Homologs in group_1011

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05645 FBDBKF_05645 100.0 Morganella morganii S1 fabI enoyl-ACP reductase FabI
EHELCC_11945 EHELCC_11945 100.0 Morganella morganii S2 fabI enoyl-ACP reductase FabI
NLDBIP_12285 NLDBIP_12285 100.0 Morganella morganii S4 fabI enoyl-ACP reductase FabI
LHKJJB_12145 LHKJJB_12145 100.0 Morganella morganii S3 fabI enoyl-ACP reductase FabI
F4V73_RS03660 F4V73_RS03660 96.2 Morganella psychrotolerans fabI enoyl-ACP reductase FabI
PMI_RS06680 PMI_RS06680 88.5 Proteus mirabilis HI4320 fabI enoyl-ACP reductase FabI

Distribution of the homologs in the orthogroup group_1011

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1011

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16657 1.74e-170 474 85 0 262 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEK6 2.42e-170 473 85 0 262 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Shigella flexneri
P0AEK4 2.42e-170 473 85 0 262 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Escherichia coli (strain K12)
P0AEK5 2.42e-170 473 85 0 262 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Escherichia coli O157:H7
P44432 1.57e-145 410 76 0 259 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZFE4 6.69e-126 361 68 2 263 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89AM1 2.65e-112 326 56 0 260 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9K151 3.35e-111 323 62 1 258 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57353 2.54e-107 313 51 0 260 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9Q6 5.09e-98 290 49 0 259 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O67505 8.46e-87 262 49 3 265 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Aquifex aeolicus (strain VF5)
P58380 1.48e-86 261 50 1 259 3 fabI1 Enoyl-[acyl-carrier-protein] reductase [NADH] 1 Rhizobium meliloti (strain 1021)
P54616 1.06e-85 259 50 3 258 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Bacillus subtilis (strain 168)
P58381 3.66e-83 253 50 1 259 3 fabI2 Enoyl-[acyl-carrier-protein] reductase [NADH] 2 Rhizobium meliloti (strain 1021)
Q05069 5.67e-83 252 48 2 256 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q81GI3 1.34e-81 248 47 2 255 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9ZDG4 5.88e-81 247 44 1 258 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Rickettsia prowazekii (strain Madrid E)
Q68X10 6.93e-81 246 45 1 257 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q820V5 7.65e-80 243 46 2 251 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Enterococcus faecalis (strain ATCC 700802 / V583)
Q92IC6 1.14e-79 243 45 1 258 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULZ7 1.82e-79 243 44 1 258 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RH28 2.49e-79 243 46 1 258 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Rickettsia bellii (strain RML369-C)
Q9ZMN7 3.32e-79 243 46 1 262 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Helicobacter pylori (strain J99 / ATCC 700824)
O24990 4.13e-76 235 46 1 262 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Helicobacter pylori (strain ATCC 700392 / 26695)
P73016 1.46e-74 230 42 2 256 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GI75 2.8e-67 212 42 2 250 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADPH] FabI Staphylococcus aureus (strain MRSA252)
Q2FZQ3 2.77e-66 209 42 2 250 1 fabI Enoyl-[acyl-carrier-protein] reductase [NADPH] FabI Staphylococcus aureus (strain NCTC 8325 / PS 47)
P9WGR1 9.63e-33 123 33 9 274 1 inhA Enoyl-[acyl-carrier-protein] reductase [NADH] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGR0 9.63e-33 123 33 9 274 3 inhA Enoyl-[acyl-carrier-protein] reductase [NADH] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Y7 9.63e-33 123 33 9 274 1 inhA Enoyl-[acyl-carrier-protein] reductase [NADH] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P42829 5.4e-32 121 34 10 267 1 inhA Enoyl-[acyl-carrier-protein] reductase [NADH] Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9SLA8 2.18e-28 114 31 7 284 1 MOD1 Enoyl-[acyl-carrier-protein] reductase [NADH], chloroplastic Arabidopsis thaliana
