Homologs in group_3453

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15610 FBDBKF_15610 100.0 Morganella morganii S1 xerC Tyrosine recombinase XerC
EHELCC_15970 EHELCC_15970 100.0 Morganella morganii S2 xerC Tyrosine recombinase XerC
NLDBIP_16400 NLDBIP_16400 100.0 Morganella morganii S4 xerC Tyrosine recombinase XerC
LHKJJB_16405 LHKJJB_16405 100.0 Morganella morganii S3 xerC Tyrosine recombinase XerC

Distribution of the homologs in the orthogroup group_3453

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3453

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B7IFN3 1.09e-12 71 27 9 238 3 THA_404 Tyrosine recombinase THA_404 Thermosipho africanus (strain TCF52B)
A8F7B4 1.25e-10 65 25 6 232 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A0LEB8 2.26e-10 65 25 8 262 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q97HE5 5.4e-10 63 25 8 251 3 CA_C2066 Putative tyrosine recombinase CA_C2066 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A1AKP9 1.68e-09 62 26 7 245 3 xerC Tyrosine recombinase XerC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q7ZAJ2 2.01e-09 61 25 6 228 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9PK47 2.01e-09 62 27 8 239 3 xerC Tyrosine recombinase XerC Chlamydia muridarum (strain MoPn / Nigg)
O26979 3.09e-09 61 29 8 216 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q5HP53 3.54e-09 60 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49XU5 6.2e-09 60 25 6 226 3 xerD Tyrosine recombinase XerD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q38067 7.06e-09 60 27 8 201 3 None Putative integrase Pseudomonas phage Pf1
P46352 7.92e-09 60 25 9 253 3 xerD Tyrosine recombinase XerD Bacillus subtilis (strain 168)
Q8P550 1.29e-08 59 27 10 243 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNK3 1.29e-08 59 27 10 243 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain B100)
Q4UYY0 1.29e-08 59 27 10 243 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain 8004)
O84351 2.55e-08 58 26 10 272 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBY1 2.55e-08 58 26 10 272 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KM11 2.55e-08 58 26 10 272 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7R6 2.55e-08 58 26 10 272 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q92A53 3.11e-08 58 25 9 236 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5L6G3 5.04e-08 57 26 7 203 3 xerC Tyrosine recombinase XerC Chlamydia abortus (strain DSM 27085 / S26/3)
O31206 5.81e-08 57 23 9 284 1 xerD Tyrosine recombinase XerD Proteus mirabilis
Q9KCP0 6.19e-08 57 26 8 248 3 xerD Tyrosine recombinase XerD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7ZAM3 9.39e-08 56 24 11 273 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O31207 9.87e-08 56 26 7 211 1 xerC Tyrosine recombinase XerC Proteus mirabilis
P04890 1.04e-07 57 28 10 239 3 int Integrase Salmonella phage P22
Q980D9 1.23e-07 56 28 6 178 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q92ME3 1.28e-07 56 27 8 207 3 xerD Tyrosine recombinase XerD Rhizobium meliloti (strain 1021)
Q8Y5V0 1.43e-07 56 25 12 280 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P24218 1.47e-07 56 26 10 242 3 intD Prophage integrase IntD Escherichia coli (strain K12)
Q8R890 1.58e-07 56 25 9 211 3 TTE2127 Tyrosine recombinase XerC-like Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7ZAM5 1.59e-07 56 26 7 241 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4L6J7 1.6e-07 55 22 4 232 3 xerD Tyrosine recombinase XerD Staphylococcus haemolyticus (strain JCSC1435)
P39776 1.78e-07 55 25 9 253 1 xerC Tyrosine recombinase XerC Bacillus subtilis (strain 168)
Q88MV0 1.82e-07 55 26 10 227 3 xerD Tyrosine recombinase XerD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B5YFZ8 1.87e-07 55 23 7 264 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q7ZAJ8 2.01e-07 55 27 6 227 3 xerD Tyrosine recombinase XerD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B3GZ58 2.2e-07 55 25 8 194 3 xerC Tyrosine recombinase XerC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P06723 2.24e-07 55 27 11 225 3 int Integrase Escherichia phage 186
Q9PD96 2.4e-07 55 29 6 187 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain 9a5c)
Q2LT92 3.5e-07 55 28 9 213 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)
Q9HXQ6 3.9e-07 54 26 8 230 3 xerD Tyrosine recombinase XerD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87DI2 3.95e-07 54 29 6 187 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA18 3.95e-07 54 29 6 187 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain M23)
Q8U9U6 4.75e-07 54 46 1 63 3 xerD Tyrosine recombinase XerD Agrobacterium fabrum (strain C58 / ATCC 33970)
