Homologs in group_1323

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08190 FBDBKF_08190 100.0 Morganella morganii S1 ilvC ketol-acid reductoisomerase
EHELCC_13335 EHELCC_13335 100.0 Morganella morganii S2 ilvC ketol-acid reductoisomerase
NLDBIP_13675 NLDBIP_13675 100.0 Morganella morganii S4 ilvC ketol-acid reductoisomerase
LHKJJB_12880 LHKJJB_12880 100.0 Morganella morganii S3 ilvC ketol-acid reductoisomerase
F4V73_RS18720 F4V73_RS18720 95.3 Morganella psychrotolerans ilvC ketol-acid reductoisomerase
PMI_RS16430 PMI_RS16430 89.8 Proteus mirabilis HI4320 ilvC ketol-acid reductoisomerase

Distribution of the homologs in the orthogroup group_1323

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1323

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1U6 0.0 900 90 0 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Proteus mirabilis (strain HI4320)
B4TNS6 0.0 882 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella schwarzengrund (strain CVM19633)
A8GL54 0.0 878 87 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Serratia proteamaculans (strain 568)
A1JI57 0.0 874 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7MYK9 0.0 874 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JQ26 0.0 870 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G37 0.0 870 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZH8 0.0 870 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FD32 0.0 870 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6DHG3 0.0 869 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MQH1 0.0 869 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cronobacter sakazakii (strain ATCC BAA-894)
A4TRD9 0.0 867 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pestis (strain Pestoides F)
Q1CNM0 0.0 867 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8G1 0.0 867 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAC2 0.0 867 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pestis
Q1CBS1 0.0 867 87 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Yersinia pestis bv. Antiqua (strain Antiqua)
B5XYZ8 0.0 866 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Klebsiella pneumoniae (strain 342)
A9MJN4 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ACS4 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LU79 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4G3 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain UTI89 / UPEC)
A1AHU6 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O1:K1 / APEC
B7MGI6 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN1 0.0 865 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LLU9 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain SMS-3-5 / SECEC)
B6I4B1 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain SE11)
B7NF81 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FBR2 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU6 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N269 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O81 (strain ED1a)
A7ZTX6 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TB09 0.0 864 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella heidelberg (strain SL476)
A4WG34 0.0 863 85 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Enterobacter sp. (strain 638)
Q3YVJ0 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shigella sonnei (strain Ss046)
Q7UB34 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shigella flexneri
Q31UL0 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shigella boydii serotype 4 (strain Sb227)
B2TU17 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z381 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella typhi
B5BIS2 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella paratyphi A (strain AKU_12601)
C0Q2V3 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella paratyphi C (strain RKS4594)
A9MXE7 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ5 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RFS8 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVG7 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella enteritidis PT4 (strain P125109)
Q57HU2 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella choleraesuis (strain SC-B67)
A6TGG1 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7M5C2 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O8 (strain IAI1)
B5YY23 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58256 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O157:H7
B7L8B5 0.0 863 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain 55989 / EAEC)
Q329V3 0.0 862 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shigella dysenteriae serotype 1 (strain Sd197)
P05989 0.0 862 86 0 491 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P05793 0.0 862 86 0 491 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain K12)
B1IWC4 0.0 862 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6N0 0.0 862 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O9:H4 (strain HS)
B1X9Z0 0.0 862 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain K12 / DH10B)
C4ZZ44 0.0 862 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli (strain K12 / MC4100 / BW2952)
B5EZ33 0.0 861 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella agona (strain SL483)
B7NTG7 0.0 861 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B4SZ22 0.0 861 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella newport (strain SL254)
B5FN70 0.0 861 86 0 491 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Salmonella dublin (strain CT_02021853)
Q6CZD1 0.0 860 86 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NQA9 0.0 859 84 1 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sodalis glossinidius (strain morsitans)
B2VG69 0.0 859 85 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9CLF1 0.0 836 82 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pasteurella multocida (strain Pm70)
C5BBA8 0.0 829 80 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Edwardsiella ictaluri (strain 93-146)
A0KEM1 0.0 827 81 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STE2 0.0 813 79 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aeromonas salmonicida (strain A449)
B8F6G2 0.0 811 79 2 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Glaesserella parasuis serovar 5 (strain SH0165)
B0BTD3 0.0 807 78 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N3E9 0.0 807 78 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4QMN4 0.0 806 80 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haemophilus influenzae (strain 86-028NP)
P44822 0.0 806 80 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UE34 0.0 806 80 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haemophilus influenzae (strain PittEE)
Q87TN4 0.0 806 78 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MQH3 0.0 805 78 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio vulnificus (strain YJ016)
Q8DDC8 0.0 805 78 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio vulnificus (strain CMCP6)
A5UHH1 0.0 804 80 1 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haemophilus influenzae (strain PittGG)
Q65WK8 0.0 804 78 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0UWE8 0.0 801 80 2 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Histophilus somni (strain 2336)
Q0I511 0.0 799 79 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Histophilus somni (strain 129Pt)
B7VGL9 0.0 798 76 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio atlanticus (strain LGP32)
C3LQ01 0.0 796 77 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio cholerae serotype O1 (strain M66-2)
Q9KVI4 0.0 796 77 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F449 0.0 796 77 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VLU1 0.0 795 77 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4L8N9 0.0 793 79 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5E1S3 0.0 792 76 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LVZ5 0.0 792 77 2 493 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Photobacterium profundum (strain SS9)
B5FCV4 0.0 791 76 2 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aliivibrio fischeri (strain MJ11)
B6EP33 0.0 790 75 1 494 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aliivibrio salmonicida (strain LFI1238)
A1SAS8 0.0 754 73 1 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8E9D5 0.0 753 73 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B4S1X4 0.0 749 72 2 492 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q15MY4 0.0 746 73 2 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A6W216 0.0 746 72 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Marinomonas sp. (strain MWYL1)
A0M380 0.0 740 73 2 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q47UP4 0.0 730 71 1 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A5FFY3 0.0 722 72 1 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q3IE45 0.0 722 69 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudoalteromonas translucida (strain TAC 125)
Q11VZ3 0.0 717 70 1 490 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q9RQ55 0.0 717 67 0 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Diuraphis noxia
B8D8B4 0.0 701 65 0 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57655 0.0 701 65 0 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8F7 0.0 701 65 0 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
O51888 0.0 699 67 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q491Z2 0.0 689 65 1 489 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Blochmanniella pennsylvanica (strain BPEN)
Q89A20 0.0 679 64 0 486 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9RQ51 0.0 678 64 0 488 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Schlechtendalia chinensis
Q9RQ47 0.0 678 65 0 484 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Buchnera aphidicola subsp. Melaphis rhois
Q7VRM0 0.0 661 63 2 487 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Blochmanniella floridana
