Homologs in group_3077

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18835 FBDBKF_18835 100.0 Morganella morganii S1 cobQ cobyric acid synthase
EHELCC_17030 EHELCC_17030 100.0 Morganella morganii S2 cobQ cobyric acid synthase
NLDBIP_18410 NLDBIP_18410 100.0 Morganella morganii S4 cobQ cobyric acid synthase
LHKJJB_09215 LHKJJB_09215 100.0 Morganella morganii S3 cobQ cobyric acid synthase
F4V73_RS13760 F4V73_RS13760 90.0 Morganella psychrotolerans - cobyric acid synthase

Distribution of the homologs in the orthogroup group_3077

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3077

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JTQ2 0.0 730 69 0 511 3 cobQ Cobyric acid synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7N2T7 0.0 722 69 0 508 3 cobQ Cobyric acid synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z5N6 0.0 674 66 3 508 3 cobQ Cobyric acid synthase Salmonella typhi
B5BG57 0.0 674 66 3 508 3 cobQ Cobyric acid synthase Salmonella paratyphi A (strain AKU_12601)
Q5PDU3 0.0 674 66 3 508 3 cobQ Cobyric acid synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T8X1 0.0 674 66 3 508 3 cobQ Cobyric acid synthase Salmonella heidelberg (strain SL476)
B5EWY5 0.0 672 66 3 508 3 cobQ Cobyric acid synthase Salmonella agona (strain SL483)
Q05597 0.0 672 66 3 508 3 cbiP Cobyric acid synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57MX8 0.0 671 66 3 508 3 cobQ Cobyric acid synthase Salmonella choleraesuis (strain SC-B67)
B5QYX6 0.0 671 66 3 508 3 cobQ Cobyric acid synthase Salmonella enteritidis PT4 (strain P125109)
B5FLY7 0.0 671 66 3 508 3 cobQ Cobyric acid synthase Salmonella dublin (strain CT_02021853)
A9MLS5 0.0 671 66 3 508 3 cobQ Cobyric acid synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TZP8 0.0 667 66 3 508 3 cobQ Cobyric acid synthase Salmonella schwarzengrund (strain CVM19633)
B5RBK9 0.0 665 66 4 511 3 cobQ Cobyric acid synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A6TDB1 0.0 658 65 2 508 3 cobQ Cobyric acid synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XUV5 0.0 656 64 2 508 3 cobQ Cobyric acid synthase Klebsiella pneumoniae (strain 342)
A8AEQ8 0.0 652 66 2 508 3 cobQ Cobyric acid synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B0KCS6 0.0 543 52 3 510 3 cobQ Cobyric acid synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K2J6 0.0 541 52 3 510 3 cobQ Cobyric acid synthase Thermoanaerobacter sp. (strain X514)
A0AHV1 0.0 540 53 2 509 3 cobQ Cobyric acid synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92CK0 0.0 538 53 2 509 3 cobQ Cobyric acid synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q720M1 0.0 537 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4b (strain F2365)
Q8Y7R3 0.0 536 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8D9Y4 0.0 536 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4a (strain HCC23)
A3CL74 0.0 533 53 3 512 3 cobQ Cobyric acid synthase Streptococcus sanguinis (strain SK36)
C1L2B3 0.0 532 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
B2G9H7 0.0 530 53 2 503 3 cobQ Cobyric acid synthase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM70 0.0 530 53 2 503 3 cobQ Cobyric acid synthase Limosilactobacillus reuteri (strain DSM 20016)
A6TU70 0.0 521 50 2 500 3 cobQ Cobyric acid synthase Alkaliphilus metalliredigens (strain QYMF)
Q180T4 6.04e-180 518 51 2 506 3 cobQ Cobyric acid synthase Clostridioides difficile (strain 630)
Q8RCP3 3.54e-178 513 49 3 511 3 cobQ Cobyric acid synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0Q0K2 7.47e-172 497 49 5 503 3 cobQ Cobyric acid synthase Clostridium novyi (strain NT)
C3L2K4 1.6e-170 493 49 6 503 3 cobQ Cobyric acid synthase Clostridium botulinum (strain 657 / Type Ba4)