Q720E4 6.98e-07 53 24 14 311 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain F2365)
C1L2I5 6.98e-07 53 24 14 311 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9Z9F7 7.49e-07 53 23 5 199 3 xerC Tyrosine recombinase XerC Chlamydia pneumoniae
Q71Y59 7.8e-07 53 24 9 236 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
Q65JN5 7.81e-07 53 24 6 226 3 xerC Tyrosine recombinase XerC Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P0A0P1 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MW2)
P0A0P2 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus
Q6G967 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MSSA476)
Q6GGK1 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MRSA252)
P0A0P0 8.84e-07 53 25 7 228 1 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain N315)
P0A0N9 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFS5 8.84e-07 53 25 7 228 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain COL)
Q8Y7K0 9.85e-07 53 23 13 309 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P36932 1.05e-06 53 25 6 178 1 int Integrase Escherichia phage P2
B3E1H7 1.2e-06 53 23 4 210 3 xerC Tyrosine recombinase XerC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q1RHT1 1.24e-06 53 24 7 214 3 xerD Tyrosine recombinase XerD Rickettsia bellii (strain RML369-C)
Q7NVH1 1.26e-06 53 27 6 200 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q253S9 1.35e-06 53 25 7 222 3 xerC Tyrosine recombinase XerC Chlamydia felis (strain Fe/C-56)
A8FD78 1.71e-06 52 25 11 255 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
A5D2W6 2.23e-06 52 25 6 246 3 xerC Tyrosine recombinase XerC Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0VM16 2.3e-06 52 24 5 224 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A5URM3 2.5e-06 52 25 6 211 3 xerC Tyrosine recombinase XerC Roseiflexus sp. (strain RS-1)
Q7ZAM7 2.64e-06 52 24 9 274 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SA5 2.64e-06 52 24 9 274 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1D804 2.67e-06 52 26 6 205 3 xerC Tyrosine recombinase XerC Myxococcus xanthus (strain DK1622)
P59818 2.67e-06 52 26 6 205 3 xerC Tyrosine recombinase XerC Myxococcus xanthus
Q8PPP9 3.04e-06 52 27 5 186 3 xerC Tyrosine recombinase XerC Xanthomonas axonopodis pv. citri (strain 306)
B0UWL5 4.31e-06 51 42 0 52 3 xerC Tyrosine recombinase XerC Histophilus somni (strain 2336)
Q7MNQ0 4.91e-06 51 25 7 247 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain YJ016)
Q7ZAJ0 4.91e-06 51 25 7 247 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain CMCP6)
Q8TZV9 4.93e-06 51 27 6 197 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q0SZ02 5.9e-06 51 25 10 246 3 xerC Tyrosine recombinase XerC Shigella flexneri serotype 5b (strain 8401)
A6VQS4 6.08e-06 51 25 6 170 3 xerC Tyrosine recombinase XerC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q8KET0 6.58e-06 51 25 8 218 3 xerD Tyrosine recombinase XerD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B6YWN8 6.62e-06 50 47 1 55 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
A0AI80 6.76e-06 51 23 7 233 3 xerC Tyrosine recombinase XerC Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q65V80 7.09e-06 50 40 0 52 3 xerC Tyrosine recombinase XerC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44818 7.29e-06 50 42 0 52 1 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UE41 7.35e-06 50 42 0 52 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain PittEE)
Q4QMP0 8.05e-06 50 42 0 52 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain 86-028NP)
Q8ZHK1 8.35e-06 50 27 8 207 3 xerD Tyrosine recombinase XerD Yersinia pestis
Q3SVJ8 8.77e-06 50 35 2 89 3 xerC Tyrosine recombinase XerC Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7ZAM8 8.89e-06 50 33 2 101 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RY9 8.89e-06 50 33 2 101 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q92C75 9.87e-06 50 22 7 233 3 xerC Tyrosine recombinase XerC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9CKC2 1.01e-05 50 40 0 52 3 xerC Tyrosine recombinase XerC Pasteurella multocida (strain Pm70)
A7NFG3 1.01e-05 50 26 8 199 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
P0A2P6 1.02e-05 50 26 9 226 1 xerD Tyrosine recombinase XerD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P7 1.02e-05 50 26 9 226 3 xerD Tyrosine recombinase XerD Salmonella typhi
Q9JXV6 1.13e-05 50 43 0 55 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q92LK1 1.16e-05 50 36 3 86 3 xerC Tyrosine recombinase XerC Rhizobium meliloti (strain 1021)