Q9AQ96 0.0 536 72 0 343 3 ilvC Ketol-acid reductoisomerase (NADP(+)) (Fragment) Buchnera aphidicola subsp. Macrosiphoniella ludovicianae
Q9AQA0 0.0 529 69 0 346 3 ilvC Ketol-acid reductoisomerase (NADP(+)) (Fragment) Buchnera aphidicola subsp. Uroleucon ambrosiae
Q9AQ98 0.0 524 69 0 346 3 ilvC Ketol-acid reductoisomerase (NADP(+)) (Fragment) Buchnera aphidicola subsp. Uroleucon rurale
Q9AQ99 0.0 523 69 0 345 3 ilvC Ketol-acid reductoisomerase (NADP(+)) (Fragment) Buchnera aphidicola subsp. Uroleucon sonchi
Q9AQ97 0.0 521 69 0 346 3 ilvC Ketol-acid reductoisomerase (NADP(+)) (Fragment) Buchnera aphidicola subsp. Uroleucon erigeronensis
Q39W76 1.94e-52 183 38 8 292 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q39W76 5.37e-09 61 30 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6F821 1.02e-51 181 34 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F821 1.18e-08 60 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V5G8 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AYE)
B0V5G8 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AYE)
A3M254 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A3M254 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VKP5 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain SDF)
B0VKP5 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain SDF)
B2HTC8 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain ACICU)
B2HTC8 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain ACICU)
B7I5I9 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AB0057)
B7I5I9 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AB0057)
B7H047 2.47e-49 175 33 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AB307-0294)
B7H047 3.15e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acinetobacter baumannii (strain AB307-0294)
A5G7V3 2.66e-48 172 37 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geotalea uraniireducens (strain Rf4)
A5G7V3 6.43e-09 61 27 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geotalea uraniireducens (strain Rf4)
B2U7S3 1.68e-47 170 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ralstonia pickettii (strain 12J)
B2U7S3 1.61e-09 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ralstonia pickettii (strain 12J)
Q7P0H9 1.74e-47 170 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7P0H9 5.48e-10 64 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7V0F0 2.14e-47 170 34 6 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7V0F0 3.25e-12 71 31 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B1XUJ0 3.11e-47 169 34 6 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B1XUJ0 1.22e-08 60 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q74BW9 4.34e-47 169 37 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74BW9 4.7e-10 64 30 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8XXN8 4.43e-47 169 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXN8 1.73e-08 59 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B9KCI3 4.95e-47 169 34 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B9KCI3 8.67e-09 60 28 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B0U8N5 6.2e-47 169 39 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium sp. (strain 4-46)
B0U8N5 4.18e-11 67 32 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium sp. (strain 4-46)
A5EPB5 7.1e-47 169 38 7 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A5EPB5 4.48e-10 64 31 3 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B8GUB6 7.68e-47 168 38 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B8GUB6 2.96e-10 65 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B3EHP0 8.58e-47 168 35 9 320 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B3EHP0 4.72e-09 61 30 4 164 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B6ITR6 8.92e-47 168 36 6 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodospirillum centenum (strain ATCC 51521 / SW)
B6ITR6 1.03e-10 66 32 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodospirillum centenum (strain ATCC 51521 / SW)
Q1LPX7 8.98e-47 168 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LPX7 8.27e-09 60 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0RQ02 1.13e-46 168 36 6 285 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter fetus subsp. fetus (strain 82-40)
A0RQ02 2.27e-08 59 31 4 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter fetus subsp. fetus (strain 82-40)
Q4FUB6 1.32e-46 168 32 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FUB6 1.96e-09 62 31 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B3R3V4 1.84e-46 167 35 8 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B3R3V4 3.39e-09 62 35 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0KCU2 2.08e-46 167 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0KCU2 5.62e-09 61 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2RX71 2.14e-46 167 38 7 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RX71 1.96e-06 53 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1QDE6 2.24e-46 167 32 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QDE6 1.92e-09 62 31 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1AS39 2.64e-46 167 37 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A1AS39 1.13e-08 60 31 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q0AB89 4.54e-46 166 41 9 256 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0AB89 2.96e-09 62 29 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1AW99 4.61e-46 166 36 6 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ruthia magnifica subsp. Calyptogena magnifica
A1AW99 3.62e-11 68 32 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Ruthia magnifica subsp. Calyptogena magnifica
B4SDK7 4.77e-46 166 35 8 318 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B4SDK7 1.38e-10 66 30 2 161 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A0L626 4.78e-46 166 35 8 306 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0L626 3.88e-08 58 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q3AVC2 4.79e-46 166 37 6 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9902)
Q3AVC2 4.08e-12 70 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9902)
Q2S9V9 6.01e-46 166 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hahella chejuensis (strain KCTC 2396)
Q2S9V9 3.46e-10 65 35 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hahella chejuensis (strain KCTC 2396)
Q3B594 6.25e-46 166 35 10 319 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3B594 2.37e-10 65 29 2 168 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A7GXQ8 6.31e-46 166 36 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter curvus (strain 525.92)
A7GXQ8 2.94e-08 58 32 4 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter curvus (strain 525.92)
C1B2M1 6.5e-46 166 36 9 326 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus opacus (strain B4)
C1B2M1 1.99e-13 74 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus opacus (strain B4)
A2CB87 7.11e-46 166 37 7 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9303)
A2CB87 2.54e-12 71 32 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9303)
Q2KWH7 8.37e-46 166 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella avium (strain 197N)
Q2KWH7 2.37e-06 53 32 5 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella avium (strain 197N)
A3PEE9 8.41e-46 166 34 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9301)
A3PEE9 1.51e-11 68 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9301)
A8I679 8.76e-46 166 38 9 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A8I679 3.23e-09 62 29 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q473V5 9.88e-46 166 34 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q473V5 4.53e-09 61 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B1LXF3 9.92e-46 166 38 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B1LXF3 3.18e-11 68 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q7W566 1.1e-45 165 38 7 259 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W566 3.36e-07 55 33 5 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WCP6 1.1e-45 165 38 7 259 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WCP6 3.36e-07 55 33 5 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B2URB8 1.15e-45 165 36 6 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B2URB8 2.59e-10 65 33 2 112 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q211Z6 1.38e-45 165 38 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisB18)
Q211Z6 3.15e-09 62 29 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisB18)
C0ZXM2 1.45e-45 165 35 8 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus erythropolis (strain PR4 / NBRC 100887)
C0ZXM2 1.99e-13 74 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A4YZA6 1.52e-45 165 37 7 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium sp. (strain ORS 278)
A4YZA6 3.45e-10 65 31 3 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium sp. (strain ORS 278)
A9IGJ3 1.75e-45 165 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A9IGJ3 3.94e-07 55 33 5 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A9VZF3 2.8e-45 164 38 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum extorquens (strain PA1)
A9VZF3 1.45e-10 66 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum extorquens (strain PA1)
B7KYZ3 2.8e-45 164 38 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B7KYZ3 1.45e-10 66 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A5GMM6 3.04e-45 164 35 8 307 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain WH7803)
A5GMM6 8.54e-12 69 32 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain WH7803)
Q7V8M5 3.3e-45 164 37 7 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9313)
Q7V8M5 1.73e-12 72 32 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9313)
A8G6C6 3.45e-45 164 34 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9215)
A8G6C6 2.4e-11 68 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9215)
Q3SHE4 3.69e-45 164 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thiobacillus denitrificans (strain ATCC 25259)