B1KY08 2.25e-170 493 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Loch Maree / Type A3)
A5I0A5 2.53e-170 493 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FSG1 2.53e-170 493 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain ATCC 19397 / Type A)
B1IHC4 4.66e-170 492 50 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Okra / Type B1)
C1FVB2 5.64e-169 489 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Kyoto / Type A2)
Q97JB2 6.84e-169 489 48 5 507 3 cobQ Cobyric acid synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7GBV6 7.33e-169 489 49 6 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q897L4 2.82e-168 487 48 5 502 3 cobQ Cobyric acid synthase Clostridium tetani (strain Massachusetts / E88)
A8MET3 5.45e-165 479 48 7 510 3 cobQ Cobyric acid synthase Alkaliphilus oremlandii (strain OhILAs)
A5N643 8.5e-165 479 47 4 506 3 cobQ Cobyric acid synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZL9 8.5e-165 479 47 4 506 3 cobQ Cobyric acid synthase Clostridium kluyveri (strain NBRC 12016)
B8I0R5 6.75e-164 477 49 7 512 3 cobQ Cobyric acid synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A9KMP5 8.44e-162 472 48 6 514 3 cobQ Cobyric acid synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4ZBD8 2.56e-158 462 49 8 511 3 cobQ Cobyric acid synthase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A5D3N4 5.96e-155 454 49 7 514 3 cobQ Cobyric acid synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q2RJH7 1.81e-152 448 47 8 513 3 cobQ Cobyric acid synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B2UXD4 2.18e-152 447 45 5 503 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Alaska E43 / Type E3)
Q24Q41 4.12e-152 447 48 11 513 3 cobQ Cobyric acid synthase Desulfitobacterium hafniense (strain Y51)
B8G242 4.12e-152 447 48 11 513 3 cobQ Cobyric acid synthase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q3ZXQ8 6e-152 446 47 9 507 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain CBDB1)
A5FQW8 6.91e-152 446 47 9 507 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3Z7Y8 1.06e-150 443 47 8 502 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q0STW6 4.27e-150 441 44 5 503 3 cobQ Cobyric acid synthase Clostridium perfringens (strain SM101 / Type A)
Q8XLJ6 1.73e-149 439 44 5 503 3 cobQ Cobyric acid synthase Clostridium perfringens (strain 13 / Type A)
Q0TRJ4 1.73e-149 439 44 5 503 3 cobQ Cobyric acid synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B2TPE7 2.39e-149 439 44 5 503 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Eklund 17B / Type B)
A0LJ24 9.51e-148 436 45 7 506 3 cobQ Cobyric acid synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A6LSX2 1.36e-145 430 45 8 510 3 cobQ Cobyric acid synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4J806 1.29e-142 422 47 9 507 3 cobQ Cobyric acid synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C5DAP4 1.39e-139 414 44 10 512 3 cobQ Cobyric acid synthase Geobacillus sp. (strain WCH70)
Q72DW3 4.6e-139 415 46 15 537 3 cobQ Cobyric acid synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VFG1 6.53e-139 414 45 13 537 3 cobQ Cobyric acid synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q3IG44 1.23e-138 412 44 7 508 3 cobQ Cobyric acid synthase Pseudoalteromonas translucida (strain TAC 125)
Q87HN1 9.99e-138 409 46 9 500 3 cobQ Cobyric acid synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O26880 1.48e-137 409 46 11 507 3 cobQ Probable cobyric acid synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8Q0P3 1.72e-137 409 47 11 505 3 cobQ Probable cobyric acid synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A9GM36 2.7e-135 404 45 9 522 3 cobQ Cobyric acid synthase Sorangium cellulosum (strain So ce56)
