 coaD Phosphopantetheine adenylyltransferase Hahella chejuensis (strain KCTC 2396)
C4L7W3 8.2e-58 181 48 0 157 3 coaD Phosphopantetheine adenylyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1LRQ5 1.93e-57 179 47 0 157 3 coaD Phosphopantetheine adenylyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q87T80 3.07e-57 179 47 0 157 3 coaD Phosphopantetheine adenylyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B8GUN6 1.11e-56 177 51 0 159 3 coaD Phosphopantetheine adenylyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B7VHL5 1.29e-56 177 48 0 154 3 coaD Phosphopantetheine adenylyltransferase Vibrio atlanticus (strain LGP32)
Q1H3D2 1.54e-56 177 50 0 157 3 coaD Phosphopantetheine adenylyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q65R52 1.99e-56 177 48 0 157 3 coaD Phosphopantetheine adenylyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5GZV9 5.26e-56 176 50 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SIL3 5.26e-56 176 50 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2V0 5.26e-56 176 50 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q0KEQ3 5.98e-56 176 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A7MSN5 7.38e-56 175 47 0 157 3 coaD Phosphopantetheine adenylyltransferase Vibrio campbellii (strain ATCC BAA-1116)
B2AGT3 8.39e-56 175 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3BS23 1.52e-55 175 49 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PJK5 1.55e-55 175 49 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q4QMR6 3.5e-55 174 48 0 155 3 coaD Phosphopantetheine adenylyltransferase Haemophilus influenzae (strain 86-028NP)
B2UER1 4.15e-55 174 46 0 157 3 coaD Phosphopantetheine adenylyltransferase Ralstonia pickettii (strain 12J)
Q476G3 4.67e-55 173 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8Y2E6 4.89e-55 174 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1XS68 7.04e-55 173 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q9Z613 3.32e-54 171 46 1 159 3 coaD Phosphopantetheine adenylyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q820N3 3.73e-54 171 47 0 157 3 coaD Phosphopantetheine adenylyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B4SS16 6.57e-54 171 48 0 150 3 coaD Phosphopantetheine adenylyltransferase Stenotrophomonas maltophilia (strain R551-3)
B2FLW4 7.49e-54 171 48 0 150 3 coaD Phosphopantetheine adenylyltransferase Stenotrophomonas maltophilia (strain K279a)
Q0ADM4 8.99e-54 170 48 0 154 3 coaD Phosphopantetheine adenylyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P44805 1.12e-53 170 47 0 155 3 coaD Phosphopantetheine adenylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9PEP8 1.16e-53 170 49 2 155 3 coaD Phosphopantetheine adenylyltransferase Xylella fastidiosa (strain 9a5c)
P71154 1.29e-53 169 45 1 159 3 coaD Phosphopantetheine adenylyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q7VTP4 1.44e-53 170 47 0 153 3 coaD Phosphopantetheine adenylyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W154 1.44e-53 170 47 0 153 3 coaD Phosphopantetheine adenylyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WNU4 1.44e-53 170 47 0 153 3 coaD Phosphopantetheine adenylyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A4T072 1.99e-53 169 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8P857 2.01e-53 169 48 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVY5 2.01e-53 169 48 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas campestris pv. campestris (strain 8004)
A9I6L9 2.21e-53 169 45 0 153 3 coaD Phosphopantetheine adenylyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0RRP8 2.34e-53 169 48 0 152 3 coaD Phosphopantetheine adenylyltransferase Xanthomonas campestris pv. campestris (strain B100)
A5UHE3 2.57e-53 169 47 0 155 3 coaD Phosphopantetheine adenylyltransferase Haemophilus influenzae (strain PittGG)
A1K3H4 2.93e-53 169 47 0 154 3 coaD Phosphopantetheine adenylyltransferase Azoarcus sp. (strain BH72)
B0U1Z4 3.61e-53 169 49 2 155 3 coaD Phosphopantetheine adenylyltransferase Xylella fastidiosa (strain M12)
Q2KY40 3.74e-53 169 45 0 153 3 coaD Phosphopantetheine adenylyltransferase Bordetella avium (strain 197N)
B1ZWG7 4.41e-53 168 47 0 154 3 coaD Phosphopantetheine adenylyltransferase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q9CLD4 7.07e-53 168 48 1 156 3 coaD Phosphopantetheine adenylyltransferase Pasteurella multocida (strain Pm70)
Q87EM8 7.26e-53 168 48 2 155 3 coaD Phosphopantetheine adenylyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7J1 7.26e-53 168 48 2 155 3 coaD Phosphopantetheine adenylyltransferase Xylella fastidiosa (strain M23)
A4JI00 8.71e-53 168 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9AEW9 8.71e-53 168 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BBQ0 8.71e-53 168 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YN57 8.71e-53 168 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia ambifaria (strain MC40-6)