Q3SHE4 3.48e-09 62 35 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thiobacillus denitrificans (strain ATCC 25259)
B3E5X4 3.88e-45 164 34 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B3E5X4 4.11e-11 67 36 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A2BSN6 4.38e-45 164 34 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain AS9601)
A2BSN6 2.51e-11 68 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain AS9601)
Q0S2H3 4.57e-45 164 35 7 324 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus jostii (strain RHA1)
Q0S2H3 1.88e-13 75 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodococcus jostii (strain RHA1)
B2IHY4 4.6e-45 164 38 9 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B2IHY4 9.66e-10 63 31 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q139A2 4.9e-45 164 37 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisB5)
Q139A2 1.58e-11 69 32 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisB5)
Q8U2A3 5.4e-45 163 36 6 296 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q7VZU4 5.64e-45 164 38 7 259 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZU4 3.39e-07 55 33 5 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B6JB83 6.15e-45 163 36 10 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B6JB83 1.52e-09 63 30 3 134 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A1KAB7 7.01e-45 163 34 4 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Azoarcus sp. (strain BH72)
A1KAB7 7.45e-10 63 30 3 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Azoarcus sp. (strain BH72)
Q5SJ03 7.28e-45 163 36 6 293 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q5SJ03 3.47e-12 71 32 3 146 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72JC8 7.28e-45 163 36 6 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q72JC8 3.47e-12 71 32 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B3EKV1 7.46e-45 163 33 8 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeobacteroides (strain BS1)
B3EKV1 2.61e-10 65 28 2 161 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeobacteroides (strain BS1)
A7IFE5 7.49e-45 163 37 9 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A7IFE5 8.33e-11 67 30 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q319H3 9.63e-45 162 34 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9312)
Q319H3 2.23e-11 68 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9312)
Q2IUS3 1.02e-44 163 37 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain HaA2)
Q2IUS3 3.16e-11 68 32 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain HaA2)
C1DA41 1.08e-44 163 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Laribacter hongkongensis (strain HLHK9)
C1DA41 1.2e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Laribacter hongkongensis (strain HLHK9)
A4SXR3 1.25e-44 162 34 6 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A4SXR3 9.76e-08 57 30 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A7HVZ2 1.26e-44 162 37 7 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A7HVZ2 3.87e-09 62 30 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q7NH80 1.39e-44 162 37 5 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NH80 1.72e-11 68 31 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3APC3 1.48e-44 162 35 9 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium chlorochromatii (strain CaD3)
Q3APC3 3.71e-11 67 30 2 161 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium chlorochromatii (strain CaD3)
Q7VAR8 1.52e-44 162 35 6 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7VAR8 6.5e-12 70 33 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3SQ46 1.53e-44 162 37 6 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3SQ46 2.3e-10 65 31 3 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A4XIL7 1.82e-44 162 34 7 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A4XIL7 3.7e-09 62 31 3 147 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q02YY8 1.89e-44 162 34 9 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. cremoris (strain SK11)
Q02YY8 2.2e-06 53 29 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. cremoris (strain SK11)
Q2YBU1 1.93e-44 162 38 3 249 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YBU1 3.67e-08 58 29 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A8ERD8 1.97e-44 162 34 6 288 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aliarcobacter butzleri (strain RM4018)
A8ERD8 1.41e-07 57 39 0 74 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aliarcobacter butzleri (strain RM4018)
B1ZI53 2.09e-44 162 38 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1ZI53 1.35e-10 66 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q9UZ09 2.1e-44 162 37 8 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrococcus abyssi (strain GE5 / Orsay)
Q9UZ09 0.000117 47 27 7 159 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrococcus abyssi (strain GE5 / Orsay)
Q5KWJ2 2.9e-44 162 37 9 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus kaustophilus (strain HTA426)
Q5KWJ2 1.49e-10 66 32 3 131 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus kaustophilus (strain HTA426)
Q1GT37 2.98e-44 162 38 10 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q1GT37 2.01e-09 62 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A1W6T4 2.99e-44 162 32 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidovorax sp. (strain JS42)
A1W6T4 7.56e-09 60 29 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidovorax sp. (strain JS42)
B9MA35 2.99e-44 162 32 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidovorax ebreus (strain TPSY)
B9MA35 7.56e-09 60 29 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidovorax ebreus (strain TPSY)
Q8KER7 3.42e-44 161 34 11 329 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KER7 2e-15 80 32 2 165 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1BES5 3.46e-44 161 33 8 318 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A1BES5 1.07e-10 66 29 2 161 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A4SFC5 4.12e-44 161 33 10 319 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A4SFC5 1.68e-11 68 32 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q5NXP4 4.76e-44 161 34 4 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5NXP4 5.38e-10 64 31 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B9MNV1 5.29e-44 160 34 7 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9MNV1 1.1e-08 60 31 3 147 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q3ALC5 5.88e-44 160 36 7 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9605)
Q3ALC5 3.97e-12 70 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9605)
Q1QJU8 6.18e-44 160 37 7 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1QJU8 3.88e-10 64 29 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5YRW2 6.4e-44 160 34 8 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nocardia farcinica (strain IFM 10152)
Q5YRW2 2.89e-12 71 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nocardia farcinica (strain IFM 10152)
B3QCW2 6.65e-44 160 36 10 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain TIE-1)
B3QCW2 1.83e-11 68 32 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain TIE-1)
Q6N869 6.65e-44 160 36 10 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N869 1.83e-11 68 32 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A8FL53 7.1e-44 160 34 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A8FL53 5.99e-09 61 28 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A2RKQ6 7.17e-44 160 34 9 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKQ6 1.83e-07 56 30 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. cremoris (strain MG1363)
Q89G50 8.09e-44 160 36 7 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89G50 8.4e-11 67 30 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7U5Q1 8.28e-44 160 36 7 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parasynechococcus marenigrum (strain WH8102)
Q7U5Q1 1.74e-12 72 31 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parasynechococcus marenigrum (strain WH8102)
C0Z9C7 8.55e-44 160 36 8 282 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C0Z9C7 4.05e-10 64 32 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q9X5F8 8.61e-44 160 36 6 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9X5F8 3.09e-08 58 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A1VYZ2 9e-44 160 34 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A1VYZ2 4.3e-09 61 29 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q46JF6 9.67e-44 160 35 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain NATL2A)
Q46JF6 4.04e-12 70 32 3 144 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain NATL2A)
A2BY22 9.7e-44 160 35 8 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9515)
A2BY22 5.36e-10 64 29 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9515)
Q47BH8 1.11e-43 160 34 4 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dechloromonas aromatica (strain RCB)
Q47BH8 1.71e-10 65 30 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dechloromonas aromatica (strain RCB)
Q49Z11 1.15e-43 160 34 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49Z11 3.05e-09 62 29 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A6VJW0 1.47e-43 159 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A6VJW0 3.06e-07 55 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A9A7D0 1.58e-43 159 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A9A7D0 2.49e-07 56 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
B8EKP4 1.72e-43 159 37 8 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B8EKP4 1.28e-08 60 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A4J179 1.87e-43 159 34 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A4J179 6.1e-12 70 27 3 175 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A1KUZ8 2.14e-43 159 36 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1KUZ8 1.66e-08 59 32 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JYI2 2.14e-43 159 36 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYI2 1.66e-08 59 32 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M177 2.14e-43 159 36 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup C (strain 053442)