A4INZ4 1.14e-134 402 43 9 513 3 cobQ Cobyric acid synthase Geobacillus thermodenitrificans (strain NG80-2)
A7N8K5 1.48e-134 400 45 8 498 3 cobQ Cobyric acid synthase Vibrio campbellii (strain ATCC BAA-1116)
B7GLS9 1.98e-134 401 43 8 508 3 cobQ Cobyric acid synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q466W7 2.8e-134 400 46 7 489 3 cobQ Probable cobyric acid synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q63WA1 1.59e-133 399 48 13 502 3 cobQ Cobyric acid synthase Burkholderia pseudomallei (strain K96243)
Q5KZ06 1.68e-133 399 44 8 505 3 cobQ Cobyric acid synthase Geobacillus kaustophilus (strain HTA426)
Q62LF1 1.89e-133 398 48 13 502 3 cobQ Cobyric acid synthase Burkholderia mallei (strain ATCC 23344)
A6L4Y5 6.67e-133 397 44 9 506 3 cobQ Cobyric acid synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B5YL83 3.29e-132 395 44 10 504 3 cobQ Cobyric acid synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A6W1K0 1.11e-131 394 43 7 505 3 cobQ Cobyric acid synthase Marinomonas sp. (strain MWYL1)
Q7NXQ0 1.13e-131 394 44 9 506 3 cobQ Cobyric acid synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0S258 2.11e-131 394 41 9 514 3 cobQ Cobyric acid synthase Rhodococcus jostii (strain RHA1)
B2T167 3.01e-131 393 46 9 499 3 cobQ Cobyric acid synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q88M97 3.01e-131 392 44 7 505 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1TXB6 4.79e-131 392 43 7 506 3 cobQ Cobyric acid synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5YSA4 5.25e-131 393 41 11 520 3 cobQ Cobyric acid synthase Nocardia farcinica (strain IFM 10152)
C1B2W9 5.41e-131 393 41 9 514 3 cobQ Cobyric acid synthase Rhodococcus opacus (strain B4)
Q0VLY5 1.69e-130 390 44 8 503 3 cobQ Cobyric acid synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8TKZ3 1.76e-130 390 46 11 502 3 cobQ Probable cobyric acid synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B1J1N6 2.78e-130 390 43 7 505 3 cobQ Cobyric acid synthase Pseudomonas putida (strain W619)
Q1GXH3 4.24e-130 390 44 10 503 3 cobQ Cobyric acid synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8U3Z8 5.04e-130 389 42 8 504 3 cobQ Probable cobyric acid synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8XWT0 7.37e-130 389 46 6 494 3 cobQ Cobyric acid synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5EZT5 1.66e-129 388 45 10 505 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7NJR0 3.38e-129 387 44 10 505 3 cobQ Cobyric acid synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q12TL2 3.48e-129 388 46 9 508 3 cobQ Probable cobyric acid synthase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
B0KT65 4.3e-129 387 43 8 503 3 cobQ Cobyric acid synthase Pseudomonas putida (strain GB-1)
Q8EXQ7 8.18e-129 398 45 10 506 3 cobDQ Adenosylcobalamin biosynthesis bifunctional protein CobDQ Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q9KLL6 1.34e-128 386 45 10 505 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A4FM88 2.86e-128 386 42 6 507 3 cobQ Cobyric acid synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A5W7Q6 5.25e-128 384 43 7 505 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q474Y6 6.36e-128 384 44 6 502 3 cobQ Cobyric acid synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B6YV97 9.43e-128 384 45 7 469 3 cobQ Probable cobyric acid synthase Thermococcus onnurineus (strain NA1)
Q64TD9 1.09e-127 384 45 11 508 3 cobQ Cobyric acid synthase Bacteroides fragilis (strain YCH46)
Q5LCE1 1.09e-127 384 45 11 508 3 cobQ Cobyric acid synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q2SNC4 1.26e-127 384 44 10 509 3 cobQ Cobyric acid synthase Hahella chejuensis (strain KCTC 2396)