Q9JW14 1.18e-05 50 43 0 55 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KS31 1.22e-05 50 43 0 55 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q823T9 1.23e-05 50 26 6 207 3 xerC Tyrosine recombinase XerC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A9M1G2 1.24e-05 50 43 0 55 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C (strain 053442)
Q8X574 1.35e-05 50 26 9 226 3 xerD Tyrosine recombinase XerD Escherichia coli O157:H7
P55636 1.49e-05 50 27 5 198 3 NGR_a01840 Putative integrase/recombinase y4rC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P21442 1.53e-05 50 28 10 214 1 int Integrase Haemophilus phage HP1 (strain HP1c1)
A1SQX0 1.6e-05 50 22 6 217 3 xerC Tyrosine recombinase XerC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q89X68 1.7e-05 50 39 2 74 3 xerC Tyrosine recombinase XerC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P9WF33 1.98e-05 49 28 6 179 1 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF32 1.98e-05 49 28 6 179 3 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67637 1.98e-05 49 28 6 179 3 xerD Tyrosine recombinase XerD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P62592 2.25e-05 49 42 0 66 3 int Integrase/recombinase Salmonella typhi
P62591 2.25e-05 49 42 0 66 3 int Integrase/recombinase Pseudomonas aeruginosa
P62590 2.25e-05 49 42 0 66 3 int Integrase/recombinase Escherichia coli
Q93C64 2.29e-05 49 22 5 236 3 xerD Tyrosine recombinase XerD Lacticaseibacillus casei
Q7ZAM0 2.35e-05 49 26 9 226 3 xerD Tyrosine recombinase XerD Shigella flexneri
Q9V1P5 2.47e-05 49 39 1 63 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
Q8RA66 2.6e-05 49 25 8 219 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2A335 2.62e-05 49 25 9 262 3 xerC Tyrosine recombinase XerC Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
O31087 2.74e-05 49 23 7 211 3 xerC Tyrosine recombinase XerC Serratia marcescens
P0A8P8 2.78e-05 49 26 9 226 1 xerD Tyrosine recombinase XerD Escherichia coli (strain K12)
P0A8P9 2.78e-05 49 26 9 226 3 xerD Tyrosine recombinase XerD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7ZAN4 3.07e-05 48 35 1 82 3 xerD Tyrosine recombinase XerD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
C4ZGY6 3.77e-05 48 24 8 250 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
P55888 3.95e-05 48 24 10 244 3 xerC Tyrosine recombinase XerC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3A8 3.99e-05 48 24 10 244 3 xerC Tyrosine recombinase XerC Salmonella typhi
B5YY58 3.99e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4T6 3.99e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7
Q7ZAL9 4.21e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Shigella flexneri
Q329Y7 4.21e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Shigella dysenteriae serotype 1 (strain Sd197)
Q3YVF5 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Shigella sonnei (strain Ss046)
Q31UH7 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 4 (strain Sb227)
B2TUW7 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LU45 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLY2 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SMS-3-5 / SECEC)
B6I4F2 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SE11)
B7NFB3 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8P6 4.29e-05 48 42 0 50 1 xerC Tyrosine recombinase XerC Escherichia coli (strain K12)
B1IW93 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P7 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A6R9 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O9:H4 (strain HS)
B1XAH7 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / DH10B)
C4ZZ74 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / MC4100 / BW2952)
B7M613 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O8 (strain IAI1)
B7N2A1 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O81 (strain ED1a)
B7NTD1 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L968 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain 55989 / EAEC)
B7UNC8 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZU16 4.29e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R4C3 4.44e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli (strain UTI89 / UPEC)
A1AHX9 4.44e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O1:K1 / APEC
B7MH75 4.44e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q98FX8 4.54e-05 48 42 1 56 3 xerD Tyrosine recombinase XerD Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8D1K0 4.71e-05 48 35 0 53 3 xerC Tyrosine recombinase XerC Yersinia pestis
B8DG54 4.73e-05 48 23 14 311 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