A9M177 1.66e-08 59 32 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup C (strain 053442)
Q1R092 2.2e-43 159 33 6 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R092 2.73e-10 65 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A5GRI8 2.21e-43 159 34 8 323 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain RCC307)
A5GRI8 8.16e-11 67 31 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain RCC307)
Q9JTI3 2.21e-43 159 36 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JTI3 1.63e-08 59 32 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9IW67 2.3e-43 159 35 8 297 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella tribocorum (strain CIP 105476 / IBS 506)
A9IW67 5.93e-10 64 32 4 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella tribocorum (strain CIP 105476 / IBS 506)
A2C482 2.35e-43 159 35 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain NATL1A)
A2C482 4.94e-12 70 32 3 144 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain NATL1A)
A4IRH9 2.46e-43 159 36 9 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus thermodenitrificans (strain NG80-2)
A4IRH9 1.11e-10 66 32 3 131 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus thermodenitrificans (strain NG80-2)
A1TRT6 2.54e-43 159 32 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paracidovorax citrulli (strain AAC00-1)
A1TRT6 2.73e-09 62 30 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paracidovorax citrulli (strain AAC00-1)
A9BBT2 2.8e-43 159 35 8 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9211)
A9BBT2 5.99e-11 67 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prochlorococcus marinus (strain MIT 9211)
C1DFH7 2.9e-43 159 31 6 312 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C1DFH7 7.49e-09 60 34 4 129 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q5FRY8 2.94e-43 159 37 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gluconobacter oxydans (strain 621H)
Q5FRY8 6.76e-09 61 32 4 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gluconobacter oxydans (strain 621H)
Q9F7L6 2.99e-43 159 36 8 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gamma-proteobacterium EBAC31A08
Q9F7L6 3.01e-12 71 29 2 165 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gamma-proteobacterium EBAC31A08
Q5H4C1 3.07e-43 159 34 7 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H4C1 1.94e-10 65 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SNG5 3.07e-43 159 34 7 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain PXO99A)
B2SNG5 1.94e-10 65 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P757 3.07e-43 159 34 7 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P757 1.94e-10 65 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5HVD9 3.08e-43 159 33 7 290 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni (strain RM1221)
Q5HVD9 6.38e-09 61 28 3 142 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni (strain RM1221)
Q17X66 3.16e-43 159 31 3 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter acinonychis (strain Sheeba)
Q17X66 3.22e-06 52 28 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter acinonychis (strain Sheeba)
Q11I83 3.33e-43 159 36 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chelativorans sp. (strain BNC1)
Q11I83 2.85e-08 59 30 3 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chelativorans sp. (strain BNC1)
B7GH18 3.49e-43 159 37 8 292 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7GH18 8.38e-10 63 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q9PHN5 3.59e-43 159 33 7 290 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9PHN5 7.05e-09 60 28 3 142 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2JXL2 4.18e-43 158 37 6 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain JA-3-3Ab)
Q2JXL2 6.37e-13 73 32 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain JA-3-3Ab)
A4FYE4 4.18e-43 158 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A4FYE4 4.42e-07 55 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A5WD25 4.21e-43 159 31 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter sp. (strain PRwf-1)
A5WD25 2.22e-08 59 30 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Psychrobacter sp. (strain PRwf-1)
A7H4H9 4.28e-43 159 32 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A7H4H9 4.49e-09 61 28 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B7KF23 4.37e-43 158 33 9 328 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gloeothece citriformis (strain PCC 7424)
B7KF23 1.13e-11 69 31 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gloeothece citriformis (strain PCC 7424)
A3CXJ5 4.81e-43 158 39 5 250 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A3CXJ5 1.49e-07 57 30 4 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
C5CYN9 5.56e-43 158 33 6 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Variovorax paradoxus (strain S110)
C5CYN9 2.39e-10 65 35 4 134 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Variovorax paradoxus (strain S110)
K4LVZ1 5.62e-43 158 34 5 282 1 ilvC Ketol-acid reductoisomerase (NAD(+)) Thermacetogenium phaeum (strain ATCC BAA-254 / DSM 26808 / PB)
K4LVZ1 2.66e-11 68 32 3 146 1 ilvC Ketol-acid reductoisomerase (NAD(+)) Thermacetogenium phaeum (strain ATCC BAA-254 / DSM 26808 / PB)
Q6A7Z2 5.99e-43 158 33 10 331 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6A7Z2 7.04e-10 63 30 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q30T61 6.23e-43 158 33 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q30T61 6e-07 55 37 0 74 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B5YJT0 6.4e-43 158 38 8 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B5YJT0 7.68e-10 63 29 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q6LZH4 6.52e-43 158 33 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LZH4 2.1e-06 53 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q2NI95 6.72e-43 158 34 7 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q2NI95 5.13e-05 48 28 2 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8PH09 6.72e-43 158 35 6 288 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas axonopodis pv. citri (strain 306)
Q8PH09 1.36e-10 66 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas axonopodis pv. citri (strain 306)
A6VCE7 8.06e-43 158 30 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain PA7)
A6VCE7 4.22e-10 64 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain PA7)
Q5F7E5 9.19e-43 157 35 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F7E5 5.19e-08 58 32 3 124 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q87CM2 9.65e-43 158 34 6 297 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87CM2 1.65e-10 66 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A6UAW6 1.01e-42 157 36 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sinorhizobium medicae (strain WSM419)
A6UAW6 7.43e-10 63 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sinorhizobium medicae (strain WSM419)
Q9HVA2 1.17e-42 157 30 6 312 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HVA2 4.26e-10 64 34 4 129 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FX9 1.17e-42 157 30 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02FX9 4.26e-10 64 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V1A6 1.17e-42 157 30 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain LESB58)
B7V1A6 4.26e-10 64 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas aeruginosa (strain LESB58)
Q52955 1.23e-42 157 36 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium meliloti (strain 1021)
Q52955 4.8e-09 61 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium meliloti (strain 1021)
Q12B50 1.28e-42 157 34 8 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q12B50 4.29e-09 61 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q2W1G2 1.3e-42 157 37 7 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W1G2 3.69e-08 58 30 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B8IGT3 1.33e-42 157 39 8 294 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B8IGT3 2.36e-10 65 31 4 149 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q0IC80 1.45e-42 157 34 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9311)
Q0IC80 1.53e-11 68 30 2 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain CC9311)
B2USG1 1.49e-42 157 32 5 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain Shi470)
B2USG1 1.17e-05 50 27 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain Shi470)
A5CWZ1 1.49e-42 157 34 6 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A5CWZ1 1.86e-09 62 32 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C3K225 1.75e-42 157 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain SBW25)
C3K225 3.02e-08 58 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain SBW25)
Q58938 1.89e-42 156 34 7 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58938 9.37e-10 63 31 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4VPI6 1.9e-42 157 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Stutzerimonas stutzeri (strain A1501)
A4VPI6 5.98e-09 61 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Stutzerimonas stutzeri (strain A1501)
Q31MY7 1.95e-42 156 36 7 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q31MY7 5.37e-12 70 32 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C5D5M1 2.02e-42 157 36 7 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus sp. (strain WCH70)
C5D5M1 1.51e-09 63 31 3 131 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geobacillus sp. (strain WCH70)
Q0W834 2.19e-42 156 40 6 251 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q0W834 5.02e-07 55 27 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B9JGH5 2.29e-42 156 35 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B9JGH5 1.06e-09 63 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A1VN04 2.84e-42 156 34 9 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polaromonas naphthalenivorans (strain CJ2)
