Homologs in group_2953

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15720 FBDBKF_15720 100.0 Morganella morganii S1 merP mercury resistance system periplasmic binding protein MerP
EHELCC_16075 EHELCC_16075 100.0 Morganella morganii S2 merP mercury resistance system periplasmic binding protein MerP
NLDBIP_16290 NLDBIP_16290 100.0 Morganella morganii S4 merP mercury resistance system periplasmic binding protein MerP
LHKJJB_16510 LHKJJB_16510 100.0 Morganella morganii S3 merP mercury resistance system periplasmic binding protein MerP
F4V73_RS17000 F4V73_RS17000 30.8 Morganella psychrotolerans - heavy-metal-associated domain-containing protein

Distribution of the homologs in the orthogroup group_2953

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2953

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q51770 2.65e-59 179 100 0 91 3 merP Mercuric transport protein periplasmic component Pseudomonas fluorescens
P13113 1.96e-45 144 92 0 91 1 merP Mercuric transport protein periplasmic component Serratia marcescens
P04131 1.6e-42 136 91 0 91 3 merP Mercuric transport protein periplasmic component Pseudomonas aeruginosa
Q52107 1.39e-41 134 80 0 91 3 merP Mercuric transport protein periplasmic component Acinetobacter calcoaceticus
P94186 2.06e-41 134 92 0 91 3 merP Mercuric transport protein periplasmic component Alcaligenes sp.
P04129 6.61e-39 127 84 0 91 1 merP Mercuric transport protein periplasmic component Shigella flexneri
P0A216 2.31e-37 123 83 0 91 3 merP Mercuric transport protein periplasmic component Salmonella typhi
P0A218 2.31e-37 123 83 0 91 3 merP Mercuric transport protein periplasmic component Enterobacter cloacae
P0A217 2.31e-37 123 83 0 91 3 merP Mercuric transport protein periplasmic component Enterobacter agglomerans
Q54463 5.93e-27 97 57 1 87 3 merP Mercuric transport protein periplasmic component Shewanella putrefaciens
Q79ZY4 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MW2)
A8Z3F9 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6B6 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MSSA476)
Q7A3E5 1.15e-12 60 39 0 61 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain N315)
Q99R79 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QK48 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Newman)
Q5HCZ2 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain COL)
A5IVY4 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH9)
Q2FV63 1.15e-12 60 39 0 61 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDU9 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300)
A6U4T9 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH1)
A7X6S3 1.15e-12 60 39 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDP0 6.66e-12 58 37 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MRSA252)
P0C885 6.66e-12 58 37 0 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4A0G2 4.34e-11 56 41 0 63 3 copZ Copper chaperone CopZ Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P73241 1.63e-10 58 42 1 68 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32221 3.89e-10 53 41 0 62 1 copZ Copper chaperone CopZ Bacillus subtilis (strain 168)
P43979 5.09e-10 53 32 1 67 1 HI_0291 Uncharacterized protein HI_0291 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04656 5.14e-10 57 33 0 72 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 1.73e-06 47 29 1 87 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 0.000368 40 28 0 67 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
O32622 5.38e-10 53 32 1 67 4 HI_0292 Uncharacterized protein HI_0292 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4L971 6.13e-10 53 32 0 61 3 copZ Copper chaperone CopZ Staphylococcus haemolyticus (strain JCSC1435)
A6QK47 5.07e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
A6QK47 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 5.07e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q5HCZ3 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 5.07e-09 54 36 0 72 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FV64 8.78e-06 45 31 1 72 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CN01 5.11e-09 51 32 1 65 3 copZ Copper chaperone CopZ Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL55 5.11e-09 51 32 1 65 3 copZ Copper chaperone CopZ Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z3F8 5.17e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A8Z3F8 8.95e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GDP1 5.17e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q6GDP1 6e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q2YWA3 5.17e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWA3 8.61e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FDV0 5.17e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2FDV0 8.95e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q8NUQ9 5.37e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q8NUQ9 9.22e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 5.37e-09 54 36 0 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q6G6B7 9.22e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q64430 1.3e-08 53 31 0 70 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 5.19e-07 48 32 1 81 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 0.000143 42 28 0 67 1 Atp7a Copper-transporting ATPase 1 Mus musculus
P70705 4.44e-08 52 31 0 70 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 3.19e-07 49 32 1 81 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 5.21e-05 43 28 0 67 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P49015 5.14e-08 52 31 0 70 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 0.000232 41 28 0 66 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 0.000533 40 27 1 81 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
Q4A0G1 5.64e-08 51 34 0 70 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A0G1 4.39e-06 46 36 1 61 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A3E6 5.98e-08 51 34 0 70 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q7A3E6 8.78e-06 45 31 1 72 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 5.98e-08 51 34 0 70 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99R80 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 5.98e-08 51 34 0 70 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A5IVY3 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 5.98e-08 51 34 0 70 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A6U4T8 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 5.98e-08 51 34 0 70 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X6S1 8.78e-06 45 31 1 72 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P38995 9.85e-08 51 35 0 70 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38995 6.05e-07 48 35 1 68 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9XT50 1.08e-07 50 35 0 68 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 1.21e-07 50 33 0 74 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 0.000145 42 29 0 65 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 0.000668 40 26 1 88 2 ATP7B Copper-transporting ATPase 2 Ovis aries
A0A0P0X004 1.41e-07 50 41 0 62 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q8CN02 1.8e-07 50 29 0 71 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CN02 0.000712 40 27 2 72 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 1.8e-07 50 29 0 71 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HL56 0.000712 40 27 2 72 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O29777 3.11e-07 49 32 0 61 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9SH30 4.26e-07 49 29 0 64 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q9SH30 7.17e-05 42 32 0 64 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q64535 4.99e-07 48 33 0 68 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 0.000687 40 25 0 68 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64446 7.23e-07 48 32 0 68 1 Atp7b Copper-transporting ATPase 2 Mus musculus
P35670 1.58e-06 47 30 0 68 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 1.63e-06 47 31 0 67 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 2.27e-05 44 23 1 88 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
Q6H7M3 1.84e-06 47 40 0 60 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
O32220 2.22e-06 47 29 0 71 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
O32220 1.14e-05 45 29 0 64 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q9S7J8 2.57e-06 47 32 0 71 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
A3AWA4 3.9e-06 46 35 0 60 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
A3AWA4 0.000385 40 33 0 60 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q8ZCA7 4.6e-06 46 38 1 67 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZCA7 3.37e-05 43 30 1 78 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q47840 5.18e-06 43 34 0 64 1 copZ Copper chaperone CopZ Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O59666 6.85e-06 45 29 0 67 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O32619 7.4e-06 45 32 0 62 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q54465 9.55e-06 45 38 1 62 3 merA Mercuric reductase Shewanella putrefaciens
Q9ZM70 1.08e-05 42 40 2 62 4 copP COP-associated protein Helicobacter pylori (strain J99 / ATCC 700824)
P58342 1.19e-05 45 39 1 61 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 0.000622 40 34 0 63 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
Q9KPZ7 1.56e-05 44 33 1 71 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X5X3 4.58e-05 43 38 1 60 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 0.000884 39 33 0 63 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P46840 5.76e-05 43 37 2 64 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
P08332 0.000103 42 35 1 67 3 merA Mercuric reductase Shigella flexneri
Q4L970 0.000116 42 32 0 65 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q4L970 0.000194 41 31 1 64 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
P55989 0.000137 42 27 0 61 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
O32620 0.000187 39 32 1 62 4 copP COP-associated protein Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
P77868 0.000337 40 25 0 70 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XD24 0.000451 40 36 2 65 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
P9WPT8 0.000453 40 35 2 64 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 0.000453 40 35 2 64 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPU1 0.000453 40 35 2 74 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 0.000453 40 35 2 74 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q59385 0.000464 40 36 2 65 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
O08462 0.000601 40 26 0 61 3 copA Copper-transporting ATPase Helicobacter pylori
P58341 0.000616 40 41 1 60 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q9ZM69 0.000625 40 26 0 61 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q59467 0.000709 40 26 0 61 3 copA Copper-transporting ATPase Helicobacter pylori
Q3YW59 0.000722 40 38 2 59 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P9WPT9 0.00076 40 35 2 64 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P37617 0.000836 40 38 2 59 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
P77871 0.001 39 26 0 61 3 copA Copper-transporting ATPase Helicobacter pylori