B2JER3 2.94e-127 382 45 8 498 3 cobQ Cobyric acid synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0BCS3 3.16e-127 382 47 11 497 3 cobQ Cobyric acid synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A6V8T2 5.13e-127 382 44 7 502 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain PA7)
A4XT53 8.14e-127 381 45 8 499 3 cobQ Cobyric acid synthase Pseudomonas mendocina (strain ymp)
Q8YUG9 2.6e-126 380 43 8 499 3 cobQ Cobyric acid synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8PHR1 3e-126 380 44 6 502 3 cobQ Cobyric acid synthase Xanthomonas axonopodis pv. citri (strain 306)
C1DPP2 4.03e-126 379 44 7 497 3 cobQ Cobyric acid synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B7UWH3 5.38e-126 379 43 7 502 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain LESB58)
Q9I467 6.19e-126 379 43 7 502 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6LIL7 6.52e-126 379 44 9 501 3 cobQ Cobyric acid synthase Photobacterium profundum (strain SS9)
A1KBC7 7.84e-126 379 44 8 497 3 cobQ Cobyric acid synthase Azoarcus sp. (strain BH72)
A4G3R6 8.78e-126 379 46 12 505 3 cobQ Cobyric acid synthase Herminiimonas arsenicoxydans
Q4K8B9 9.6e-126 379 44 7 502 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O33475 1.01e-125 379 45 7 469 3 cobQ Probable cobyric acid synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q47JS8 1.77e-125 378 42 9 508 3 cobQ Cobyric acid synthase Dechloromonas aromatica (strain RCB)
B2J764 1.8e-125 378 43 7 497 3 cobQ Cobyric acid synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q3AE11 2.13e-125 378 44 7 508 3 cobQ Cobyric acid synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2JRG5 2.57e-125 378 41 9 508 3 cobQ Cobyric acid synthase Synechococcus sp. (strain JA-3-3Ab)
Q3MGR4 3.04e-125 377 43 8 499 3 cobQ Cobyric acid synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B0RPU7 4.11e-125 377 44 8 501 3 cobQ Cobyric acid synthase Xanthomonas campestris pv. campestris (strain B100)
Q5E0T7 4.14e-125 377 45 11 456 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8DI74 4.52e-125 377 44 9 509 3 cobQ Cobyric acid synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5P3B0 9.17e-125 376 44 8 499 3 cobQ Cobyric acid synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q02JB8 9.36e-125 376 43 7 502 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9RJ20 9.86e-125 377 42 7 512 3 cobQ Cobyric acid synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1IDJ9 1.2e-124 376 42 7 505 3 cobQ Cobyric acid synthase Pseudomonas entomophila (strain L48)
B8GDE3 1.3e-124 376 44 8 510 3 cobQ Probable cobyric acid synthase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B6ES52 1.3e-124 376 47 11 453 3 cobQ Cobyric acid synthase Aliivibrio salmonicida (strain LFI1238)
B1I5R2 2.01e-124 375 42 6 497 3 cobQ Cobyric acid synthase Desulforudis audaxviator (strain MP104C)
Q2J9S7 2.03e-124 376 42 8 530 3 cobQ Cobyric acid synthase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q3BQB5 2.06e-124 375 47 5 446 3 cobQ Cobyric acid synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q605I0 2.49e-124 375 44 7 503 3 cobQ Cobyric acid synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A4JGX5 2.57e-124 375 46 8 498 3 cobQ Cobyric acid synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A4VJ40 2.78e-124 375 45 8 502 3 cobQ Cobyric acid synthase Stutzerimonas stutzeri (strain A1501)
B1WYU3 4.48e-124 375 42 9 499 3 cobQ Cobyric acid synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7KHS7 4.57e-124 375 43 7 500 3 cobQ Cobyric acid synthase Gloeothece citriformis (strain PCC 7424)