P80030 1.35e-27 112 30 8 288 1 None Enoyl-[acyl-carrier-protein] reductase [NADH], chloroplastic Brassica napus
Q6H5J0 7.77e-27 110 34 4 186 2 Os09g0277800 Enoyl-[acyl-carrier-protein] reductase [NADH] 2, chloroplastic Oryza sativa subsp. japonica
Q6Z0I4 1.17e-26 109 36 5 185 2 Os08g0327400 Enoyl-[acyl-carrier-protein] reductase [NADH] 1, chloroplastic Oryza sativa subsp. japonica
O07400 5.92e-26 105 31 7 266 3 inhA Enoyl-[acyl-carrier-protein] reductase [NADH] Mycobacterium avium
P95727 4.89e-18 84 28 4 255 1 chcA 1-cyclohexenylcarbonyl-CoA reductase Streptomyces collinus
P71079 7.99e-18 83 28 8 254 1 fabL Enoyl-[acyl-carrier-protein] reductase [NADPH] FabL Bacillus subtilis (strain 168)
P0AET8 1.41e-17 82 29 6 253 1 hdhA 7alpha-hydroxysteroid dehydrogenase Escherichia coli (strain K12)
P0AET9 1.41e-17 82 29 6 253 3 hdhA 7alpha-hydroxysteroid dehydrogenase Escherichia coli O157:H7
Q21929 4.54e-14 73 30 12 263 1 dhs-21 L-xylulose reductase Caenorhabditis elegans
Q49117 9.39e-14 72 27 7 258 3 MexAM1_META1p0182 Uncharacterized oxidoreductase MexAM1_META1p0182 Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
P50161 1.95e-13 71 27 6 259 1 aflM Versicolorin reductase 1 Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
P80873 5.4e-12 67 27 8 254 1 ydaD General stress protein 39 Bacillus subtilis (strain 168)
Q00791 6.15e-12 67 26 7 262 2 stcU Versicolorin reductase stcU Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WGQ9 6.64e-12 67 26 9 254 1 Rv0769 Uncharacterized oxidoreductase Rv0769 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ8 6.64e-12 67 26 9 254 3 MT0793 Uncharacterized oxidoreductase MT0793 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q64591 7.87e-12 67 27 8 255 1 Decr1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Rattus norvegicus
M2WJF1 7.92e-12 67 26 9 263 2 ver1 Versicolorin reductase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
Q8TFD5 7.92e-12 67 26 9 263 2 ver1 Versicolorin reductase 1 Dothistroma septosporum
P0A2D1 1.17e-11 66 26 5 261 3 ucpA Oxidoreductase UcpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D2 1.17e-11 66 26 5 261 3 ucpA Oxidoreductase UcpA Salmonella typhi
A0A1L5BUG8 1.35e-11 66 25 6 256 3 linB 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase Sphingobium indicum (strain DSM 16412 / CCM 7286 / MTCC 6364 / B90A)
A0A5B8YU81 2.06e-11 65 25 6 263 2 GME11373 Short-chain dehydrogenase/reductase GME11373 Pestalotiopsis microspora
Q92EU6 2.79e-11 65 27 8 260 1 golD NAD-dependent glycerol dehydrogenase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P55575 2.93e-11 65 28 10 269 3 NGR_a02430 Uncharacterized short-chain type dehydrogenase/reductase y4mP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D4YYG1 3.1e-11 65 25 6 256 1 linC 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase Sphingobium indicum (strain DSM 16413 / CCM 7287 / MTCC 6362 / UT26 / NBRC 101211 / UT26S)
Q9CQ62 3.12e-11 65 26 8 255 1 Decr1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Mus musculus
E9ET40 6.98e-11 64 25 9 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
O67610 9.11e-11 63 27 10 261 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Aquifex aeolicus (strain VF5)
Q16698 9.17e-11 64 27 8 221 1 DECR1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Homo sapiens
P0DOV5 9.71e-11 63 27 8 260 1 PpSQ1_00405 Sulfoquinovose 1-dehydrogenase Pseudomonas putida
A0A0B4GU97 1.15e-10 63 25 9 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium guizhouense (strain ARSEF 977)
A0A0B4GT47 1.35e-10 63 25 9 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium anisopliae (strain ARSEF 549)
Q9FZ42 1.59e-10 63 22 5 256 1 ChlADR1 NADPH-dependent aldehyde reductase 1, chloroplastic Arabidopsis thaliana
P43713 1.79e-10 62 27 6 257 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A1A9TAK5 1.82e-10 63 25 7 260 1 NR Noroxomaritidine/norcraugsodine reductase Narcissus pseudonarcissus
A0A1C9II22 1.82e-10 63 25 7 260 1 NR Noroxomaritidine/norcraugsodine reductase Narcissus aff. pseudonarcissus MK-2014