A1VN04 2.91e-08 58 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Polaromonas naphthalenivorans (strain CJ2)
Q07PJ7 2.96e-42 156 36 5 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisA53)
Q07PJ7 3.7e-09 62 29 2 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhodopseudomonas palustris (strain BisA53)
B3PK17 2.99e-42 156 30 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cellvibrio japonicus (strain Ueda107)
B3PK17 1.49e-09 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cellvibrio japonicus (strain Ueda107)
Q8FPX1 3.23e-42 156 34 9 329 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FPX1 2.05e-10 65 29 3 152 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A5V3W3 3.32e-42 156 35 5 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A5V3W3 2.21e-08 59 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q1GZE9 3.38e-42 156 34 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1GZE9 4.76e-11 67 37 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q02138 3.4e-42 156 33 7 312 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. lactis (strain IL1403)
Q02138 5.51e-08 58 31 2 135 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Lactococcus lactis subsp. lactis (strain IL1403)
P9WKJ7 3.66e-42 156 33 8 325 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKJ7 9.28e-14 75 34 2 143 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKJ6 3.66e-42 156 33 8 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WKJ6 9.28e-14 75 34 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U713 3.66e-42 156 33 8 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A5U713 9.28e-14 75 34 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KMZ6 3.66e-42 156 33 8 325 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KMZ6 9.28e-14 75 34 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A9GZJ4 3.68e-42 156 37 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A9GZJ4 1.25e-09 63 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A0PPY3 3.84e-42 155 34 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium ulcerans (strain Agy99)
A0PPY3 5.65e-11 67 31 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium ulcerans (strain Agy99)
Q0BS26 3.87e-42 156 34 6 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q0BS26 1.78e-09 62 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q1CUH1 3.96e-42 155 31 5 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain HPAG1)
Q1CUH1 5.21e-06 52 27 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain HPAG1)
Q9PCF9 5.96e-42 155 34 6 297 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xylella fastidiosa (strain 9a5c)
Q9PCF9 1.91e-10 65 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xylella fastidiosa (strain 9a5c)
Q5N667 6.99e-42 155 36 7 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5N667 5.04e-12 70 32 3 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B9KB98 7.58e-42 155 35 7 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B9KB98 3.67e-09 62 33 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q3K6T1 7.86e-42 155 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain Pf0-1)
Q3K6T1 3.39e-08 58 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain Pf0-1)
Q4K608 7.86e-42 155 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K608 3.39e-08 58 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B0T4Y1 8.56e-42 155 37 10 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter sp. (strain K31)
B0T4Y1 1.2e-09 63 33 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter sp. (strain K31)
B8GXW2 8.83e-42 155 36 11 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter vibrioides (strain NA1000 / CB15N)
B8GXW2 7.23e-10 63 39 4 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A6H4 8.83e-42 155 36 11 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A6H4 7.23e-10 63 39 4 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q888N4 8.89e-42 155 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q888N4 2.61e-08 59 33 4 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6USF9 9.04e-42 155 34 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6USF9 1.09e-06 54 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q4ZY66 1.07e-41 155 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas syringae pv. syringae (strain B728a)
Q4ZY66 3.58e-08 58 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas syringae pv. syringae (strain B728a)
Q48N66 1.07e-41 155 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48N66 3.58e-08 58 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
E0SRA9 1.08e-41 154 35 7 294 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Ignisphaera aggregans (strain DSM 17230 / JCM 13409 / AQ1.S1)
E0SRA9 9.59e-07 54 27 5 148 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Ignisphaera aggregans (strain DSM 17230 / JCM 13409 / AQ1.S1)
B5EP52 1.09e-41 155 36 6 285 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B5EP52 4.84e-11 67 29 3 164 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J643 1.09e-41 155 36 6 285 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B7J643 4.84e-11 67 29 3 164 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q8P5L5 1.11e-41 154 33 7 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8P5L5 1.59e-10 65 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RP32 1.11e-41 154 33 7 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain B100)
B0RP32 1.59e-10 65 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain B100)
Q4UYF7 1.11e-41 154 33 7 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain 8004)
Q4UYF7 1.59e-10 65 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas campestris pv. campestris (strain 8004)
Q5WEN2 1.21e-41 155 36 7 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shouchella clausii (strain KSM-K16)
Q5WEN2 2.42e-12 71 34 3 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Shouchella clausii (strain KSM-K16)
Q31HZ1 1.29e-41 154 31 6 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31HZ1 8.01e-10 63 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B9DMJ5 1.33e-41 154 32 10 338 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus carnosus (strain TM300)
B9DMJ5 1.12e-07 57 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus carnosus (strain TM300)
P65150 1.45e-41 154 33 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P65150 8.95e-14 75 34 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C0QMX0 1.51e-41 154 31 5 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain P12)
C0QMX0 1.84e-05 50 27 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain P12)
B2ILY8 1.61e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain CGSP14)
B2ILY8 9.28e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain CGSP14)
C1CPV5 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain Taiwan19F-14)
C1CPV5 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain Taiwan19F-14)
C1CIU7 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain P1031)
C1CIU7 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain P1031)
C1CCK9 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain JJA)
C1CCK9 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain JJA)
Q8DR03 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DR03 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97SD7 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SD7 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLL0 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B8ZLL0 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C5I0 1.62e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain 70585)
C1C5I0 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain 70585)
Q04M32 1.62e-41 154 32 5 312 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04M32 9.62e-07 54 30 2 133 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1L8U5 1.64e-41 154 35 7 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga sp. (strain RQ2)
B1L8U5 1.83e-09 62 34 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga sp. (strain RQ2)
Q9WZ20 1.64e-41 154 35 7 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WZ20 1.83e-09 62 34 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2K6M2 1.65e-41 154 35 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K6M2 2.9e-09 62 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PT89 1.65e-41 154 35 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium etli (strain CIAT 652)
B3PT89 2.9e-09 62 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium etli (strain CIAT 652)
Q0RDI8 1.69e-41 154 35 10 318 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q0RDI8 7.41e-10 63 31 3 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
C3ME70 2.05e-41 154 35 9 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sinorhizobium fredii (strain NBRC 101917 / NGR234)
C3ME70 8.74e-10 63 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A6SZZ1 2.07e-41 154 32 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Janthinobacterium sp. (strain Marseille)
A6SZZ1 3.15e-08 58 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Janthinobacterium sp. (strain Marseille)
B1I9N6 2.35e-41 154 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain Hungary19A-6)
B1I9N6 9.62e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae (strain Hungary19A-6)
B0SL33 2.92e-41 153 36 5 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SL33 2.6e-10 65 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCQ5 2.92e-41 153 36 5 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B0SCQ5 2.6e-10 65 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q9ZMA9 2.92e-41 153 31 5 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain J99 / ATCC 700824)
Q9ZMA9 9.98e-06 51 27 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain J99 / ATCC 700824)
B8E2W8 2.94e-41 153 36 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B8E2W8 7.99e-09 60 31 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q73VH7 2.95e-41 153 33 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73VH7 4.26e-13 73 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QJC6 2.95e-41 153 33 7 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium avium (strain 104)