A6LBQ5 5.98e-124 374 43 10 503 3 cobQ Cobyric acid synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q7ME60 3.82e-123 372 44 8 505 3 cobQ Cobyric acid synthase Vibrio vulnificus (strain YJ016)
Q8D737 4.16e-123 372 44 9 506 3 cobQ Cobyric acid synthase Vibrio vulnificus (strain CMCP6)
Q829J5 5.63e-123 372 43 8 513 3 cobQ Cobyric acid synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8EI15 5.94e-123 372 43 13 516 3 cobQ Cobyric acid synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B5ET63 1.18e-122 371 42 13 505 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain MJ11)
Q2JJP4 4.04e-122 370 42 11 508 3 cobQ Cobyric acid synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q55860 4.27e-122 370 42 7 502 3 cobQ Cobyric acid synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q31RS6 6.22e-122 369 40 5 499 3 cobQ Cobyric acid synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6SWZ4 6.53e-122 369 46 5 455 3 cobQ Cobyric acid synthase Janthinobacterium sp. (strain Marseille)
A6X034 1.11e-121 368 42 10 508 3 cobQ Cobyric acid synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5N2H9 1.76e-121 368 40 5 499 3 cobQ Cobyric acid synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B4S8A8 3.5e-121 367 41 11 510 3 cobQ Cobyric acid synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
C5A475 4.45e-121 367 42 8 500 3 cobQ Probable cobyric acid synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q2NEZ9 5.1e-121 367 41 11 507 3 cobQ Probable cobyric acid synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B9JGD3 1.21e-120 365 42 9 500 3 cobQ Cobyric acid synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B0JHX2 1.88e-120 365 43 7 499 3 cobQ Cobyric acid synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8G005 1.89e-120 365 42 7 507 3 cobQ Cobyric acid synthase Brucella suis biovar 1 (strain 1330)
Q10XP0 2.75e-120 365 41 8 501 3 cobQ Cobyric acid synthase Trichodesmium erythraeum (strain IMS101)
A9M5X3 3.47e-120 364 42 7 507 3 cobQ Cobyric acid synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57CI7 4.4e-120 364 42 7 507 3 cobQ Cobyric acid synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQK2 4.4e-120 364 42 7 507 3 cobQ Cobyric acid synthase Brucella abortus (strain 2308)
B2S6E8 4.4e-120 364 42 7 507 3 cobQ Cobyric acid synthase Brucella abortus (strain S19)
B0CHA6 6.43e-120 363 42 7 507 3 cobQ Cobyric acid synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
B9LKN1 8.63e-120 363 42 10 506 3 cobQ Cobyric acid synthase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WIN9 8.63e-120 363 42 10 506 3 cobQ Cobyric acid synthase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q21P75 9.88e-120 363 41 9 506 3 cobQ Cobyric acid synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B0CCR3 1.37e-119 363 42 6 498 3 cobQ Cobyric acid synthase Acaryochloris marina (strain MBIC 11017)
A3CX25 2.53e-119 362 42 8 501 3 cobQ Probable cobyric acid synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A1B8D6 2.85e-119 362 44 7 506 3 cobQ Cobyric acid synthase Paracoccus denitrificans (strain Pd 1222)
Q0W1N4 4.06e-119 362 43 9 507 3 cobQ Probable cobyric acid synthase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q8YHV6 4.22e-119 362 41 7 507 3 cobQ Cobyric acid synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJS3 4.22e-119 362 41 7 507 3 cobQ Cobyric acid synthase Brucella melitensis biotype 2 (strain ATCC 23457)
D5AV13 5.91e-119 361 42 7 506 3 cobQ Cobyric acid synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
A0PU57 1.4e-118 360 40 8 507 3 cobQ Cobyric acid synthase Mycobacterium ulcerans (strain Agy99)
P29932 2.04e-118 360 44 9 466 1 cobQ Cobyric acid synthase Sinorhizobium sp.