O31680 2.21e-10 62 26 10 261 3 ykvO Uncharacterized oxidoreductase YkvO Bacillus subtilis (strain 168)
A0A165U5V5 2.8e-10 62 27 11 267 1 ADH1 Short chain aldehyde dehydrogenase 1 Euphorbia lathyris
E9EHG1 3.14e-10 62 24 8 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium acridum (strain CQMa 102)
Q94KL7 4.21e-10 62 27 9 265 1 None Secoisolariciresinol dehydrogenase (Fragment) Forsythia intermedia
Q8XBJ4 5.72e-10 61 26 7 265 3 ucpA Oxidoreductase UcpA Escherichia coli O157:H7
A0A0B4HVU2 6.21e-10 61 24 9 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium majus (strain ARSEF 297)
A0A0B4FP77 6.21e-10 61 24 9 268 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium brunneum (strain ARSEF 3297)
Q9PKF7 7.18e-10 61 25 8 254 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia muridarum (strain MoPn / Nigg)
O07575 7.39e-10 61 24 7 261 3 yhdF Uncharacterized oxidoreductase YhdF Bacillus subtilis (strain 168)
Q8CPI3 9.49e-10 60 26 7 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPW0 9.49e-10 60 26 7 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0ZT44 1.16e-09 60 24 5 258 2 RDT1 Elsinochrome reductase 1 Elsinoe fawcettii
P37440 1.24e-09 60 26 7 265 1 ucpA Oxidoreductase UcpA Escherichia coli (strain K12)
Q5FPE5 1.3e-09 60 26 13 265 1 GOX2015 Glucose 1-dehydrogenase Gluconobacter oxydans (strain 621H)
O34717 2.01e-09 60 27 8 259 2 fadH Probable 2,4-dienoyl-CoA reductase [(2E)-enoyl-CoA-producing] Bacillus subtilis (strain 168)
F4J300 2.31e-09 60 27 9 265 3 SDR5 Short-chain dehydrogenase reductase 5 Arabidopsis thaliana
Q9ZW12 2.31e-09 60 34 0 102 2 At2g29260 Tropinone reductase homolog At2g29260, chloroplastic Arabidopsis thaliana
Q53217 2.57e-09 60 26 5 249 3 NGR_a01150 Uncharacterized short-chain type dehydrogenase/reductase y4vI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q53217 5.57e-05 47 38 2 113 3 NGR_a01150 Uncharacterized short-chain type dehydrogenase/reductase y4vI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7Z4W1 2.59e-09 59 25 10 260 1 DCXR L-xylulose reductase Homo sapiens
P0A0I0 2.66e-09 59 27 8 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MW2)
Q6G9Y2 2.66e-09 59 27 8 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MSSA476)
Q6GHK4 2.66e-09 59 27 8 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MRSA252)
P99093 2.66e-09 59 27 8 256 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain N315)
P0A0H9 2.66e-09 59 27 8 256 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGK2 2.66e-09 59 27 8 256 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain COL)
Q9LBV3 3.8e-09 59 26 9 269 1 barS1 A-factor type gamma-butyrolactone 1'-reductase (1S-forming) Streptomyces virginiae
P50162 5.31e-09 58 26 11 262 1 TR1 Tropinone reductase 1 Datura stramonium
P39333 5.37e-09 58 27 9 254 1 bdcA Cyclic-di-GMP-binding biofilm dispersal mediator protein Escherichia coli (strain K12)
O80713 6.37e-09 58 24 7 265 2 SDR3a Short-chain dehydrogenase reductase 3a Arabidopsis thaliana
Q5P5I4 8.01e-09 58 27 7 249 1 ped (S)-1-Phenylethanol dehydrogenase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8WNV7 8.39e-09 58 25 4 239 1 DHRS4 Dehydrogenase/reductase SDR family member 4 Sus scrofa
Q10216 8.67e-09 58 28 4 170 3 SPAC4H3.08 Uncharacterized oxidoreductase C4H3.08 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8NK50 9.91e-09 58 24 9 257 1 lxr1 NADP-dependent mannitol dehydrogenase Hypocrea jecorina (strain ATCC 56765 / BCRC 32924 / NRRL 11460 / Rut C-30)
C8WGQ3 1.06e-08 58 26 8 261 1 Elen_1325 3beta-hydroxysteroid dehydrogenase 2 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q9Z8P2 1.08e-08 57 23 7 259 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia pneumoniae
A0A0H3KNE7 1.11e-08 57 26 5 211 1 BMULJ_04919 L-fucose dehydrogenase Burkholderia multivorans (strain ATCC 17616 / 249)
W3XC32 1.13e-08 58 23 5 259 2 Pfmaj Trihydroxynaphthalene reductase PfmaI Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P0A2C9 1.19e-08 57 26 7 250 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D0 1.19e-08 57 26 7 250 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Salmonella typhi
