Homologs in group_929

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05045 FBDBKF_05045 87.0 Morganella morganii S1 rsxG electron transport complex subunit RsxG
EHELCC_12545 EHELCC_12545 87.0 Morganella morganii S2 rsxG electron transport complex subunit RsxG
NLDBIP_12885 NLDBIP_12885 87.0 Morganella morganii S4 rsxG electron transport complex subunit RsxG
LHKJJB_12745 LHKJJB_12745 87.0 Morganella morganii S3 rsxG electron transport complex subunit RsxG
HKOGLL_11360 HKOGLL_11360 87.0 Morganella morganii S5 rsxG electron transport complex subunit RsxG
PMI_RS06310 PMI_RS06310 63.9 Proteus mirabilis HI4320 rsxG electron transport complex subunit RsxG

Distribution of the homologs in the orthogroup group_929

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_929

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N4F7 1.14e-102 298 67 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZED3 1.92e-102 297 68 0 208 3 rnfG Ion-translocating oxidoreductase complex subunit G Yersinia pestis
P77285 2.66e-98 286 65 1 206 1 rsxG Ion-translocating oxidoreductase complex subunit G Escherichia coli (strain K12)
P58345 1.25e-97 285 65 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Escherichia coli O157:H7
C6DH13 1.73e-95 280 63 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4W0 1.07e-94 278 62 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8ZPM4 9.02e-93 273 61 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z6Q7 1.54e-92 272 61 1 206 3 rsxG Ion-translocating oxidoreductase complex subunit G Salmonella typhi
B2VEQ5 1.76e-91 270 61 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7MML1 9.58e-91 267 64 1 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Cronobacter sakazakii (strain ATCC BAA-894)
Q2NSZ9 7.11e-90 265 60 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Sodalis glossinidius (strain morsitans)
C5BDE9 1.77e-82 246 57 0 206 3 rnfG Ion-translocating oxidoreductase complex subunit G Edwardsiella ictaluri (strain 93-146)
Q7MM85 2.12e-66 206 47 1 208 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio vulnificus (strain YJ016)
B7VLT4 1.6e-65 204 45 1 209 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio atlanticus (strain LGP32)
Q15RL1 2.14e-63 198 52 1 194 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87MX0 9.18e-63 196 45 1 209 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6EGH3 2.17e-61 193 48 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio salmonicida (strain LFI1238)
B5FCN1 9.63e-58 184 45 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio fischeri (strain MJ11)
A5F2S8 1.28e-57 183 48 0 192 1 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q5E6C0 1.68e-57 183 45 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LTR1 2.32e-56 180 48 0 192 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain M66-2)
Q9KT90 2.32e-56 180 48 0 192 3 rnfG Ion-translocating oxidoreductase complex subunit G Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B8E552 3.93e-56 180 46 2 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella baltica (strain OS223)
A3QEN8 1.52e-53 173 45 1 204 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q89AW6 2.43e-53 173 40 2 198 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A5UBI8 7.63e-52 169 44 2 197 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain PittEE)
Q9CNP4 8.89e-52 168 48 0 173 3 rnfG Ion-translocating oxidoreductase complex subunit G Pasteurella multocida (strain Pm70)
P44291 2.12e-51 167 44 2 197 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QJQ4 4.3e-51 167 44 2 197 3 rnfG Ion-translocating oxidoreductase complex subunit G Haemophilus influenzae (strain 86-028NP)
A1S6N3 8.07e-50 164 43 1 193 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B8CM54 4.48e-49 162 44 1 185 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella piezotolerans (strain WP3 / JCM 13877)
A4XS49 7.4e-49 161 45 0 199 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas mendocina (strain ymp)
P57217 3.5e-48 158 48 1 147 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9HYB6 5.17e-48 159 45 1 190 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QY2 5.17e-48 159 45 1 190 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVW9 5.17e-48 159 45 1 190 3 rnfG Ion-translocating oxidoreductase complex subunit G Pseudomonas aeruginosa (strain LESB58)
Q8EE77 8.63e-47 156 42 2 191 3 rnfG Ion-translocating oxidoreductase complex subunit G Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8KA18 2.37e-44 149 44 1 172 3 rnfG Ion-translocating oxidoreductase complex subunit G Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P97054 2.67e-37 132 41 5 202 1 rnfG Ion-translocating oxidoreductase complex subunit G Rhodobacter capsulatus
A3PRP7 7.13e-35 125 43 2 158 3 rnfG Ion-translocating oxidoreductase complex subunit G Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3IXC2 1.56e-34 125 41 3 177 3 rnfG Ion-translocating oxidoreductase complex subunit G Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9EVN3 1.33e-33 122 42 4 179 3 rnfG Ion-translocating oxidoreductase complex subunit G Stutzerimonas stutzeri
Q8TSY2 4.47e-10 60 35 10 171 1 rnfG Ion-translocating oxidoreductase complex subunit G Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
H6LC30 5.39e-08 54 24 2 192 1 rnfG Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit G Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
D8GR68 2.52e-07 52 27 5 188 3 rnfG Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit G Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05485
Feature type CDS
Gene rsxG
Product electron transport complex subunit RsxG
Location 1167015 - 1167641 (strand: 1)
Length 627 (nucleotides) / 208 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_929
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04205 FMN-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4659 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfG subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03612 H+/Na+-translocating ferredoxin:NAD+ oxidoreductase subunit G - -

Protein Sequence

MIATLRRYGLILALFAAGTTGLSGFVYTLTKPAIEQQAAEQQKALFAQILPAGMYDNDMIAECYLVTDPMLGNNLPHRLYVARKNGEPVAAVLESTAPDGYSGAIQLLVAADFNQTVLGSRVTEHKETPGLGDKIDTRISDWITTLSGKHVDSAADPHWAVKKDGGDFDQFTGATITPRAVVNAVRKTAVYIQTLPPQLTELPHCGAE

Flanking regions ( +/- flanking 50bp)

ATTGATACCTATACACAACCCCGTGTTTACGGGCATAAACGGGGAAATAAATGATTGCCACATTGCGCCGTTACGGGTTGATCCTCGCCCTGTTTGCCGCCGGAACCACCGGTCTGAGCGGGTTTGTCTATACACTGACCAAACCGGCGATTGAGCAGCAGGCGGCTGAGCAGCAAAAAGCCCTGTTTGCCCAAATTCTGCCCGCCGGCATGTATGATAACGATATGATTGCAGAGTGTTATCTTGTGACCGACCCGATGCTGGGCAATAATCTGCCACACCGCCTGTATGTTGCCCGCAAAAATGGTGAACCGGTTGCGGCAGTCCTTGAATCCACCGCGCCGGATGGCTATTCAGGCGCCATTCAGCTACTGGTTGCCGCTGATTTTAACCAGACTGTACTGGGCAGCCGGGTAACTGAGCATAAAGAAACCCCGGGGCTGGGGGATAAAATTGATACCCGGATTTCAGACTGGATCACCACACTGAGCGGCAAACATGTGGATTCAGCCGCTGATCCGCACTGGGCAGTCAAAAAAGACGGCGGGGATTTCGATCAGTTCACCGGTGCAACGATCACGCCACGGGCGGTTGTTAATGCCGTGAGAAAAACGGCTGTGTATATACAGACATTGCCGCCACAATTAACTGAATTACCACACTGCGGAGCAGAATAATGAGTCAGGTCAAAACGTTATTCGCCGATGGTTTATGGAAAAATAACTCC