A5UE83 9.11e-53 167 47 0 155 3 coaD Phosphopantetheine adenylyltransferase Haemophilus influenzae (strain PittEE)
Q5P730 1.07e-52 167 46 0 154 3 coaD Phosphopantetheine adenylyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0A592 1.2e-52 167 45 1 159 3 coaD Phosphopantetheine adenylyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A0AKF8 1.31e-52 167 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5WYZ4 2.19e-52 167 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Legionella pneumophila (strain Lens)
Q5ZY26 2.19e-52 167 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q3SLS2 2.29e-52 166 46 0 154 3 coaD Phosphopantetheine adenylyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q145X7 2.49e-52 167 45 0 154 3 coaD Phosphopantetheine adenylyltransferase Paraburkholderia xenovorans (strain LB400)
Q2T1C2 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63XM3 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia pseudomallei (strain K96243)
A3N5J6 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia pseudomallei (strain 668)
Q3JW91 3.16e-52 166 44 0 154 1 coaD Phosphopantetheine adenylyltransferase Burkholderia pseudomallei (strain 1710b)
A3NR92 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia pseudomallei (strain 1106a)
A1UZP1 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia mallei (strain SAVP1)
Q62FB8 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia mallei (strain ATCC 23344)
A2S6B1 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia mallei (strain NCTC 10229)
A3MQB0 3.16e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia mallei (strain NCTC 10247)
Q39CT5 3.64e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q929W5 4.66e-52 166 46 0 156 3 coaD Phosphopantetheine adenylyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8I385 5.68e-52 166 45 0 155 3 coaD Phosphopantetheine adenylyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B2SXG0 6.8e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q1BTG1 7.01e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia orbicola (strain AU 1054)
B1JYQ4 7.01e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia orbicola (strain MC0-3)
B4EAQ8 7.01e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0KAN0 7.01e-52 166 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Burkholderia cenocepacia (strain HI2424)
A6T2S8 9.07e-52 165 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Janthinobacterium sp. (strain Marseille)
A4G927 1.11e-51 165 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Herminiimonas arsenicoxydans
Q0I593 1.29e-51 164 46 0 155 3 coaD Phosphopantetheine adenylyltransferase Histophilus somni (strain 129Pt)
B0URI7 1.32e-51 164 46 0 155 3 coaD Phosphopantetheine adenylyltransferase Histophilus somni (strain 2336)
Q2Y5F0 1.37e-51 165 48 0 143 3 coaD Phosphopantetheine adenylyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5X7J6 1.4e-51 165 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Legionella pneumophila (strain Paris)
A6VM51 1.64e-51 164 46 1 157 3 coaD Phosphopantetheine adenylyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q8Y5K7 1.69e-51 164 45 0 154 3 coaD Phosphopantetheine adenylyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DH77 1.69e-51 164 45 0 154 3 coaD Phosphopantetheine adenylyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q7VNN7 4.47e-51 163 45 0 157 3 coaD Phosphopantetheine adenylyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F6N2 4.93e-51 163 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
B2JCN4 6.06e-51 163 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B0BQ73 6.66e-51 163 44 0 157 3 coaD Phosphopantetheine adenylyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A7GYG9 8.97e-51 162 48 0 150 3 coaD Phosphopantetheine adenylyltransferase Campylobacter curvus (strain 525.92)
A7ZDJ9 1e-50 162 46 0 154 3 coaD Phosphopantetheine adenylyltransferase Campylobacter concisus (strain 13826)
A1WZG0 1.16e-50 162 45 1 162 3 coaD Phosphopantetheine adenylyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q1QTC8 1.2e-50 162 47 0 155 3 coaD Phosphopantetheine adenylyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0TGU9 1.64e-50 162 45 0 157 3 coaD Phosphopantetheine adenylyltransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
C4XSE1 1.7e-50 162 43 0 157 3 coaD Phosphopantetheine adenylyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q5L0Z6 1.9e-50 162 41 0 159 3 coaD Phosphopantetheine adenylyltransferase Geobacillus kaustophilus (strain HTA426)
B5FFG3 2.33e-50 161 44 0 158 3 coaD Phosphopantetheine adenylyltransferase Aliivibrio fischeri (strain MJ11)