P80869 1.51e-08 57 23 7 258 1 ycdF Glucose 1-dehydrogenase 2 Bacillus subtilis (strain 168)
Q91VT4 1.62e-08 57 23 5 235 1 Cbr4 3-oxoacyl-[acyl-carrier-protein] reductase Mus musculus
Q9ZW15 1.72e-08 57 26 9 260 2 At2g29320 Tropinone reductase homolog At2g29320 Arabidopsis thaliana
P87025 2.13e-08 57 22 6 267 3 THR1 Trihydroxynaphthalene reductase Colletotrichum orbiculare (strain 104-T / ATCC 96160 / CBS 514.97 / LARS 414 / MAFF 240422)
Q6P0H7 2.16e-08 57 24 5 245 2 cbr4 Carbonyl reductase family member 4 Danio rerio
Q8N4T8 2.9e-08 56 24 6 236 1 CBR4 3-oxoacyl-[acyl-carrier-protein] reductase Homo sapiens
F9XMW6 3.11e-08 56 22 5 258 3 MYCGRDRAFT_87994 Probable tetrahydroxynaphthalene reductase MYCGRDRAFT_87994 Zymoseptoria tritici (strain CBS 115943 / IPO323)
P51831 3.33e-08 56 24 9 262 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Bacillus subtilis (strain 168)
P38004 4.34e-08 56 21 7 264 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A0A411PQN6 4.61e-08 56 24 7 265 3 AgnL6 Short chain dehydrogenase AgnL6 Paecilomyces divaricatus
P50842 5e-08 55 26 8 254 2 kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Bacillus subtilis (strain 168)
Q6TMA3 5.54e-08 55 25 7 271 1 chnA Cyclohexanol dehydrogenase Rhodococcus sp. (strain TK6)
Q9ZW20 5.95e-08 55 26 7 201 3 At2g29370 Tropinone reductase homolog At2g29370 Arabidopsis thaliana
Q42182 6.15e-08 55 26 10 263 2 At2g29300 Tropinone reductase homolog At2g29300 Arabidopsis thaliana
G9FRD7 6.16e-08 55 25 10 261 1 hdha 7alpha-hydroxysteroid dehydrogenase Clostridium sardiniense
A7B3K3 8.32e-08 55 40 1 79 1 baiA 3alpha-hydroxysteroid dehydrogenase Mediterraneibacter gnavus (strain ATCC 29149 / DSM 114966 / JCM 6515 / VPI C7-9)
P0CU75 1e-07 55 22 5 261 1 claC Short chain dehydrogenase claC Passalora fulva
Q9WYG0 1.1e-07 55 26 8 258 3 TM_0325 Uncharacterized oxidoreductase TM_0325 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q4UK62 1.13e-07 54 28 8 213 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P06234 1.19e-07 54 23 8 259 3 nodG Nodulation protein G Rhizobium meliloti (strain 1021)
P72332 1.27e-07 54 22 7 262 3 nodG Nodulation protein G Rhizobium sp. (strain N33)
Q5RBV3 1.3e-07 55 31 2 107 2 DECR2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Pongo abelii
P87218 1.35e-07 55 24 9 262 3 SOU2 Sorbose reductase homolog SOU2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8K9J5 1.36e-07 54 27 8 197 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P40397 1.38e-07 55 21 6 252 3 yhxC Uncharacterized oxidoreductase YhxC Bacillus subtilis (strain 168)
A1CFM1 1.54e-07 54 31 5 143 1 patN Isoepoxydon dehydrogenase patN Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q91XV4 1.57e-07 54 26 7 200 1 DCXR L-xylulose reductase Mesocricetus auratus
P0AG84 1.6e-07 54 23 6 258 1 yghA Uncharacterized oxidoreductase YghA Escherichia coli (strain K12)
P0AG85 1.6e-07 54 23 6 258 3 yghA Uncharacterized oxidoreductase YghA Escherichia coli O157:H7
P87219 1.64e-07 54 24 8 259 1 SOU1 Sorbose reductase SOU1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q15SS0 1.79e-07 54 25 9 258 1 Patl_2552 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P0C0Y4 1.8e-07 54 24 9 258 1 None NADP-dependent mannitol dehydrogenase Alternaria alternata
Q5LA59 1.8e-07 54 26 12 268 1 hdhA 7alpha-hydroxysteroid dehydrogenase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q6NV34 1.83e-07 54 33 3 107 2 decr2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Danio rerio
Q12634 1.87e-07 54 23 6 263 1 MGG_02252 Tetrahydroxynaphthalene reductase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P12310 1.92e-07 54 24 9 262 2 gdh Glucose 1-dehydrogenase Bacillus subtilis (strain 168)
P0AEK3 2.15e-07 53 26 7 250 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Shigella flexneri
P0AEK2 2.15e-07 53 26 7 250 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Escherichia coli (strain K12)
H9BFQ2 2.64e-07 53 24 4 246 2 None Tropinone reductase-like 3 Erythroxylum coca
P0C0Y5 2.69e-07 53 25 11 258 1 None NADP-dependent mannitol dehydrogenase Davidiella tassiana