Q7VKG8 4.77e-05 48 26 7 179 3 xerC Tyrosine recombinase XerC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0TAR4 4.82e-05 48 42 0 50 3 xerC Tyrosine recombinase XerC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q039E1 5.27e-05 48 23 8 244 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 5.27e-05 48 23 8 244 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
O59490 6.12e-05 48 38 1 62 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q4UM01 6.52e-05 48 26 10 216 3 xerD Tyrosine recombinase XerD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5JHA3 6.78e-05 47 43 1 55 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B7GGC7 8.33e-05 47 25 6 206 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q7ZAK0 9.65e-05 47 23 8 265 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8NQL5 0.000112 47 41 1 58 3 xerD Tyrosine recombinase XerD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7ZAN7 0.000124 47 42 0 47 3 xerC Tyrosine recombinase XerC Brucella suis biovar 1 (strain 1330)
Q8YJD9 0.000137 47 42 0 47 3 xerC Tyrosine recombinase XerC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8UC70 0.000146 47 40 0 54 3 xerC Tyrosine recombinase XerC Agrobacterium fabrum (strain C58 / ATCC 33970)
A8GQ15 0.000146 47 41 1 58 3 xerC Tyrosine recombinase XerC Rickettsia akari (strain Hartford)
B4RNW5 0.000156 47 41 0 55 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain NCCP11945)
Q5FAI3 0.000156 47 41 0 55 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9B1E0 0.000157 47 26 10 229 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q9JV76 0.000184 46 23 6 202 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q92IC9 0.000196 46 25 10 216 3 xerD Tyrosine recombinase XerD Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q7VPN8 0.000213 46 38 1 65 3 xerD Tyrosine recombinase XerD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q98ED9 0.000225 46 35 3 85 3 xerC Tyrosine recombinase XerC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9KA25 0.000243 46 25 10 242 3 xerC Tyrosine recombinase XerC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q73NE4 0.000268 46 24 8 224 3 xerC Tyrosine recombinase XerC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7ZAP1 0.000268 46 42 0 49 3 xerD Tyrosine recombinase XerD Bifidobacterium longum (strain NCC 2705)
P55632 0.000273 46 27 8 186 3 NGR_a01870 Putative integrase/recombinase y4qK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q49890 0.000278 46 30 9 182 3 xerD Tyrosine recombinase XerD Mycobacterium leprae (strain TN)
A7N0V8 0.000357 45 23 7 188 3 xerC Tyrosine recombinase XerC Vibrio campbellii (strain ATCC BAA-1116)
Q9ZDG8 0.000361 45 25 9 217 3 xerD Tyrosine recombinase XerD Rickettsia prowazekii (strain Madrid E)
Q8NNZ9 0.000364 45 23 7 258 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B4SDZ2 0.000368 45 48 0 49 3 xerC Tyrosine recombinase XerC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q48733 0.000419 45 41 0 56 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
C3PLU8 0.000419 45 46 0 45 3 xerC Tyrosine recombinase XerC Rickettsia africae (strain ESF-5)
Q9K068 0.00042 45 25 7 198 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q04A03 0.000446 45 37 1 70 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 0.000446 45 37 1 70 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q03FK2 0.000448 45 26 4 168 3 xerC Tyrosine recombinase XerC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q7MQB9 0.000497 45 23 7 198 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain YJ016)
Q7ZAI9 0.000497 45 23 7 198 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain CMCP6)
Q92G55 0.000524 45 46 0 45 3 xerC Tyrosine recombinase XerC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C4K256 0.000529 45 36 1 73 3 xerC Tyrosine recombinase XerC Rickettsia peacockii (strain Rustic)
Q8YJP2 0.000629 45 43 0 46 3 xerD Tyrosine recombinase XerD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q7ZAN6 0.000635 45 43 0 46 3 xerD Tyrosine recombinase XerD Brucella suis biovar 1 (strain 1330)
Q87KJ6 0.000637 45 23 7 188 3 xerC Tyrosine recombinase XerC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B0UNY7 0.000693 45 38 1 68 3 xerC Tyrosine recombinase XerC Methylobacterium sp. (strain 4-46)
A8GTV8 0.000697 44 41 1 58 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Sheila Smith)
B0BVE6 0.000697 44 41 1 58 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Iowa)
B8I9N8 0.00071 45 33 2 83 3 xerC Tyrosine recombinase XerC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q4UJZ3 0.001 44 44 0 45 3 xerC Tyrosine recombinase XerC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_16175
Feature type CDS
Gene xerC
Product Tyrosine recombinase XerC
Location 52531 - 53700 (strand: 1)
Length 1170 (nucleotides) / 389 (amino acids)