A1BFI0 2.82e-118 360 41 6 509 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q2FTC7 2.94e-118 359 42 8 500 3 cobQ Probable cobyric acid synthase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q885W8 3.38e-118 359 43 9 505 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0CY57 4.9e-118 358 42 7 506 3 cobQ Cobyric acid synthase Rhodobacter capsulatus
Q9KCI0 6.31e-118 359 40 9 507 3 cobQ Cobyric acid synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1MFE8 8.72e-118 358 41 7 500 3 cobQ Cobyric acid synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C3MDR9 9.67e-118 358 45 10 468 3 cobQ Cobyric acid synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B2HNJ6 1.35e-117 358 39 7 507 3 cobQ Cobyric acid synthase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q4ZQ64 1.62e-117 357 42 8 505 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. syringae (strain B728a)
Q92P31 4.99e-117 356 44 10 471 3 cobQ Cobyric acid synthase Rhizobium meliloti (strain 1021)
B4SH62 7.38e-117 356 41 5 510 3 cobQ Cobyric acid synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q73VS8 7.87e-117 356 42 7 478 3 cobQ Cobyric acid synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B7JVZ0 2.73e-116 355 39 7 505 3 cobQ Cobyric acid synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q48FJ7 3.12e-116 354 42 8 505 3 cobQ Cobyric acid synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A7I9K5 3.63e-116 354 44 12 505 3 cobQ Probable cobyric acid synthase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A6UAC0 8.28e-116 353 44 11 472 3 cobQ Cobyric acid synthase Sinorhizobium medicae (strain WSM419)
Q6NGL6 9.19e-116 353 37 8 506 3 cobQ Cobyric acid synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A9AZZ2 1.47e-115 352 42 11 470 3 cobQ Cobyric acid synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q98L33 3.3e-115 352 40 11 518 3 cobQ Cobyric acid synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3IZR0 3.94e-115 351 41 10 509 3 cobQ Cobyric acid synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6AAP6 4.14e-115 351 41 10 510 3 cobQ Cobyric acid synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A7NH10 5.42e-115 351 42 9 496 3 cobQ Cobyric acid synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B3EJS3 5.67e-115 351 42 6 506 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain BS1)
B3PQX7 6.44e-115 351 43 7 465 3 cobQ Cobyric acid synthase Rhizobium etli (strain CIAT 652)
Q0C077 7.27e-115 351 40 8 507 3 cobQ Cobyric acid synthase Hyphomonas neptunium (strain ATCC 15444)
Q3ARV1 8.55e-115 351 41 5 507 3 cobQ Cobyric acid synthase Chlorobium chlorochromatii (strain CaD3)
A5VFK5 8.89e-115 350 40 7 504 3 cobQ Cobyric acid synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B5ZT17 1.96e-114 350 41 7 500 3 cobQ Cobyric acid synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q89Q71 3.84e-114 348 41 8 509 3 cobQ Cobyric acid synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1Z9X0 1.31e-113 347 42 9 510 3 cobQ Cobyric acid synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q28N58 1.6e-113 347 41 8 504 3 cobQ Cobyric acid synthase Jannaschia sp. (strain CCS1)
Q2K7B5 1.95e-113 347 40 8 500 3 cobQ Cobyric acid synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3KFR7 2.07e-113 347 43 11 505 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain Pf0-1)
P9WP95 2.35e-113 347 40 9 510 1 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP94 2.35e-113 347 40 9 510 3 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TYY1 2.35e-113 347 40 9 510 3 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AJT1 2.35e-113 347 40 9 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KF76 2.35e-113 347 40 9 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A533 2.35e-113 347 40 9 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8KDV6 3.78e-113 347 40 8 516 3 cobQ Cobyric acid synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q1BAC5 1.39e-112 345 40 7 502 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain MCS)
A1UEN7 1.39e-112 345 40 7 502 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain KMS)
A3PY44 1.39e-112 345 40 7 502 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain JLS)
A4WPH6 1.51e-112 345 42 10 509 3 cobQ Cobyric acid synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A1S3L6 7.97e-112 343 40 9 512 3 cobQ Cobyric acid synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0SXF9 1.32e-111 342 42 8 509 3 cobQ Cobyric acid synthase Caulobacter sp. (strain K31)