Q9NUI1 2.87e-07 53 34 2 97 1 DECR2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Homo sapiens
Q99LB2 3.04e-07 53 25 6 251 1 Dhrs4 Dehydrogenase/reductase SDR family member 4 Mus musculus
P50164 3.89e-07 53 23 10 265 2 TR2 Tropinone reductase 2 Hyoscyamus niger
P32573 4.49e-07 53 26 6 190 1 SPS19 Peroxisomal 2,4-dienoyl-CoA reductase SPS19 [(3E)-enoyl-CoA-producing] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P50941 5.3e-07 52 26 10 258 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia prowazekii (strain Madrid E)
Q93761 5.7e-07 53 29 2 118 3 F53C11.3 Uncharacterized oxidoreductase F53C11.3 Caenorhabditis elegans
Q1JP75 5.96e-07 52 23 9 259 2 DCXR L-xylulose reductase Bos taurus
Q68VY7 6.22e-07 52 25 10 253 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q75KH3 8.02e-07 52 22 7 270 2 Os05g0140800 Glucose and ribitol dehydrogenase homolog Oryza sativa subsp. japonica
A0A075TRB3 8.11e-07 52 28 6 153 1 patN Isoepoxydon dehydrogenase patN Penicillium expansum
F4J2Z7 9.23e-07 52 28 12 274 2 SDR4 Short-chain dehydrogenase reductase 4 Arabidopsis thaliana
G5EGA6 9.48e-07 52 23 8 259 1 dhrs-4 Dehydrogenase/reductase SDR family member 4 Caenorhabditis elegans
A0A3Q8GLE8 1.16e-06 52 27 12 272 1 NEPS3 (+)-cis,cis-nepetalactol synthase NEPS3 Nepeta racemosa
Q9LHT0 1.19e-06 52 30 0 94 2 At5g06060 Tropinone reductase homolog At5g06060 Arabidopsis thaliana
P46331 1.19e-06 52 24 9 262 3 yxbG Uncharacterized oxidoreductase YxbG Bacillus subtilis (strain 168)
O31642 1.22e-06 52 24 8 256 3 yjdA Uncharacterized oxidoreductase YjdA Bacillus subtilis (strain 168)
F4IKM1 1.31e-06 52 27 13 262 2 At2g29340 Tropinone reductase homolog At2g29340 Arabidopsis thaliana
P33368 1.38e-06 51 29 3 134 1 yohF Uncharacterized oxidoreductase YohF Escherichia coli (strain K12)
D4Z260 1.42e-06 51 25 9 257 1 linX 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX Sphingobium indicum (strain DSM 16413 / CCM 7287 / MTCC 6362 / UT26 / NBRC 101211 / UT26S)
A0A1L5BU05 1.42e-06 51 25 9 257 3 linX 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX Sphingobium indicum (strain DSM 16412 / CCM 7286 / MTCC 6364 / B90A)
P16543 1.45e-06 51 32 3 128 3 gra-orf6 Granaticin polyketide synthase putative ketoacyl reductase 2 Streptomyces violaceoruber
A4IFA7 1.61e-06 51 25 6 245 2 CBR4 3-oxoacyl-[acyl-carrier-protein] reductase Bos taurus
P0DXE1 1.72e-06 51 27 9 259 1 chcB2 Cis-4-hydroxycyclohexanecarboxylate dehydrogenase Corynebacterium cyclohexanicum
Q9BTZ2 1.91e-06 51 24 6 246 1 DHRS4 Dehydrogenase/reductase SDR family member 4 Homo sapiens
Q9LBG2 2.02e-06 51 24 10 270 1 lvr Levodione reductase Leifsonia aquatica
Q5RCF8 2.1e-06 51 24 6 246 2 DHRS4 Dehydrogenase/reductase SDR family member 4 Pongo abelii
Q6NUE2 2.24e-06 50 24 8 221 2 cbr4 Carbonyl reductase family member 4 Xenopus laevis
P50163 2.39e-06 51 24 11 265 1 TR2 Tropinone reductase 2 Datura stramonium
P55336 2.61e-06 50 26 7 252 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Vibrio harveyi
Q9ZW13 2.83e-06 50 22 7 256 2 At2g29290 Tropinone reductase homolog At2g29290 Arabidopsis thaliana
Q9URX0 2.96e-06 50 28 11 256 3 SPAC922.06 Uncharacterized oxidoreductase C922.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P05406 3.1e-06 50 37 1 89 3 fixR Protein FixR Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5BH34 3.19e-06 50 26 11 263 1 mdpC Short chain dehydrogenase mdpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q3KPT7 3.58e-06 50 23 7 259 2 bdh2 Dehydrogenase/reductase SDR family member 6 Xenopus laevis
Q92GE0 3.89e-06 50 27 8 213 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia conorii (strain ATCC VR-613 / Malish 7)
E9QUT3 3.96e-06 50 22 8 259 3 arp2 Hydroxynaphthalene reductase arp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q91X52 4.09e-06 50 25 10 253 1 Dcxr L-xylulose reductase Mus musculus
Q5KTS5 4.09e-06 50 21 6 257 2 CAISE5 Glucose and ribitol dehydrogenase Daucus carota
Q9ZW14 4.11e-06 50 25 13 275 2 At2g29310 Tropinone reductase homolog At2g29310 Arabidopsis thaliana
Q9X450 4.39e-06 46 50 0 46 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI (Fragment) Rhizobium meliloti