Q71XW2 2.51e-50 161 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KX05 2.51e-50 161 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q2IIM3 2.55e-50 161 43 0 160 3 coaD Phosphopantetheine adenylyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
A3N1D7 2.94e-50 161 43 0 157 3 coaD Phosphopantetheine adenylyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B9L9C2 3.45e-50 160 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B3GY20 3.54e-50 161 43 0 157 3 coaD Phosphopantetheine adenylyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
C4Z0C3 3.93e-50 161 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
B9M4U3 5e-50 160 44 0 156 3 coaD Phosphopantetheine adenylyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B9DPV4 6.42e-50 160 44 0 159 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus carnosus (strain TM300)
A7HC22 6.45e-50 160 44 0 155 3 coaD Phosphopantetheine adenylyltransferase Anaeromyxobacter sp. (strain Fw109-5)
A5V280 8.56e-50 160 41 2 163 3 coaD Phosphopantetheine adenylyltransferase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q65JZ9 8.96e-50 160 42 0 160 3 coaD Phosphopantetheine adenylyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B4UCU5 9.78e-50 160 43 0 160 3 coaD Phosphopantetheine adenylyltransferase Anaeromyxobacter sp. (strain K)
B8J9D7 9.78e-50 160 43 0 160 3 coaD Phosphopantetheine adenylyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q8ER64 1.1e-49 160 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q491X2 1.15e-49 160 44 0 158 3 coaD Phosphopantetheine adenylyltransferase Blochmanniella pennsylvanica (strain BPEN)
A5IJ44 1.29e-49 159 46 0 155 3 coaD Phosphopantetheine adenylyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A7I1U3 1.82e-49 159 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A4XKE2 1.87e-49 159 44 0 147 3 coaD Phosphopantetheine adenylyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B1L7W5 1.89e-49 159 46 0 155 3 coaD Phosphopantetheine adenylyltransferase Thermotoga sp. (strain RQ2)
Q9WZK0 1.89e-49 159 46 0 155 1 coaD Phosphopantetheine adenylyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8R9U9 2.26e-49 159 44 0 157 3 coaD Phosphopantetheine adenylyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6TRV0 3.83e-49 158 50 0 153 3 coaD Phosphopantetheine adenylyltransferase Alkaliphilus metalliredigens (strain QYMF)
B9MRM3 6.64e-49 158 43 0 147 3 coaD Phosphopantetheine adenylyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B1HPW8 8.14e-49 157 42 0 155 3 coaD Phosphopantetheine adenylyltransferase Lysinibacillus sphaericus (strain C3-41)
A9KNU8 8.6e-49 157 43 0 153 3 coaD Phosphopantetheine adenylyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B0K1X4 9.25e-49 157 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Thermoanaerobacter sp. (strain X514)
B0K9Z1 9.25e-49 157 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B5YK79 9.32e-49 157 44 1 161 3 coaD Phosphopantetheine adenylyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
C4L5T1 1.02e-48 157 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A5CX55 1.03e-48 157 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A5G4G0 1.35e-48 157 43 0 158 3 coaD Phosphopantetheine adenylyltransferase Geotalea uraniireducens (strain Rf4)
A3DEX9 2.08e-48 156 42 0 155 3 coaD Phosphopantetheine adenylyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q4L5D8 2.46e-48 156 42 0 159 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus haemolyticus (strain JCSC1435)
A8FCW1 2.78e-48 156 40 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus pumilus (strain SAFR-032)
A7Z4C5 3.9e-48 155 43 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2RHB8 4.85e-48 155 43 0 155 3 coaD Phosphopantetheine adenylyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A4ILY8 5.31e-48 155 40 0 161 3 coaD Phosphopantetheine adenylyltransferase Geobacillus thermodenitrificans (strain NG80-2)
A7GRV8 6.07e-48 155 42 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q310R6 1.54e-47 154 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0RPD1 1.65e-47 154 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
Q5N092 1.78e-47 154 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55235 1.78e-47 154 44 0 154 3 coaD Phosphopantetheine adenylyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C1CY24 1.8e-47 154 41 2 155 3 coaD Phosphopantetheine adenylyltransferase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q8XJM7 1.82e-47 154 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Clostridium perfringens (strain 13 / Type A)
Q83EM7 2.12e-47 154 45 1 160 1 coaD Phosphopantetheine adenylyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NB23 2.12e-47 154 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KCX4 2.12e-47 154 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Coxiella burnetii (strain Dugway 5J108-111)
B6J216 2.12e-47 154 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Coxiella burnetii (strain CbuG_Q212)