A4T0R6 2.15e-111 342 38 9 508 3 cobQ Cobyric acid synthase Mycolicibacterium gilvum (strain PYR-GCK)
A1T225 5.21e-111 341 40 12 507 3 cobQ Cobyric acid synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
C3K0Z0 1.05e-110 340 43 11 505 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain SBW25)
B9JX68 2.85e-109 336 42 8 501 3 cobQ Cobyric acid synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q167R8 3.02e-109 336 39 7 509 3 cobQ Cobyric acid synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2GBK2 7.24e-109 335 41 8 508 3 cobQ Cobyric acid synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A1WYA9 1.96e-108 334 42 7 456 3 cobQ Cobyric acid synthase Halorhodospira halophila (strain DSM 244 / SL1)
O28931 4.24e-108 332 42 8 455 3 cobQ Probable cobyric acid synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
C5CKN7 1.17e-107 332 40 8 475 3 cobQ Cobyric acid synthase Variovorax paradoxus (strain S110)
B8EQG6 3.22e-107 331 39 7 502 3 cobQ Cobyric acid synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q9RZU9 1.56e-106 329 41 7 457 3 cobQ Cobyric acid synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1GF45 8.21e-106 327 42 11 503 3 cobQ Cobyric acid synthase Ruegeria sp. (strain TM1040)
B8G7Y8 1.13e-105 327 42 8 458 3 cobQ Cobyric acid synthase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q7U5J9 1.51e-105 327 39 9 504 3 cobQ Cobyric acid synthase Parasynechococcus marenigrum (strain WH8102)
Q7VB41 2.18e-104 324 38 10 513 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A0QVI7 2.35e-104 324 38 6 507 3 cobQ Cobyric acid synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0IBR6 4.19e-104 324 38 10 511 3 cobQ Cobyric acid synthase Synechococcus sp. (strain CC9311)
Q21V75 6.85e-104 323 41 8 450 3 cobQ Cobyric acid synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0BUF0 8.79e-104 322 40 7 503 3 cobQ Cobyric acid synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B2IE16 1.17e-103 322 38 9 512 3 cobQ Cobyric acid synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q6LXX9 7.83e-103 320 37 10 501 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8UBP3 1.37e-102 319 39 7 505 3 cobQ Cobyric acid synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q129W6 1.95e-102 319 40 8 464 3 cobQ Cobyric acid synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0UH14 6.5e-102 317 40 10 502 3 cobQ Cobyric acid synthase Methylobacterium sp. (strain 4-46)
A1VP76 8.88e-102 317 39 11 484 3 cobQ Cobyric acid synthase Polaromonas naphthalenivorans (strain CJ2)
Q1GPG1 2.05e-101 316 39 10 505 3 cobQ Cobyric acid synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A1TMF3 5.02e-101 315 41 8 462 3 cobQ Cobyric acid synthase Paracidovorax citrulli (strain AAC00-1)
Q7V6H6 5.04e-101 315 37 10 519 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9313)
Q3ALJ7 2.96e-100 313 38 12 504 3 cobQ Cobyric acid synthase Synechococcus sp. (strain CC9605)
A1WAM6 3.14e-100 313 40 9 473 3 cobQ Cobyric acid synthase Acidovorax sp. (strain JS42)
Q46JR6 3.88e-100 313 37 10 509 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain NATL2A)
A5GUP3 4.15e-100 313 37 9 504 3 cobQ Cobyric acid synthase Synechococcus sp. (strain RCC307)
Q57908 6.75e-100 312 38 9 497 3 cobQ Probable cobyric acid synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7ILW0 2.05e-99 311 41 10 468 3 cobQ Cobyric acid synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A2C7X7 2.39e-99 311 37 10 519 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9303)
B9MD32 3.13e-99 311 40 9 479 3 cobQ Cobyric acid synthase Acidovorax ebreus (strain TPSY)
A4FWW2 5.37e-99 310 37 10 503 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A2C3V9 7.05e-99 310 36 11 509 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain NATL1A)
A9AA97 7.09e-99 310 37 10 503 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A5GMB9 8.46e-99 310 37 10 515 3 cobQ Cobyric acid synthase Synechococcus sp. (strain WH7803)