Q5C9I9 5.42e-06 50 26 8 260 1 None (-)-isopiperitenol/(-)-carveol dehydrogenase, mitochondrial Mentha piperita
Q9ZW16 5.48e-06 50 38 3 97 1 TRI Tropinone reductase homolog At2g29330 Arabidopsis thaliana
F1SWA0 5.53e-06 50 24 8 262 1 ZSD1 Zerumbone synthase Zingiber zerumbet
Q9KJF1 5.55e-06 50 25 11 261 1 bbsD (2S)-[(R)-hydroxy(phenyl)methyl]succinyl-CoA dehydrogenase subunit BbsD Thauera aromatica
A0A2I1C3T5 5.65e-06 50 21 5 264 1 nsrJ Short chain dehydrogenase/reductase nsrJ Aspergillus novofumigatus (strain IBT 16806)
Q22230 5.8e-06 50 25 11 264 3 decr-1.3 Probable 2,4-dienoyl-CoA reductase 3 [(3E)-enoyl-CoA-producing] Caenorhabditis elegans
C1C4R8 6.69e-06 49 23 7 259 2 bdh2 Dehydrogenase/reductase SDR family member 6 Aquarana catesbeiana
Q9KQH7 7.03e-06 49 25 7 252 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O13908 7.21e-06 49 24 9 261 3 SPAC22A12.17c Uncharacterized oxidoreductase C22A12.17c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O49332 7.32e-06 49 26 13 266 3 At2g30670 Tropinone reductase homolog At2g30670 Arabidopsis thaliana
Q23116 8.38e-06 49 32 2 123 3 decr-1.2 Probable 2,4-dienoyl-CoA reductase decr-1.2 [(3E)-enoyl-CoA-producing] Caenorhabditis elegans
M1W270 8.58e-06 49 24 7 262 2 CPUR_05429 Short chain dehydrogenase CPUR_05429 Claviceps purpurea (strain 20.1)
Q9ZW03 8.59e-06 49 26 7 219 1 At2g29150 Tropinone reductase homolog At2g29150 Arabidopsis thaliana
Q68ER2 8.91e-06 49 25 6 197 2 cbr4 Carbonyl reductase family member 4 Xenopus tropicalis
P40398 9.06e-06 49 21 6 260 3 yhxD Uncharacterized oxidoreductase YhxD Bacillus subtilis (strain 168)
Q9X248 9.51e-06 49 24 8 262 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5TJF5 1.02e-05 49 25 6 204 3 HSD17B8 (3R)-3-hydroxyacyl-CoA dehydrogenase Canis lupus familiaris
P9WGQ5 1.08e-05 49 27 5 195 1 Rv0927c Uncharacterized oxidoreductase Rv0927c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ4 1.08e-05 49 27 5 195 3 MT0954 Uncharacterized oxidoreductase MT0954 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0DXE0 1.08e-05 49 24 7 230 1 chcB1 Trans-4-hydroxycyclohexanecarboxylate dehydrogenase Corynebacterium cyclohexanicum
C8WJW0 1.1e-05 49 23 6 259 1 Elen_0198 3beta-hydroxysteroid dehydrogenase 1 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q1MLL4 1.22e-05 48 28 7 198 1 gdh Galactitol 2-dehydrogenase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q920N9 1.34e-05 48 24 9 259 2 DCXR L-xylulose reductase Cavia porcellus
P50165 1.4e-05 48 28 1 105 2 None Tropinone reductase homolog Datura stramonium
A0A2U8U2K8 1.46e-05 48 25 8 259 1 asL5 Oxidoreductase asL5 Sarocladium schorii
P50200 1.58e-05 48 33 6 126 1 None 7alpha-hydroxysteroid dehydrogenase Paraclostridium sordellii
Q9C826 1.9e-05 48 24 10 281 1 ABA2 Xanthoxin dehydrogenase Arabidopsis thaliana
Q920P0 1.94e-05 48 25 10 253 1 Dcxr L-xylulose reductase Rattus norvegicus
P08074 2.17e-05 48 28 6 153 1 Cbr2 Carbonyl reductase [NADPH] 2 Mus musculus
A7DY56 2.18e-05 48 30 0 94 1 TR Tropinone reductase Cochlearia officinalis
Q8VID1 2.21e-05 48 23 4 239 2 Dhrs4 Dehydrogenase/reductase SDR family member 4 Rattus norvegicus
Q7TS56 2.31e-05 48 22 5 237 2 Cbr4 3-oxoacyl-[acyl-carrier-protein] reductase Rattus norvegicus
P17611 2.39e-05 48 24 11 265 3 nodG Nodulation protein G Azospirillum brasilense
Q1RKB7 2.41e-05 48 26 8 213 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia bellii (strain RML369-C)
Q08632 2.46e-05 48 23 7 263 2 None Short-chain type dehydrogenase/reductase Picea abies
Q51576 2.54e-05 48 27 11 258 3 PA3106 Uncharacterized oxidoreductase PA3106 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9MA93 2.64e-05 48 23 10 273 2 At3g05260 Glucose and ribitol dehydrogenase homolog 2 Arabidopsis thaliana
Q8SPU8 2.76e-05 48 22 4 239 2 DHRS4 Dehydrogenase/reductase SDR family member 4 Bos taurus
Q9WVK3 3.48e-05 47 21 8 269 2 Pecr Peroxisomal trans-2-enoyl-CoA reductase Rattus norvegicus
Q9SQR2 3.53e-05 47 22 10 266 1 ChlADR2 NADPH-dependent aldehyde reductase 2, chloroplastic Arabidopsis thaliana