A0QJC6 4.26e-13 73 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium avium (strain 104)
B8G7X1 3.01e-41 154 35 8 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aggregans (strain MD-66 / DSM 9485)
B8G7X1 1.25e-11 69 33 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q3BPK3 3.17e-41 153 34 6 288 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BPK3 1.3e-10 66 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5M2F2 3.34e-41 153 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M2F2 7.94e-06 51 29 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXV0 3.34e-41 153 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain CNRZ 1066)
Q5LXV0 7.94e-06 51 29 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain CNRZ 1066)
Q2FM37 3.39e-41 153 35 7 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FM37 1.3e-07 57 26 3 173 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
O33114 3.41e-41 153 33 6 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium leprae (strain TN)
O33114 4.15e-11 67 31 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium leprae (strain TN)
O25097 3.41e-41 153 31 5 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain ATCC 700392 / 26695)
O25097 1.63e-06 53 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Helicobacter pylori (strain ATCC 700392 / 26695)
B4U6I9 3.44e-41 153 36 6 295 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Hydrogenobaculum sp. (strain Y04AAS1)
B4U6I9 2.39e-10 65 36 5 127 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Hydrogenobaculum sp. (strain Y04AAS1)
Q2NAU8 3.5e-41 153 35 10 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Erythrobacter litoralis (strain HTCC2594)
Q2NAU8 5.63e-08 58 28 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Erythrobacter litoralis (strain HTCC2594)
A5G1L8 3.96e-41 153 36 7 298 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidiphilium cryptum (strain JF-5)
A5G1L8 3.71e-11 68 32 3 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Acidiphilium cryptum (strain JF-5)
A9BME9 4.16e-41 153 31 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Delftia acidovorans (strain DSM 14801 / SPH-1)
A9BME9 4.72e-08 58 30 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Delftia acidovorans (strain DSM 14801 / SPH-1)
Q59500 4.74e-41 153 33 7 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium avium
Q59500 1.16e-12 72 32 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycobacterium avium
Q9F0I7 4.93e-41 153 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus
Q9F0I7 2.63e-06 53 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus
Q03IJ9 4.93e-41 153 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03IJ9 2.63e-06 53 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B5ZVQ5 5.91e-41 153 34 8 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B5ZVQ5 2.27e-09 62 30 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q9UWX9 6.16e-41 152 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9UWX9 2.88e-05 49 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B5YEF3 7.05e-41 152 35 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B5YEF3 1.1e-08 60 31 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B5E1Q6 7.21e-41 152 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 19F (strain G54)
B5E1Q6 9.37e-07 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus pneumoniae serotype 19F (strain G54)
A6LPX8 7.24e-41 152 35 8 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LPX8 9.96e-13 72 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B9LGM7 7.99e-41 152 35 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
B9LGM7 3.52e-12 71 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WC26 7.99e-41 152 35 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A9WC26 3.52e-12 71 31 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B1WNP1 8.81e-41 152 32 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1WNP1 4.83e-10 64 31 3 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Crocosphaera subtropica (strain ATCC 51142 / BH68)
B2UYT8 9.76e-41 152 36 6 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium botulinum (strain Alaska E43 / Type E3)
B2UYT8 4.67e-07 55 26 2 134 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium botulinum (strain Alaska E43 / Type E3)
A4XR11 1.05e-40 152 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas mendocina (strain ymp)
A4XR11 2.61e-08 59 33 4 128 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas mendocina (strain ymp)
Q8CRQ6 1.16e-40 152 33 8 307 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CRQ6 1.91e-07 56 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMG0 1.16e-40 152 33 8 307 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HMG0 1.91e-07 56 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O32414 1.2e-40 152 36 9 297 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Magnetospirillum molischianum
O32414 2.75e-10 65 32 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Magnetospirillum molischianum
A5IJM5 1.35e-40 152 34 7 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IJM5 6.65e-09 61 33 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B4S6N3 1.35e-40 151 31 10 318 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B4S6N3 7.46e-12 70 33 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q6FZ98 1.4e-40 152 35 10 300 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella quintana (strain Toulouse)
Q6FZ98 1.13e-09 63 31 4 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella quintana (strain Toulouse)
A1WUW3 1.71e-40 151 35 8 287 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Halorhodospira halophila (strain DSM 244 / SL1)
A1WUW3 1.03e-11 69 31 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Halorhodospira halophila (strain DSM 244 / SL1)
B9JXM6 1.74e-40 151 34 8 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B9JXM6 9.15e-10 63 29 2 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A8AVN4 1.78e-40 151 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A8AVN4 1.03e-06 54 30 2 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q82UZ3 1.84e-40 151 38 5 250 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82UZ3 1.96e-08 59 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A5UMJ9 1.88e-40 151 35 7 296 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UMJ9 1.91e-09 62 31 2 132 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q02CM4 1.89e-40 151 34 8 307 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Solibacter usitatus (strain Ellin6076)
Q02CM4 1.53e-10 66 31 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Solibacter usitatus (strain Ellin6076)
B8DVE0 1.91e-40 152 33 7 309 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bifidobacterium animalis subsp. lactis (strain AD011)
B8DVE0 2.11e-06 53 28 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bifidobacterium animalis subsp. lactis (strain AD011)
A7I5I8 2.16e-40 151 35 11 320 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A7I5I8 6.23e-08 58 29 3 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q605K9 2.26e-40 151 35 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q605K9 4.77e-08 58 30 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1ILZ3 2.42e-40 151 34 10 338 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Koribacter versatilis (strain Ellin345)
Q1ILZ3 4.58e-09 61 33 4 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Koribacter versatilis (strain Ellin345)
B1XYB1 3.21e-40 150 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B1XYB1 1.14e-09 63 33 3 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A4G4H8 3.7e-40 150 32 8 304 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Herminiimonas arsenicoxydans
A4G4H8 6.46e-08 58 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Herminiimonas arsenicoxydans
A4WQ93 3.96e-40 150 34 6 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A4WQ93 1.01e-11 69 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A3CQ86 4.38e-40 150 32 5 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus sanguinis (strain SK36)
A3CQ86 1.17e-06 54 30 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus sanguinis (strain SK36)
Q6G2T6 4.42e-40 150 34 8 297 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6G2T6 7.57e-10 63 32 4 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q64BR7 5.33e-40 150 31 3 309 1 ilvC Ketol-acid reductoisomerase (NAD(+)) Uncultured archaeon GZfos26G2
Q64BR7 2.53e-06 53 30 3 112 1 ilvC Ketol-acid reductoisomerase (NAD(+)) Uncultured archaeon GZfos26G2
A4VXL3 5.49e-40 150 32 5 306 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus suis (strain 05ZYH33)
A4VXL3 8.83e-06 51 30 3 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus suis (strain 05ZYH33)
A4W3V8 5.49e-40 150 32 5 306 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus suis (strain 98HAH33)
A4W3V8 8.83e-06 51 30 3 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Streptococcus suis (strain 98HAH33)
Q98KM7 5.59e-40 150 35 8 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98KM7 2.12e-08 59 29 2 137 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4FPQ6 5.62e-40 150 32 5 302 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelagibacter ubique (strain HTCC1062)
Q4FPQ6 2.48e-10 65 34 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pelagibacter ubique (strain HTCC1062)
B0K0Y0 5.83e-40 150 36 9 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermoanaerobacter sp. (strain X514)
B0K0Y0 8.16e-09 60 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermoanaerobacter sp. (strain X514)
Q8RDK4 5.89e-40 150 35 7 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RDK4 1.68e-09 62 33 3 127 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q0AV19 5.92e-40 150 34 7 286 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AV19 7.68e-10 63 30 2 147 1 ilvC Ketol-acid reductoisomerase (NAD(P)(+)) Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