B6J5S3 2.12e-47 154 45 1 160 3 coaD Phosphopantetheine adenylyltransferase Coxiella burnetii (strain CbuK_Q154)
Q0TPM5 2.19e-47 154 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C5D8K3 2.53e-47 154 39 0 159 3 coaD Phosphopantetheine adenylyltransferase Geobacillus sp. (strain WCH70)
Q1J1P5 2.78e-47 154 38 2 158 3 coaD Phosphopantetheine adenylyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q7VGG0 2.78e-47 154 43 0 151 3 coaD Phosphopantetheine adenylyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8EYP6 2.84e-47 154 42 0 160 3 coaD Phosphopantetheine adenylyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72M66 2.84e-47 154 42 0 160 3 coaD Phosphopantetheine adenylyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A9AWY7 3.28e-47 154 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q0SS92 3.51e-47 154 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Clostridium perfringens (strain SM101 / Type A)
A5IH08 3.84e-47 153 41 0 157 3 coaD Phosphopantetheine adenylyltransferase Legionella pneumophila (strain Corby)
A8MHA0 4.1e-47 153 45 0 154 3 coaD Phosphopantetheine adenylyltransferase Alkaliphilus oremlandii (strain OhILAs)
A5N7Z7 5.67e-47 153 44 0 159 3 coaD Phosphopantetheine adenylyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E1F8 5.67e-47 153 44 0 159 3 coaD Phosphopantetheine adenylyltransferase Clostridium kluyveri (strain NBRC 12016)
A6LKD2 6.32e-47 152 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q9K9Q6 6.38e-47 153 39 0 161 3 coaD Phosphopantetheine adenylyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A9BAE9 6.7e-47 152 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9211)
B9EB42 7.35e-47 153 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Macrococcus caseolyticus (strain JCSC5402)
Q3AC43 8.71e-47 152 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1YIV1 8.96e-47 152 40 0 161 3 coaD Phosphopantetheine adenylyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A1WBK4 1.43e-46 152 40 0 156 3 coaD Phosphopantetheine adenylyltransferase Acidovorax sp. (strain JS42)
B9MF03 1.43e-46 152 40 0 156 3 coaD Phosphopantetheine adenylyltransferase Acidovorax ebreus (strain TPSY)
B3DYW1 1.75e-46 152 42 1 159 3 coaD Phosphopantetheine adenylyltransferase Methylacidiphilum infernorum (isolate V4)
B3ECH9 2.36e-46 152 42 2 163 3 coaD Phosphopantetheine adenylyltransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q819P1 2.56e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H6R5 2.56e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain B4264)
B7IVG6 2.56e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain G9842)
Q6MQ60 2.87e-46 151 41 0 160 3 coaD Phosphopantetheine adenylyltransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q6HEN5 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q635Z7 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain ZK / E33L)
B9IW07 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain Q1)
B7HMA9 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain AH187)
C1EPU3 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain 03BB102)
Q732D8 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JK17 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus cereus (strain AH820)
Q81W43 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus anthracis
A0RHU9 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus thuringiensis (strain Al Hakam)
C3LHZ4 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P6T7 3.12e-46 151 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus anthracis (strain A0248)
Q5SJS9 3.31e-46 151 38 1 157 1 coaD Phosphopantetheine adenylyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72K87 3.31e-46 151 38 1 157 3 coaD Phosphopantetheine adenylyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B4SGQ2 3.36e-46 151 44 2 159 3 coaD Phosphopantetheine adenylyltransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
P63820 3.46e-46 151 41 0 156 1 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain MW2)
A8Z1Q8 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA90 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain MSSA476)
Q6GHW1 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain MRSA252)
P63819 3.46e-46 151 41 0 156 1 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain N315)
P63818 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFX8 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain Newman)
Q5HGV9 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain COL)
Q2YXA0 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IS11 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain JH9)
Q2FZF5 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHV6 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain USA300)
A6U0U2 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain JH1)