Q8KWS9 3.56e-05 47 22 10 276 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus amyloliquefaciens
Q13268 3.82e-05 47 23 5 256 1 DHRS2 Dehydrogenase/reductase SDR family member 2, mitochondrial Homo sapiens
Q8JIS3 4.03e-05 47 26 4 151 1 DER D-erythrulose reductase Gallus gallus
P42556 4.5e-05 47 34 4 103 1 PTR1 Pteridine reductase 1 Leishmania tarentolae
K4N0V2 4.56e-05 47 26 11 260 1 BDH Borneol dehydrogenase, mitochondrial Lavandula x intermedia
P54795 5.14e-05 47 33 2 102 3 moaE Protein MoaE Klebsiella aerogenes
O31767 5.4e-05 47 24 9 253 3 ymfI Uncharacterized oxidoreductase YmfI Bacillus subtilis (strain 168)
Q8KWT4 5.47e-05 47 22 8 272 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus subtilis
P07914 6.05e-05 47 30 2 96 1 baiA1 3alpha-hydroxy bile acid-CoA-ester 3-dehydrogenase 1/3 Clostridium scindens (strain JCM 10418 / VPI 12708)
Q9S9W2 6.26e-05 47 25 5 252 1 SDRA Short-chain dehydrogenase/reductase SDRA Arabidopsis thaliana
Q988B7 6.36e-05 46 25 8 258 1 pldh-t Pyridoxal 4-dehydrogenase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P50199 6.5e-05 46 21 9 259 1 gno Gluconate 5-dehydrogenase Gluconobacter oxydans (strain 621H)
H9BFQ0 7.19e-05 46 24 6 256 2 None Tropinone reductase-like 1 Erythroxylum coca
H9XP47 7.7e-05 46 26 9 251 1 budC Meso-2,3-butanediol dehydrogenase Serratia marcescens
A0A3Q8GL18 8.6e-05 46 24 8 262 1 NEPS1 (+)-cis,trans-nepetalactol synthase NEPS1 Nepeta racemosa
A0A384JQF5 8.66e-05 46 26 11 269 2 aba4 Short-chain dehydrogenase/reductase aba4 Botryotinia fuckeliana (strain B05.10)
P0A9P9 8.82e-05 46 21 6 262 1 idnO 5-keto-D-gluconate 5-reductase Escherichia coli (strain K12)
P0A9Q0 8.82e-05 46 21 6 262 3 idnO 5-keto-D-gluconate 5-reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O34782 8.87e-05 46 25 10 264 3 yvrD Uncharacterized oxidoreductase YvrD Bacillus subtilis (strain 168)
Q9ZW04 9.06e-05 46 25 11 256 3 At2g29170 Tropinone reductase homolog At2g29170 Arabidopsis thaliana
A3LZU7 9.95e-05 46 35 2 92 1 DHG2 L-rhamnose-1-dehydrogenase Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q9ZW19 0.000113 46 25 8 201 1 SDR Tropinone reductase homolog At2g29360 Arabidopsis thaliana
Q56841 0.000126 45 25 8 254 1 xecE1 2-(S)-hydroxypropyl-CoM dehydrogenase 1 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A0A8F5XX49 0.000131 45 24 10 277 1 BDH2 (+)-borneol dehydrogenase 2 Salvia officinalis
Q45219 0.000134 45 25 7 260 3 blr2146 Probable short-chain type dehydrogenase/reductase blr2146 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P39640 0.000141 45 22 9 275 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus subtilis (strain 168)
Q9JIF5 0.000142 45 22 7 246 1 PECR Peroxisomal trans-2-enoyl-CoA reductase Cavia porcellus
B8H1Z0 0.000155 45 25 8 259 1 xylB D-xylose 1-dehydrogenase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9Z0 0.000155 45 25 8 259 1 xylB D-xylose 1-dehydrogenase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0A4P8DJW8 0.000165 45 22 7 268 3 dmxR18 Short chain dehydrogenase/reductase dmxR18 Cryptosporiopsis sp. (strain 8999)
P0DKI3 0.000171 45 34 2 93 1 At1g07440 Tropinone reductase homolog At1g07440 Arabidopsis thaliana
Q3T046 0.000178 45 24 8 260 2 BDH2 Dehydrogenase/reductase SDR family member 6 Bos taurus
O42866 0.000184 45 24 12 256 3 oar2 3-oxoacyl-[acyl-carrier-protein] reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O54438 0.000192 45 26 10 259 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92506 0.000207 45 25 6 204 1 HSD17B8 (3R)-3-hydroxyacyl-CoA dehydrogenase Homo sapiens
A0A3Q8GYY4 0.000251 45 24 6 220 1 NEPS2 (+)-cis,trans-nepetalactol synthase NEPS2 Nepeta racemosa
Q9BY49 0.000301 45 21 8 266 1 PECR Peroxisomal trans-2-enoyl-CoA reductase Homo sapiens
P55541 0.000311 44 23 5 251 3 NGR_a02730 Uncharacterized short-chain type dehydrogenase/reductase y4lA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9GKX2 0.000351 44 22 4 239 1 DHRS4 Dehydrogenase/reductase SDR family member 4 (Fragment) Oryctolagus cuniculus
A7AZH2 0.00036 44 22 6 272 1 RUMGNA_00694 3beta-hydroxysteroid dehydrogenase Mediterraneibacter gnavus (strain ATCC 29149 / DSM 114966 / JCM 6515 / VPI C7-9)