C8WR67 6.2e-40 150 34 8 297 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Alicyclobacillus acidocaldarius subsp. acidocaldarius (strain ATCC 27009 / DSM 446 / BCRC 14685 / JCM 5260 / KCTC 1825 / NBRC 15652 / NCIMB 11725 / NRRL B-14509 / 104-IA)
C8WR67 5.19e-11 67 33 3 131 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Alicyclobacillus acidocaldarius subsp. acidocaldarius (strain ATCC 27009 / DSM 446 / BCRC 14685 / JCM 5260 / KCTC 1825 / NBRC 15652 / NCIMB 11725 / NRRL B-14509 / 104-IA)
Q2J6V2 7.34e-40 149 35 11 303 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q2J6V2 5.57e-09 61 30 3 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q8G6V2 7.47e-40 150 34 7 288 3 ilvC1 Ketol-acid reductoisomerase (NADP(+)) 1 Bifidobacterium longum (strain NCC 2705)
Q8G6V2 1.07e-07 57 29 2 137 3 ilvC1 Ketol-acid reductoisomerase (NADP(+)) 1 Bifidobacterium longum (strain NCC 2705)
Q5V520 7.6e-40 150 33 9 319 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V520 2.67e-07 56 31 3 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8EN66 7.61e-40 150 34 6 284 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EN66 1.2e-13 75 33 2 148 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C3NET2 7.69e-40 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NET2 2.28e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
Q63VP6 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain K96243)
Q63VP6 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain K96243)
A3N7K4 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 668)
A3N7K4 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 668)
Q3JUC2 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 1710b)
Q3JUC2 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 1710b)
A3NT91 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 1106a)
A3NT91 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia pseudomallei (strain 1106a)
A1V2K2 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain SAVP1)
A1V2K2 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain SAVP1)
Q62IM0 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain ATCC 23344)
Q62IM0 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain ATCC 23344)
A2S472 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain NCTC 10229)
A2S472 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain NCTC 10229)
A3MI87 8.07e-40 150 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain NCTC 10247)
A3MI87 8.31e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia mallei (strain NCTC 10247)
Q8UDV0 8.6e-40 149 34 8 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UDV0 3.5e-09 62 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Agrobacterium fabrum (strain C58 / ATCC 33970)
B9KM37 8.62e-40 149 34 6 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B9KM37 1.04e-11 69 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PH14 8.62e-40 149 34 6 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A3PH14 1.04e-11 69 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J5C0 9.17e-40 149 34 6 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J5C0 1.12e-11 69 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1I4R5 9.41e-40 149 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas entomophila (strain L48)
Q1I4R5 6.91e-09 60 34 5 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas entomophila (strain L48)
Q1MED4 9.53e-40 149 34 8 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MED4 2.02e-10 65 31 2 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q03UU4 1.06e-39 149 34 6 310 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B2TIR4 1.2e-39 149 36 6 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium botulinum (strain Eklund 17B / Type B)
B2TIR4 5.11e-07 55 26 2 134 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Clostridium botulinum (strain Eklund 17B / Type B)
A7I0D4 1.23e-39 149 32 6 285 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A7I0D4 8.93e-08 57 31 1 102 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q0BDB6 1.24e-39 149 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BDB6 1.1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YTS0 1.24e-39 149 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia ambifaria (strain MC40-6)
B1YTS0 1.1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia ambifaria (strain MC40-6)
C3MW82 1.32e-39 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MW82 2.37e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KHT9 1.32e-39 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C4KHT9 2.37e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N6C4 1.32e-39 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.16.27)
C3N6C4 2.37e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain M.16.27)
C0R090 1.36e-39 149 34 7 299 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
C0R090 1.21e-05 50 26 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
C3NGW2 1.56e-39 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NGW2 2.04e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MQK4 1.57e-39 149 34 9 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MQK4 2.43e-05 50 30 0 78 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
B9KYS1 1.78e-39 149 33 6 317 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B9KYS1 2.83e-09 62 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A2SHM0 1.95e-39 149 34 9 317 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A2SHM0 3.95e-09 61 34 3 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q8TX44 2.01e-39 148 35 6 281 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TX44 1.66e-08 59 31 2 134 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B1J2D7 2.32e-39 148 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain W619)
B1J2D7 5.93e-09 61 34 5 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain W619)
A7NJH8 2.33e-39 148 35 9 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A7NJH8 6.33e-11 67 34 3 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Roseiflexus castenholzii (strain DSM 13941 / HLO8)
D0WGK0 2.36e-39 149 32 7 305 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Slackia exigua (strain ATCC 700122 / DSM 15923 / CIP 105133 / JCM 11022 / KCTC 5966 / S-7)
D0WGK0 2.07e-12 72 32 3 132 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Slackia exigua (strain ATCC 700122 / DSM 15923 / CIP 105133 / JCM 11022 / KCTC 5966 / S-7)
B2T2D1 2.39e-39 148 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2T2D1 4.22e-10 64 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q88DZ0 2.49e-39 148 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88DZ0 7.49e-09 60 34 5 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KHU2 2.49e-39 148 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain GB-1)
B0KHU2 7.49e-09 60 34 5 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain GB-1)
A5W952 2.49e-39 148 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W952 7.49e-09 60 34 5 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q142I6 2.84e-39 148 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia xenovorans (strain LB400)
Q142I6 1.87e-09 62 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia xenovorans (strain LB400)
B4RG67 3.16e-39 148 37 9 293 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Phenylobacterium zucineum (strain HLK1)
B4RG67 3.45e-10 65 36 4 130 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Phenylobacterium zucineum (strain HLK1)
Q2SZP8 3.25e-39 148 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SZP8 8.01e-10 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1B2W3 3.4e-39 148 34 6 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paracoccus denitrificans (strain Pd 1222)
A1B2W3 7.43e-12 70 33 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paracoccus denitrificans (strain Pd 1222)
A4TE07 3.41e-39 148 34 9 326 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycolicibacterium gilvum (strain PYR-GCK)
A4TE07 1.77e-11 68 31 2 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Mycolicibacterium gilvum (strain PYR-GCK)
Q0VSB5 3.49e-39 148 31 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VSB5 1.77e-10 65 36 4 129 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B3QSP0 3.71e-39 148 31 8 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B3QSP0 8.01e-10 63 27 2 161 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A4JGE3 3.86e-39 148 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia vietnamiensis (strain G4 / LMG 22486)
A4JGE3 1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1BUZ9 3.86e-39 148 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia orbicola (strain AU 1054)
Q1BUZ9 1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia orbicola (strain AU 1054)
B1JVQ4 3.86e-39 148 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia orbicola (strain MC0-3)
B1JVQ4 1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia orbicola (strain MC0-3)
A0K937 3.86e-39 148 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia cenocepacia (strain HI2424)
A0K937 1e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia cenocepacia (strain HI2424)
Q21HN0 4.37e-39 147 30 4 308 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21HN0 1.22e-09 63 31 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B2JDN9 4.64e-39 147 35 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2JDN9 5.38e-10 64 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q47SB6 5.16e-39 147 32 9 309 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermobifida fusca (strain YX)
Q47SB6 5.66e-07 55 29 3 144 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermobifida fusca (strain YX)
B9M5B1 5.28e-39 147 33 6 289 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B9M5B1 5.19e-12 70 34 5 154 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8GIC5 5.33e-39 147 37 5 249 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B8GIC5 8.85e-07 54 28 3 145 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B9EBF4 5.37e-39 147 33 7 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Macrococcus caseolyticus (strain JCSC5402)