A7X140 3.46e-46 151 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CSZ5 3.98e-46 150 41 0 157 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQ42 3.98e-46 150 41 0 157 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1XNE8 4.03e-46 151 43 0 152 3 coaD Phosphopantetheine adenylyltransferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A9VU91 4.05e-46 150 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Bacillus mycoides (strain KBAB4)
Q056E9 4.5e-46 150 42 0 160 3 coaD Phosphopantetheine adenylyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04P85 4.5e-46 150 42 0 160 3 coaD Phosphopantetheine adenylyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A8G4U2 5.57e-46 150 41 0 153 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9215)
B1I2E4 6.69e-46 150 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Desulforudis audaxviator (strain MP104C)
B2TJ12 9.67e-46 150 42 0 153 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
Q39UT4 1.02e-45 150 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q7M9X2 1.32e-45 149 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B7GGK2 1.43e-45 149 39 0 161 3 coaD Phosphopantetheine adenylyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
C6BXG1 1.59e-45 149 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q3B3M9 2.17e-45 149 45 2 159 3 coaD Phosphopantetheine adenylyltransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
O34797 2.23e-45 149 39 0 158 1 coaD Phosphopantetheine adenylyltransferase Bacillus subtilis (strain 168)
A1BF85 2.27e-45 149 42 1 159 3 coaD Phosphopantetheine adenylyltransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q0AZ31 2.28e-45 149 42 0 154 3 coaD Phosphopantetheine adenylyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B5YEA6 2.31e-45 149 40 0 156 3 coaD Phosphopantetheine adenylyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A3PCX3 2.51e-45 149 41 0 151 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9301)
A8F4E1 2.72e-45 149 41 0 151 3 coaD Phosphopantetheine adenylyltransferase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A1VDV0 3.13e-45 149 40 0 155 3 coaD Phosphopantetheine adenylyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72BV2 3.13e-45 149 40 0 155 3 coaD Phosphopantetheine adenylyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B2V4C6 3.25e-45 148 41 0 153 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
A8ZXR7 4.91e-45 148 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B8GVE7 5.49e-45 148 40 1 160 3 coaD Phosphopantetheine adenylyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
P58103 5.49e-45 148 40 1 160 3 coaD Phosphopantetheine adenylyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8KDS9 5.96e-45 148 41 1 158 3 coaD Phosphopantetheine adenylyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q1GR20 5.98e-45 148 38 1 157 3 coaD Phosphopantetheine adenylyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q7NMB9 6.22e-45 147 42 0 157 3 coaD Phosphopantetheine adenylyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8D2R5 7.52e-45 148 41 0 147 3 coaD Phosphopantetheine adenylyltransferase Wigglesworthia glossinidia brevipalpis
A2BR50 7.63e-45 147 40 0 153 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain AS9601)
Q49WP9 8.08e-45 147 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WFE8 8.2e-45 147 43 0 153 3 coaD Phosphopantetheine adenylyltransferase Shouchella clausii (strain KSM-K16)
Q31AW9 9.6e-45 147 40 0 153 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9312)
A1SR02 1.02e-44 147 42 1 157 3 coaD Phosphopantetheine adenylyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B5EB44 1.03e-44 147 40 0 154 3 coaD Phosphopantetheine adenylyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q5HV25 1.15e-44 147 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Campylobacter jejuni (strain RM1221)
A1VZB5 1.15e-44 147 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PPF2 1.15e-44 147 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H475 1.15e-44 147 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FLI0 1.15e-44 147 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q97IB2 1.28e-44 147 44 0 153 3 coaD Phosphopantetheine adenylyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A4TE51 1.37e-44 147 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
B8FI62 1.78e-44 147 41 0 158 3 coaD Phosphopantetheine adenylyltransferase Desulfatibacillum aliphaticivorans
Q9RME4 1.99e-44 147 37 1 161 3 coaD Phosphopantetheine adenylyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C4Z9Y1 2.28e-44 146 47 0 144 3 coaD Phosphopantetheine adenylyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q7V1I7 2.36e-44 146 38 0 157 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8YN70 2.6e-44 147 42 0 147 3 coaD Phosphopantetheine adenylyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5GT90 2.92e-44 146 43 0 148 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain RCC307)