Contig

Accession ZDB_696
Length 80662 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3453
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00589 Phage integrase family
PF13102 Phage integrase SAM-like domain
PF17293 Arm DNA-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4974 Replication, recombination and repair (L) L Site-specific recombinase XerD

Protein Sequence

MKINIQKREPDKNGLRPIRLVYYYGSKTSEDGSRAQKRSYEPLNLFLYNKPKNAIEREHNKTTLQKAEAIRAKRLLEMESAKHGLDDRTKLNASFFDYFDQVTASKASGSKSNYSIWVSAGIHLHRYHGHAELTFEQLDKYFLEGFRHYLQHEAITKSDTCLSRNTACSYFNKIRAALNQAQRDRIIRDNPVEQVKSIKAERTQRTYLTLDEVKALTKAECRYDVLRRAFLFSCTTGLRWSDIHKLVWSEIELFAQGHYRIIFSQIKLKNSGNGLQYLDLPDSAVRLLNMENKGKPTERVFKGLRYDSYSNVALVQWAIRAGITKHVTFHAGRHTFAVNQLARGLDIYSLSRLLGHSELRTTEIYADILETRRTEAMRTFPDIFDESSD

Flanking regions ( +/- flanking 50bp)

TCCGAAGATAAATTCTGGAGCACATGCGGAGCACAAGAAGAGAAAAACCTATGAAAATCAATATACAAAAGCGAGAACCAGATAAGAATGGCCTGCGCCCCATCAGGCTTGTGTACTATTACGGTTCAAAGACCTCGGAAGACGGTTCAAGGGCTCAAAAGCGCTCTTACGAGCCGCTGAATCTATTCCTCTACAACAAGCCAAAAAACGCAATTGAGCGCGAGCACAATAAAACCACATTGCAAAAAGCTGAGGCCATTCGAGCCAAGCGTCTACTGGAAATGGAATCAGCCAAACACGGCTTAGATGATCGCACTAAACTCAATGCCAGCTTCTTTGACTACTTCGATCAAGTAACAGCAAGTAAAGCATCCGGTAGTAAATCCAATTACTCAATTTGGGTTTCAGCGGGCATCCATCTCCACCGATACCACGGTCACGCAGAACTTACTTTTGAACAGCTAGATAAATACTTCTTGGAAGGGTTCCGCCATTACCTACAGCATGAGGCAATAACAAAATCAGATACCTGCCTATCTAGGAATACTGCTTGTAGCTACTTCAATAAAATCCGGGCTGCGCTCAACCAAGCACAACGAGACCGAATAATCAGAGATAACCCTGTTGAACAAGTCAAATCCATCAAAGCAGAGAGGACACAGCGCACTTACCTCACTCTGGATGAGGTAAAAGCTCTTACCAAGGCAGAATGCCGTTATGATGTTCTACGAAGAGCATTTCTGTTCTCCTGCACTACGGGTCTACGCTGGTCAGACATACATAAACTGGTATGGAGTGAAATTGAACTGTTTGCTCAAGGCCACTACCGAATAATCTTTTCCCAGATAAAGCTAAAAAACTCAGGAAATGGTCTGCAATACTTGGATTTACCGGATTCTGCGGTGCGTCTACTCAACATGGAGAACAAGGGAAAACCGACTGAACGGGTTTTTAAGGGCTTACGTTACGACAGCTATAGCAATGTCGCGCTAGTGCAGTGGGCTATACGTGCCGGGATAACCAAACACGTGACCTTTCATGCTGGCCGACACACCTTTGCTGTAAACCAGCTTGCCCGAGGTCTGGACATTTATTCCCTTTCCAGATTACTTGGCCATAGCGAACTCAGAACAACAGAAATCTACGCAGATATTCTGGAAACCCGGCGCACAGAGGCCATGCGGACCTTTCCAGATATCTTCGATGAGTCATCAGACTAAGAGCATTATTTGTCGGAAGACAATATAGGGGTGAACAAGTCACCCCAAGG