B9EBF4 2.38e-07 56 30 3 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Macrococcus caseolyticus (strain JCSC5402)
B0KAH3 5.78e-39 147 35 9 291 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KAH3 7.8e-09 60 30 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B2J2U6 5.78e-39 147 33 9 336 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B2J2U6 2.84e-09 62 31 4 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q10WP7 5.84e-39 147 33 8 327 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichodesmium erythraeum (strain IMS101)
Q10WP7 1.04e-09 63 29 3 143 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichodesmium erythraeum (strain IMS101)
P65153 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MW2)
P65153 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MW2)
Q6GF17 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MRSA252)
Q6GF17 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MRSA252)
P65152 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain N315)
P65152 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain N315)
P65151 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain Mu50 / ATCC 700699)
P65151 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUF3 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YUF3 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUK2 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain JH9)
A5IUK2 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain JH9)
A6U3E1 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain JH1)
A6U3E1 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain JH1)
A7X4M9 6.93e-39 147 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X4M9 4.67e-07 55 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q39ED2 7.51e-39 147 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39ED2 1.52e-09 63 35 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1Y9N6 7.7e-39 147 35 8 301 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
B1Y9N6 2.9e-06 52 27 2 116 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
A9AJN1 8.49e-39 147 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia multivorans (strain ATCC 17616 / 249)
A9AJN1 1.16e-09 63 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia multivorans (strain ATCC 17616 / 249)
A6W7N6 8.91e-39 147 36 6 288 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A6W7N6 8.98e-10 63 28 2 139 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A9KQ65 9.85e-39 147 34 6 286 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9KQ65 6.57e-08 58 28 3 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A5FR44 1.07e-38 146 37 7 254 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A5FR44 4.03e-09 61 32 4 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q0C516 1.09e-38 147 34 8 283 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hyphomonas neptunium (strain ATCC 15444)
Q0C516 8.48e-11 67 28 2 160 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Hyphomonas neptunium (strain ATCC 15444)
A8L548 1.18e-38 146 36 13 316 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parafrankia sp. (strain EAN1pec)
A8L548 1.03e-10 66 31 2 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Parafrankia sp. (strain EAN1pec)
Q3Z891 1.22e-38 146 38 8 252 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q3Z891 3.07e-09 62 32 4 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B8HAS8 1.37e-38 146 33 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
B8HAS8 4.5e-10 64 30 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q24XT5 1.4e-38 146 39 8 254 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulfitobacterium hafniense (strain Y51)
Q24XT5 2.99e-11 68 31 2 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulfitobacterium hafniense (strain Y51)
B8FU98 1.4e-38 146 39 8 254 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B8FU98 2.99e-11 68 31 2 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q6G7Q2 1.4e-38 146 33 10 311 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MSSA476)
Q6G7Q2 1.2e-06 53 28 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus aureus (strain MSSA476)
A0JXZ6 1.41e-38 146 33 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Arthrobacter sp. (strain FB24)
A0JXZ6 7.78e-11 67 31 3 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Arthrobacter sp. (strain FB24)
B8CX20 1.42e-38 146 33 9 315 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8CX20 3.12e-07 55 33 4 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A0B5E0 1.48e-38 146 35 6 282 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A0B5E0 1.28e-06 53 28 2 135 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q3MGX7 1.57e-38 146 33 8 327 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MGX7 9.7e-11 66 32 4 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B4E5N5 1.63e-38 146 34 8 313 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B4E5N5 1.65e-09 62 34 3 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q3ZXI2 1.71e-38 146 37 7 254 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain CBDB1)
Q3ZXI2 4.18e-09 61 32 4 133 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Dehalococcoides mccartyi (strain CBDB1)
Q21T70 1.92e-38 146 32 6 312 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21T70 2.32e-10 65 34 3 131 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8YUM5 2.03e-38 145 33 8 327 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YUM5 1.07e-10 66 32 4 136 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6Q461 2.67e-38 145 38 4 231 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitratiruptor sp. (strain SB155-2)
A6Q461 1.45e-12 72 34 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitratiruptor sp. (strain SB155-2)
A9BGP6 2.7e-38 145 32 9 300 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Petrotoga mobilis (strain DSM 10674 / SJ95)
A9BGP6 2.19e-08 59 28 2 138 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Petrotoga mobilis (strain DSM 10674 / SJ95)
A9GW78 2.91e-38 145 33 7 295 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sorangium cellulosum (strain So ce56)
A9GW78 9.16e-09 60 28 2 146 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Sorangium cellulosum (strain So ce56)
A1RRZ8 3.53e-38 145 35 8 296 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
A1RRZ8 7.01e-07 54 27 2 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q0AGM0 3.54e-38 145 37 5 241 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AGM0 3.1e-08 58 27 2 140 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q4L7T9 4.01e-38 145 32 7 307 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus haemolyticus (strain JCSC1435)
Q4L7T9 9.86e-09 60 29 3 141 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Staphylococcus haemolyticus (strain JCSC1435)
Q8ZTE1 4.52e-38 145 34 9 323 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q8ZTE1 4.88e-07 55 29 2 126 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
P29107 4.84e-38 145 36 9 300 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P29107 1.67e-06 53 28 3 142 1 ilvC Ketol-acid reductoisomerase (NADP(+)) Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7M851 4.93e-38 145 33 7 290 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M851 6.74e-11 67 32 3 142 3 ilvC Ketol-acid reductoisomerase (NADP(+)) Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_12150
Feature type CDS
Gene ilvC
Product ketol-acid reductoisomerase
Location 149475 - 150950 (strand: -1)
Length 1476 (nucleotides) / 491 (amino acids)

Contig

Accession ZDB_689
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1323
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01450 Acetohydroxy acid isomeroreductase, catalytic domain
PF07991 Acetohydroxy acid isomeroreductase, NADPH-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0059 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
EH Ketol-acid reductoisomerase

Kegg Ortholog Annotation(s)

Protein Sequence

MANYFNTLNLRQQLAQLGKCRFMAREEFADEAGYLKGKKVVIVGCGAQGLNQGLNMRDSGLDIAYALRQEAIDEKRTSWRRATENGFTVGTYEELIPQADLVVNLTPDKQHSAVVKAVQPLMKSGAALGYSHGFNIVEVGETIRPDITVVMVAPKCPGTEVREEYKRGFGVPTLIAVHPENDAKGEGLAIAKAWAAATGGHRAGVLESSFVAEVKSDLMGEQTILCGMLQAGSLLCYDKMVADGADPAYAGKLIQYGWETITEALKQGGITLMMDRLSNPAKVRAYQLSETLKAQMKTLFEKHMDDIISGHFSSTMMADWANDDKNLLTWREETGKTAFENYPDSEQKISEQEYFDHGVVMVAMVKAGVELAFETMIDAGIIAESAYYESLHELPLIANTIARKRLYEMNVVISDTAEYGNYLFSFAAVPLLKDFMASLQPGDLGKSGADHGTDNAQLRDINEAIRRHPIETVGKTLRGYMTDMKRIAVGG

Flanking regions ( +/- flanking 50bp)

TCAGTGCTGCGAAGACAGCAATCTGAGCAAACACAATACACGGAGTCACCATGGCGAATTATTTTAATACACTGAATTTGCGCCAGCAGCTGGCGCAGTTAGGCAAATGCCGGTTTATGGCACGCGAAGAATTTGCGGACGAGGCTGGGTATCTCAAAGGCAAAAAAGTGGTGATTGTCGGCTGTGGTGCACAGGGGCTGAACCAAGGACTGAACATGCGCGATTCCGGGCTGGATATCGCCTATGCACTACGTCAGGAAGCGATCGATGAGAAGCGCACCTCATGGCGCCGCGCCACCGAAAACGGTTTTACCGTCGGCACGTATGAAGAACTGATCCCGCAGGCTGACCTGGTGGTTAACCTGACACCTGACAAACAGCATTCTGCGGTGGTTAAGGCGGTTCAGCCGCTGATGAAATCTGGCGCAGCGCTGGGTTACTCACACGGCTTCAATATTGTTGAAGTCGGCGAAACCATCCGCCCTGATATCACGGTTGTGATGGTGGCACCGAAATGCCCGGGTACAGAAGTGCGTGAAGAGTACAAGCGTGGCTTTGGTGTTCCGACACTGATTGCAGTCCATCCGGAAAATGATGCCAAAGGTGAAGGTCTGGCGATTGCCAAAGCCTGGGCTGCGGCAACCGGCGGTCACCGTGCGGGTGTTCTGGAATCATCCTTTGTTGCAGAAGTTAAATCTGACCTGATGGGCGAGCAGACTATCCTCTGCGGTATGCTGCAGGCCGGTTCTCTGCTCTGTTATGACAAAATGGTTGCTGACGGTGCGGATCCTGCGTATGCAGGCAAGCTGATCCAGTACGGCTGGGAAACCATCACTGAAGCGCTGAAACAGGGTGGGATCACGCTGATGATGGACAGATTGTCCAACCCGGCAAAAGTCCGTGCTTATCAGCTGTCTGAAACCCTGAAAGCACAGATGAAGACTCTGTTTGAAAAACATATGGATGACATCATTTCCGGCCATTTCTCCTCAACGATGATGGCGGACTGGGCGAATGATGATAAAAATCTGCTGACCTGGCGTGAAGAGACCGGCAAGACGGCATTTGAAAACTATCCGGATTCTGAGCAGAAAATCAGTGAGCAGGAATATTTTGACCACGGTGTTGTCATGGTCGCAATGGTGAAAGCCGGTGTTGAGCTGGCATTTGAAACCATGATTGACGCGGGGATCATTGCGGAATCTGCCTATTATGAATCACTGCATGAACTGCCGCTGATTGCCAACACCATTGCCCGTAAGCGTCTGTATGAAATGAACGTGGTTATCTCCGATACCGCAGAATACGGCAATTACCTGTTCTCCTTTGCAGCAGTGCCGTTACTGAAAGACTTTATGGCATCACTGCAGCCGGGTGACCTGGGTAAATCCGGCGCGGACCACGGTACGGATAACGCGCAGCTGCGTGATATCAATGAAGCAATTCGTCGGCATCCGATTGAAACTGTGGGTAAAACCCTGCGCGGCTATATGACGGATATGAAACGTATCGCGGTCGGCGGCTGATAACAAAATTGTTTAATGATGAAATGAGACGGCACCTGCGGGTGCCGTTT