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_16280
Feature type CDS
Gene merP
Product mercury resistance system periplasmic binding protein MerP
Location 76964 - 77239 (strand: -1)
Length 276 (nucleotides) / 91 (amino acids)

Contig

Accession ZDB_696
Length 80662 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2953
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00403 Heavy-metal-associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2608 Inorganic ion transport and metabolism (P) P Copper chaperone CopZ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08364 periplasmic mercuric ion binding protein - -

AMR gene Annotation(s)

Gene Description Scope Type Class Subclass HMM
merP mercury resistance system periplasmic binding protein MerP plus STRESS MERCURY MERCURY TIGR02052 

Protein Sequence

MKKLLSALALAAVVAPVWAATQTVTLSVPGMTCSACPITVKKAISKVDGVSKVDVTFETREAVVTFDDAKTSVQKLTKATEDAGYPSSVKN

Flanking regions ( +/- flanking 50bp)

TCGGATTTCCCTACGTCGTGCCATTTTTCTATTGATCACAGGAGTTCACCATGAAAAAGCTGCTTTCCGCCCTTGCCCTCGCTGCCGTTGTTGCCCCCGTGTGGGCCGCCACCCAGACCGTTACGCTGTCCGTACCGGGCATGACCTGCTCGGCCTGTCCGATCACTGTCAAGAAGGCGATTTCCAAGGTCGATGGCGTCAGTAAAGTTGACGTGACCTTCGAGACGCGCGAAGCGGTGGTCACCTTCGATGATGCCAAGACCAGCGTGCAGAAACTGACCAAGGCTACCGAGGATGCGGGCTACCCATCATCAGTCAAGAACTGATCATGAAAGACCCGAAGACACTGCTGCGGGTCAGCATCATTGGCACAACC