A0PQ17 3.02e-44 146 43 1 155 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium ulcerans (strain Agy99)
B2HIK6 3.02e-44 146 43 1 155 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
B4S8K5 3.03e-44 146 43 2 159 3 coaD Phosphopantetheine adenylyltransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q74DS2 3.13e-44 146 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A4J698 3.33e-44 146 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C6DZ58 3.41e-44 146 40 0 154 3 coaD Phosphopantetheine adenylyltransferase Geobacter sp. (strain M21)
B1MDL6 4.19e-44 145 42 1 156 1 coaD Phosphopantetheine adenylyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B3QNZ9 4.47e-44 145 42 1 147 3 coaD Phosphopantetheine adenylyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B8E2S1 6.64e-44 145 38 0 155 3 coaD Phosphopantetheine adenylyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q67PG9 6.83e-44 145 36 0 158 3 coaD Phosphopantetheine adenylyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3AQM9 8.36e-44 145 44 2 148 3 coaD Phosphopantetheine adenylyltransferase Chlorobium chlorochromatii (strain CaD3)
Q895N8 9.11e-44 145 41 0 153 3 coaD Phosphopantetheine adenylyltransferase Clostridium tetani (strain Massachusetts / E88)
B0SZS4 9.26e-44 145 41 1 159 3 coaD Phosphopantetheine adenylyltransferase Caulobacter sp. (strain K31)
B2A2L7 1.14e-43 144 38 1 157 3 coaD Phosphopantetheine adenylyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A1UED2 1.27e-43 144 43 1 154 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium sp. (strain KMS)
A3PXT6 1.27e-43 144 43 1 154 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium sp. (strain JLS)
B6ISP7 1.31e-43 145 39 1 163 3 coaD Phosphopantetheine adenylyltransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
B0S155 1.4e-43 144 37 0 157 3 coaD Phosphopantetheine adenylyltransferase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q5LRC9 1.41e-43 144 40 2 162 3 coaD Phosphopantetheine adenylyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B3EQL4 2.59e-43 144 44 3 159 3 coaD Phosphopantetheine adenylyltransferase Chlorobium phaeobacteroides (strain BS1)
A7NK79 2.89e-43 143 40 0 158 3 coaD Phosphopantetheine adenylyltransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B7KEW8 2.98e-43 143 42 0 148 3 coaD Phosphopantetheine adenylyltransferase Gloeothece citriformis (strain PCC 7424)
Q1MRN8 3.19e-43 144 41 0 157 3 coaD Phosphopantetheine adenylyltransferase Lawsonia intracellularis (strain PHE/MN1-00)
A5UWI3 3.33e-43 143 39 0 158 3 coaD Phosphopantetheine adenylyltransferase Roseiflexus sp. (strain RS-1)
A0QV16 3.35e-43 143 43 1 154 3 coaD Phosphopantetheine adenylyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q03QM5 3.47e-43 143 41 0 156 3 coaD Phosphopantetheine adenylyltransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q73VL1 3.72e-43 143 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QJ93 3.72e-43 143 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium avium (strain 104)
B1VYY6 5.17e-43 143 42 1 157 3 coaD Phosphopantetheine adenylyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B9L2B5 6.02e-43 143 45 2 161 3 coaD Phosphopantetheine adenylyltransferase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q9RWM4 8.54e-43 142 37 2 158 3 coaD Phosphopantetheine adenylyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B8HPS4 8.87e-43 142 41 0 147 3 coaD Phosphopantetheine adenylyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q8DJQ7 9.29e-43 142 41 0 148 3 coaD Phosphopantetheine adenylyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O26010 1.04e-42 142 43 0 150 1 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q5FKS7 1.37e-42 142 44 1 157 3 coaD Phosphopantetheine adenylyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1AW92 1.41e-42 142 40 0 152 3 coaD Phosphopantetheine adenylyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A4X4F2 1.44e-42 142 43 1 155 3 coaD Phosphopantetheine adenylyltransferase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
P9WPA5 1.58e-42 142 42 1 156 1 coaD Phosphopantetheine adenylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPA4 1.58e-42 142 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6X4 1.58e-42 142 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AG80 1.58e-42 142 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMV9 1.58e-42 142 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A531 1.58e-42 142 42 1 156 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q11RP5 2.33e-42 141 44 0 150 3 coaD Phosphopantetheine adenylyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q88VC8 2.48e-42 141 41 0 155 3 coaD Phosphopantetheine adenylyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B0CAI3 3.07e-42 141 41 0 147 3 coaD Phosphopantetheine adenylyltransferase Acaryochloris marina (strain MBIC 11017)