Q9SQR4 0.000369 44 22 7 263 3 At3g03980 NADPH-dependent aldehyde reductase-like protein, chloroplastic Arabidopsis thaliana
P19337 0.000384 44 22 9 261 1 baiA2 3alpha-hydroxy bile acid-CoA-ester 3-dehydrogenase 2 Clostridium scindens (strain JCM 10418 / VPI 12708)
P57432 0.000399 44 28 5 135 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A3F5F0 0.000482 44 24 12 258 1 SDH Secoisolariciresinol dehydrogenase Sinopodophyllum hexandrum
Q89AG9 0.000544 43 25 3 136 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P10528 0.000553 43 23 10 259 3 gdhA Glucose 1-dehydrogenase A Priestia megaterium
Q94KL8 0.000589 43 25 12 255 1 None Secoisolariciresinol dehydrogenase (Fragment) Podophyllum peltatum
Q6MGB5 0.000596 43 29 4 151 1 Hsd17b8 (3R)-3-hydroxyacyl-CoA dehydrogenase Rattus norvegicus
A0A1L9WLH9 0.000608 43 23 7 268 1 AacuN Short chain dehydrogenase/reductase AacuN Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q9M1K9 0.000621 43 26 11 264 1 TA1 Short-chain dehydrogenase reductase ATA1 Arabidopsis thaliana
P52037 0.000631 43 21 9 253 1 ygfF Uncharacterized oxidoreductase YgfF Escherichia coli (strain K12)
Q5RCH8 0.000635 43 20 8 266 2 PECR Peroxisomal trans-2-enoyl-CoA reductase Pongo abelii
P57793 0.000668 43 22 7 262 1 SAMN02910417_01454 Phloroglucinol reductase Eubacterium oxidoreducens
W3XAA0 0.00068 43 25 7 224 1 PfmaG Tetrahydroxynaphthalene reductase PfmaG Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
H9BFQ1 0.00072 43 25 12 269 2 None Tropinone reductase-like 2 Erythroxylum coca
C0KTJ6 0.000721 43 27 1 101 1 None Galactitol 2-dehydrogenase (L-tagatose-forming) Cereibacter sphaeroides
Q92RN6 0.000754 43 28 1 98 3 galD Probable galactose dehydrogenase GalD Rhizobium meliloti (strain 1021)
Q56632 0.000832 43 25 5 206 3 vibA Vibriobactin-specific 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O07399 0.000846 43 23 4 194 3 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycobacterium avium
A7IQH5 0.000886 43 25 6 235 1 xecE3 2-(S)-hydroxypropyl-CoM dehydrogenase 3 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
P40288 0.000892 43 21 6 258 1 None Glucose 1-dehydrogenase Priestia megaterium
Q94K41 0.001 43 25 12 267 2 SDR3b Short-chain dehydrogenase reductase 3b Arabidopsis thaliana
P39484 0.001 43 23 10 259 3 gdhIII Glucose 1-dehydrogenase 3 Priestia megaterium

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10760
Feature type CDS
Gene fabI
Product enoyl-ACP reductase FabI
Location 44265 - 45053 (strand: -1)
Length 789 (nucleotides) / 262 (amino acids)

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1011
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13561 Enoyl-(Acyl carrier protein) reductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0623 Lipid transport and metabolism (I) I Enoyl-[acyl-carrier-protein] reductase FabI

Kegg Ortholog Annotation(s)

Protein Sequence

MGFMTGKRILITGVASKLSIAYGIAKAMRDQGAELAFTYQNDKLKPRVEEFAQSLGSSIVLPCDVAEDESIENLFTELAKVWPKFDGFVHSIGFAPADQLDGDYVDAVNREGFRIAHDISAYSFVAMAKACRSMLNPNSALLTLSYLGAERAIPNYNTMGLAKASLEANVRYMANAMGKETIRVNAVSAGPIRTLAASGIKDFRKMLSHCEAVTPLRRTVTTEDVGNAAAFLCSDLAGGITGEILHVDGGFSIAAMNELELK

Flanking regions ( +/- flanking 50bp)

CTGCCGGGTTGCGGCGCAGAAGGTGACAGAGAAAACACAAGGAAACTGCTATGGGTTTTATGACCGGTAAACGCATCCTGATCACAGGGGTTGCAAGCAAATTATCGATTGCTTACGGTATTGCCAAAGCAATGCGTGACCAGGGGGCGGAACTTGCATTCACCTACCAGAATGACAAGCTGAAACCCCGTGTTGAAGAGTTCGCTCAGTCTCTGGGTTCCTCCATCGTTCTGCCTTGCGATGTGGCAGAAGATGAAAGTATTGAAAATCTGTTCACGGAATTAGCCAAAGTCTGGCCGAAATTTGACGGTTTTGTTCACTCTATCGGCTTTGCCCCGGCTGACCAACTGGACGGCGACTATGTGGATGCGGTAAACCGTGAAGGCTTCCGTATTGCTCACGACATCAGCGCGTACAGTTTTGTGGCGATGGCAAAAGCCTGCCGCAGTATGCTGAACCCGAATTCCGCCCTGCTGACACTCTCTTACCTGGGGGCGGAACGTGCTATCCCGAACTACAATACCATGGGTCTTGCTAAAGCCTCTCTCGAAGCGAACGTCCGTTATATGGCGAACGCGATGGGGAAAGAAACCATCCGTGTTAATGCGGTTTCTGCCGGTCCTATCCGTACACTGGCAGCATCCGGTATTAAAGATTTCCGCAAAATGCTGTCGCACTGTGAAGCAGTCACCCCGCTGCGCCGTACAGTCACCACAGAAGATGTGGGTAACGCGGCAGCGTTCCTCTGCTCTGATCTGGCCGGCGGTATTACCGGTGAAATCCTGCATGTTGACGGCGGTTTCAGTATCGCGGCAATGAATGAGCTGGAACTGAAATAAGGCAACCGGCCTCTGCATGGCAGAGGCTGTGTTTTCTGCACGTTCGGTGT