Homologs in group_996

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05045 FBDBKF_05045 100.0 Morganella morganii S1 rsxG electron transport complex subunit RsxG
EHELCC_12545 EHELCC_12545 100.0 Morganella morganii S2 rsxG electron transport complex subunit RsxG
NLDBIP_12885 NLDBIP_12885 100.0 Morganella morganii S4 rsxG electron transport complex subunit RsxG
LHKJJB_12745 LHKJJB_12745 100.0 Morganella morganii S3 rsxG electron transport complex subunit RsxG
F4V73_RS05485 F4V73_RS05485 87.0 Morganella psychrotolerans rsxG electron transport complex subunit RsxG
PMI_RS06310 PMI_RS06310 65.4 Proteus mirabilis HI4320 rsxG electron transport complex subunit RsxG

Distribution of the homologs in the orthogroup group_996

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_996

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZED3 3.96e-98 286 65 0 208 3 rnfG Ion-translocating oxidoreductase complex subunit G Yersinia pestis
Q7N4F7 7.48e-98 285 66 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P77285 5.63e-96 281 65 1 206 1 rsxG Ion-translocating oxidoreductase complex subunit G Escherichia coli (strain K12)
P58345 2.21e-95 279 65 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Escherichia coli O157:H7
C6DH13 6.91e-94 275 62 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4W0 1.16e-92 272 60 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VEQ5 1.66e-90 267 61 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8ZPM4 2.62e-90 266 62 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z6Q7 4.05e-90 266 61 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Salmonella typhi
Q2NSZ9 5.47e-90 266 60 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Sodalis glossinidius (strain morsitans)
A7MML1 2.79e-89 264 63 1 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Cronobacter sakazakii (strain ATCC BAA-894)
C5BDE9 6.84e-78 235 55 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Edwardsiella ictaluri (strain 93-146)
Q7MM85 2.31e-65 203 46 1 209 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio vulnificus (strain YJ016)
B7VLT4 1.54e-63 198 44 1 209 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio atlanticus (strain LGP32)
Q87MX0 4.49e-61 192 46 0 192 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q15RL1 5.78e-60 189 50 1 194 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B6EGH3 1.61e-58 186 46 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio salmonicida (strain LFI1238)
Q5E6C0 2.42e-58 185 45 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FCN1 4.96e-58 184 45 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio fischeri (strain MJ11)
A5F2S8 2.07e-57 183 46 0 192 1 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LTR1 3.32e-56 180 46 0 192 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain M66-2)
Q9KT90 3.32e-56 180 46 0 192 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5UBI8 7.87e-56 179 46 1 196 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain PittEE)
P44291 2.49e-55 177 46 1 196 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B8E552 3.61e-55 177 45 1 198 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella baltica (strain OS223)
Q4QJQ4 5.89e-55 177 46 1 196 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain 86-028NP)
A3QEN8 3e-51 167 43 2 207 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9CNP4 3.42e-51 167 48 0 170 3 rnfG Ion-translocating oxidoreductase complex subunit G Pasteurella multocida (strain Pm70)
Q8EE77 9.38e-51 166 47 2 174 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q89AW6 1.46e-48 160 41 1 187 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1S6N3 3.97e-48 159 43 1 189 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B8CM54 7.83e-47 156 42 2 188 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella piezotolerans (strain WP3 / JCM 13877)
A4XS49 1.88e-45 152 44 0 189 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas mendocina (strain ymp)
P57217 1.14e-44 149 43 1 155 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9HYB6 1.69e-43 147 45 3 191 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QY2 1.69e-43 147 45 3 191 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVW9 1.69e-43 147 45 3 191 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain LESB58)
Q8KA18 1.25e-39 137 39 1 176 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P97054 2.12e-35 127 38 3 198 1 rnfG Ion-translocating oxidoreductase complex subunit G Rhodobacter capsulatus
Q3IXC2 1.81e-33 122 39 3 176 3 rnfG Ion-translocating oxidoreductase complex subunit G Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9EVN3 2.33e-32 119 45 2 142 3 rnfG Ion-translocating oxidoreductase complex subunit G Stutzerimonas stutzeri
A3PRP7 1.78e-31 117 41 2 156 3 rnfG Ion-translocating oxidoreductase complex subunit G Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8TSY2 1.44e-11 63 33 10 177 1 rnfG Ion-translocating oxidoreductase complex subunit G Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
H6LC30 4.22e-09 57 27 5 197 1 rnfG Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit G Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
D8GR68 4.27e-05 45 29 4 135 3 rnfG Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit G Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_11360
Feature type CDS
Gene rsxG
Product electron transport complex subunit RsxG
Location 165268 - 165894 (strand: -1)
Length 627 (nucleotides) / 208 (amino acids)
In genomic island -

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_996
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04205 FMN-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4659 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfG subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03612 H+/Na+-translocating ferredoxin:NAD+ oxidoreductase subunit G - -

Protein Sequence

MIATLRRYGLILALFAAGTTGLSGFVYTLTKPEIDKQAAAQQKALFAEILPESVYNNDVIAECYLVTDPALGNELPHRLYVARKDGTPVAAVLESTAPDGYSGNIQLLVAADFNRTVLGSRVTEHKETPGLGDKIDTRISDWITSLSGKHIESADDPHWAVKKDGGDFDQFTGATITPRAVVNAVRATADYMQTLPPLLNTLPQCGAE

Flanking regions ( +/- flanking 50bp)

ATCGATACCTACACACAACCGCGTGTTTACGGGCACAAACGGGGGAATAAATGATTGCCACATTACGCCGTTACGGCCTGATCCTCGCCCTGTTTGCCGCCGGTACCACCGGGCTGAGCGGGTTTGTCTACACCCTGACAAAACCGGAAATTGATAAGCAGGCCGCCGCACAGCAAAAGGCACTGTTTGCCGAAATCCTGCCGGAATCGGTTTATAATAATGATGTGATTGCAGAGTGTTATCTGGTCACCGATCCTGCCCTGGGTAATGAACTGCCGCACCGGCTGTATGTTGCCCGCAAAGACGGCACACCTGTCGCCGCAGTGCTGGAGTCCACCGCACCGGACGGCTATTCCGGTAATATTCAGCTGCTGGTTGCGGCTGATTTTAACCGTACCGTGCTCGGCTCCCGCGTGACCGAACACAAAGAGACACCGGGGCTGGGTGATAAAATTGATACCCGGATTTCAGACTGGATCACATCTCTGAGCGGCAAACATATTGAATCCGCTGATGACCCGCACTGGGCGGTGAAAAAAGACGGCGGGGATTTTGATCAGTTCACCGGTGCCACCATCACGCCGCGCGCAGTTGTCAATGCTGTCCGTGCAACAGCGGATTATATGCAGACACTGCCGCCGCTGCTGAACACCTTACCTCAATGCGGAGCAGAATAATGAGTCAGATTAAAGAGTTATTCGCCGACGGATTATGGAAAAACAACTCC