Q115H2 3.22e-42 141 43 0 147 3 coaD Phosphopantetheine adenylyltransferase Trichodesmium erythraeum (strain IMS101)
Q3A423 3.81e-42 140 40 0 160 3 coaD Phosphopantetheine adenylyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3AJW3 4.19e-42 140 41 0 149 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain CC9605)
B0JPJ2 4.21e-42 140 40 0 148 3 coaD Phosphopantetheine adenylyltransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q831P9 5.75e-42 140 41 1 158 1 coaD Phosphopantetheine adenylyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
B2J6C6 5.77e-42 141 39 0 152 3 coaD Phosphopantetheine adenylyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q24XZ0 6.07e-42 140 45 0 153 3 coaD Phosphopantetheine adenylyltransferase Desulfitobacterium hafniense (strain Y51)
Q9ZJE4 6.81e-42 140 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
A1SLV0 6.92e-42 140 40 1 156 3 coaD Phosphopantetheine adenylyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B8FTK5 7.07e-42 140 45 0 153 3 coaD Phosphopantetheine adenylyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q1CRB7 7.27e-42 140 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain HPAG1)
B5Z994 7.27e-42 140 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain G27)
B6JNX3 7.27e-42 140 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain P12)
Q2JRG2 8.99e-42 139 42 0 153 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain JA-3-3Ab)
Q4FLZ4 9.67e-42 140 38 1 162 3 coaD Phosphopantetheine adenylyltransferase Pelagibacter ubique (strain HTCC1062)
Q17V95 1.1e-41 139 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter acinonychis (strain Sheeba)
A2BWL2 1.14e-41 139 36 0 157 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9515)
Q6AJH7 1.45e-41 139 43 1 155 3 coaD Phosphopantetheine adenylyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C5CFP6 1.61e-41 139 39 0 155 3 coaD Phosphopantetheine adenylyltransferase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
A4IZ18 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NH87 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BL95 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
A0Q5Y0 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. novicida (strain U112)
Q2A2Q6 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7ND27 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14IN9 1.81e-41 139 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q3AXV0 1.95e-41 139 41 0 148 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain CC9902)
B0SJR1 3.14e-41 138 38 0 158 3 coaD Phosphopantetheine adenylyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S9J5 3.14e-41 138 38 0 158 3 coaD Phosphopantetheine adenylyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B1WS35 5e-41 137 38 0 152 3 coaD Phosphopantetheine adenylyltransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
O66614 5.05e-41 138 41 1 158 3 coaD Phosphopantetheine adenylyltransferase Aquifex aeolicus (strain VF5)
O69466 5.18e-41 137 41 1 153 3 coaD Phosphopantetheine adenylyltransferase Mycobacterium leprae (strain TN)
A0Q101 5.39e-41 137 41 0 143 3 coaD Phosphopantetheine adenylyltransferase Clostridium novyi (strain NT)
A1T732 8.18e-41 137 42 1 154 3 coaD Phosphopantetheine adenylyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q2RTK2 8.23e-41 137 36 1 158 3 coaD Phosphopantetheine adenylyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B2SHB2 9.27e-41 137 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
B2GBB0 9.45e-41 137 39 0 156 3 coaD Phosphopantetheine adenylyltransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A0LV90 1e-40 137 40 1 155 3 coaD Phosphopantetheine adenylyltransferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q7U6T8 1.17e-40 137 40 0 149 3 coaD Phosphopantetheine adenylyltransferase Parasynechococcus marenigrum (strain WH8102)
B0TYA1 1.62e-40 136 40 1 161 3 coaD Phosphopantetheine adenylyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2UVM0 1.64e-40 136 42 0 150 3 coaD Phosphopantetheine adenylyltransferase Helicobacter pylori (strain Shi470)
A6LSL2 2.19e-40 136 39 0 154 3 coaD Phosphopantetheine adenylyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C3L0J4 2.3e-40 136 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q2LTS1 2.5e-40 136 37 0 157 3 coaD Phosphopantetheine adenylyltransferase Syntrophus aciditrophicus (strain SB)
Q38WQ7 2.91e-40 136 42 1 155 3 coaD Phosphopantetheine adenylyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
C1FSR3 3.08e-40 136 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5I4S1 3.08e-40 136 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FW59 3.08e-40 136 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
A8YUR4 3.4e-40 135 41 1 158 3 coaD Phosphopantetheine adenylyltransferase Lactobacillus helveticus (strain DPC 4571)
Q0IAF3 3.41e-40 135 39 0 149 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain CC9311)
B1KX43 4.05e-40 135 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
A7GG79 4.05e-40 135 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IIK4 4.05e-40 135 39 1 158 3 coaD Phosphopantetheine adenylyltransferase Clostridium botulinum (strain Okra / Type B1)
A5FXQ8 5.12e-40 135 36 1 161 3 coaD Phosphopantetheine adenylyltransferase Acidiphilium cryptum (strain JF-5)
Q2JJM6 5.23e-40 135 39 0 153 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q164T8 5.83e-40 135 38 2 162 3 coaD Phosphopantetheine adenylyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A5GL79 7.03e-40 135 40 0 149 3 coaD Phosphopantetheine adenylyltransferase Synechococcus sp. (strain WH7803)
B3WE28 7.06e-40 135 39 1 161 3 coaD Phosphopantetheine adenylyltransferase Lacticaseibacillus casei (strain BL23)
Q039M3 7.14e-40 135 39 1 161 3 coaD Phosphopantetheine adenylyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q55435 8.35e-40 134 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2G6Q2 9.09e-40 135 38 0 154 3 coaD Phosphopantetheine adenylyltransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ82 9.09e-40 135 38 0 154 3 coaD Phosphopantetheine adenylyltransferase Limosilactobacillus reuteri (strain DSM 20016)
A8LME1 1.31e-39 134 38 2 160 3 coaD Phosphopantetheine adenylyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7HXM4 1.43e-39 134 39 2 164 3 coaD Phosphopantetheine adenylyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4WSC5 1.44e-39 134 39 1 157 3 coaD Phosphopantetheine adenylyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q1GHM4 1.81e-39 134 38 1 161 3 coaD Phosphopantetheine adenylyltransferase Ruegeria sp. (strain TM1040)
B3CMX3 1.94e-39 134 40 1 153 3 coaD Phosphopantetheine adenylyltransferase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A2C9T2 2.31e-39 133 39 0 149 3 coaD Phosphopantetheine adenylyltransferase Prochlorococcus marinus (strain MIT 9303)
A1BAJ6 2.75e-39 133 37 1 161 3 coaD Phosphopantetheine adenylyltransferase Paracoccus denitrificans (strain Pd 1222)
C0ZXQ0 3.42e-39 133 36 1 158 3 coaD Phosphopantetheine adenylyltransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q82JT5 3.51e-39 133 41 1 155 3 coaD Phosphopantetheine adenylyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q3J263 5.32e-39 132 38 1 157 3 coaD Phosphopantetheine adenylyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PK50 5.32e-39 132 38 1 157 3 coaD Phosphopantetheine adenylyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A5FGN1 5.92e-39 132 41 1 147 3 coaD Phosphopantetheine adenylyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q6NHJ8 6.61e-39 132 37 2 156 3 coaD Phosphopantetheine adenylyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A9BIS4 9.89e-39 132 41 0 146 3 coaD Phosphopantetheine adenylyltransferase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q0S2E4 1.41e-38 132 36 1 158 3 coaD Phosphopantetheine adenylyltransferase Rhodococcus jostii (strain RHA1)
Q6A7Q4 1.47e-38 131 38 1 155 3 coaD Phosphopantetheine adenylyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_16885
Feature type CDS
Gene coaD
Product pantetheine-phosphate adenylyltransferase
Location 41698 - 42183 (strand: -1)
Length 486 (nucleotides) / 161 (amino acids)

Contig

Accession ZDB_698
Length 62170 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2162
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01467 Cytidylyltransferase-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0669 Coenzyme transport and metabolism (H) H Phosphopantetheine adenylyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00954 pantetheine-phosphate adenylyltransferase [EC:2.7.7.3] Pantothenate and CoA biosynthesis
Metabolic pathways
Biosynthesis of cofactors
Coenzyme A biosynthesis, pantothenate => CoA

Protein Sequence

MKTRAIYPGTFDPITCGHIDILERASKMFDHILLAIANSSRKNPMFTLDERVALAKDVCSHIPNVEVLGFSELMANFAKKQNANVLIRGVRSVADFEYEWQLANMNRHFAQDLESVFLLPSQNLSFVSSSLIKDVALHDGDVSAFLPESVAQAMMQKLGKA

Flanking regions ( +/- flanking 50bp)

AATAAATACGCCACTTTGTGGTCCGTCAGTAACAACGATGAGTCAGCATCATGAAAACACGCGCAATCTATCCCGGCACTTTTGACCCGATTACCTGCGGACATATCGATATTCTTGAGCGCGCCTCAAAAATGTTTGATCACATTCTGCTGGCGATCGCCAACAGCAGCCGTAAAAATCCGATGTTTACCCTCGATGAGCGGGTTGCGCTGGCCAAAGACGTGTGTTCTCACATCCCGAATGTGGAAGTACTGGGGTTTTCTGAGCTGATGGCGAATTTTGCCAAAAAGCAAAATGCCAATGTGCTGATCCGGGGTGTCCGGTCTGTTGCTGACTTTGAATATGAATGGCAGCTGGCAAATATGAACCGCCATTTTGCGCAGGATCTCGAGAGTGTTTTCCTCCTGCCATCGCAGAATCTCTCTTTTGTTTCTTCATCCCTGATTAAAGATGTGGCCCTGCACGACGGTGATGTCTCTGCATTTTTGCCGGAGTCCGTCGCACAGGCGATGATGCAAAAACTCGGTAAGGCGTAATCAGTGCTGACAGGCGGGGCAGAAAAACGTGCTCCGCTGACCGACTTTCA