B8IUQ6 2.63e-98 308 39 8 499 3 cobQ Cobyric acid synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q8FP85 5.21e-98 308 35 9 506 3 cobQ Cobyric acid synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5V0Z6 6.91e-98 307 43 13 471 3 cobQ Probable cobyric acid synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q6L0V5 1.14e-97 306 38 13 507 3 cobQ Probable cobyric acid synthase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q8TVH5 5.8e-97 305 41 13 473 3 cobQ Probable cobyric acid synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A2SI71 7.29e-97 305 39 10 486 3 cobQ Cobyric acid synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A8I5C0 3.8e-95 300 39 8 511 3 cobQ Cobyric acid synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5EGF9 3.75e-94 298 38 9 510 3 cobQ Cobyric acid synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A4YXJ9 4.96e-94 297 37 8 507 3 cobQ Cobyric acid synthase Bradyrhizobium sp. (strain ORS 278)
A6VGF5 2.72e-93 295 36 10 503 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A2BXM3 6.57e-93 295 34 9 514 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9515)
Q7V0U2 4.09e-91 290 35 10 508 3 cobQ Cobyric acid synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A6UWF6 9.99e-91 289 36 10 503 3 cobQ Probable cobyric acid synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A3PE00 2.17e-90 288 34 12 507 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9301)
B1Y856 2.39e-90 288 39 13 504 3 cobQ Cobyric acid synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A2BS60 5.26e-90 287 33 10 506 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain AS9601)
A6UPL5 3.51e-89 285 36 10 502 3 cobQ Probable cobyric acid synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A8G5V0 3.52e-89 285 34 11 514 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9215)
Q9HPL5 6.38e-89 285 37 14 522 3 cobQ Probable cobyric acid synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5X2 6.38e-89 285 37 14 522 3 cobQ Probable cobyric acid synthase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q319X7 2.86e-88 283 33 12 515 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9312)
Q43989 2.06e-87 279 34 8 500 3 cobQ Cobyric acid synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9HLZ8 1.28e-84 272 38 13 457 3 cobQ Probable cobyric acid synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P21157 6.68e-66 215 47 0 226 3 cobQ Probable cobyric acid synthase (Fragment) Methanococcus voltae
Q9KER6 6.33e-08 57 24 9 230 3 bioD ATP-dependent dethiobiotin synthetase BioD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q97JC5 1.01e-07 56 25 9 227 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B9MP52 8.36e-07 53 25 12 240 3 bioD ATP-dependent dethiobiotin synthetase BioD Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q8ZQQ5 8.93e-06 50 24 7 234 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FPS0 9.27e-06 50 26 8 241 3 bioD ATP-dependent dethiobiotin synthetase BioD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8Z890 1.57e-05 49 25 9 240 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhi
A4XGB6 2.74e-05 49 25 13 243 3 bioD ATP-dependent dethiobiotin synthetase BioD Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B7IWN2 3.85e-05 48 23 8 246 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain G9842)
B8HNL6 8.55e-05 47 25 12 237 3 bioD ATP-dependent dethiobiotin synthetase BioD Cyanothece sp. (strain PCC 7425 / ATCC 29141)
C5D7L1 9.13e-05 47 20 7 236 3 bioD ATP-dependent dethiobiotin synthetase BioD Geobacillus sp. (strain WCH70)
Q8UBQ8 9.71e-05 48 32 7 132 3 cobB Hydrogenobyrinate a,c-diamide synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81MA9 0.000246 46 24 8 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis
C3LJP5 0.000246 46 24 8 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P7Q4 0.000246 46 24 8 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain A0248)
B7GHM4 0.000356 45 23 9 226 3 bioD ATP-dependent dethiobiotin synthetase BioD Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B0JX07 0.000873 44 23 9 249 3 bioD ATP-dependent dethiobiotin synthetase BioD Microcystis aeruginosa (strain NIES-843 / IAM M-2473)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_08765
Feature type CDS
Gene cobQ
Product cobyric acid synthase
Location 177720 - 179255 (strand: 1)
Length 1536 (nucleotides) / 511 (amino acids)

Contig

Accession ZDB_685
Length 192328 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3077
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01656 CobQ/CobB/MinD/ParA nucleotide binding domain
PF07685 CobB/CobQ-like glutamine amidotransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1492 Coenzyme transport and metabolism (H) H Cobyric acid synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MTFSLMIQGTASDVGKSVLVAGFCRIFSQDGYHCAPFKSQNMALNSGITRDGKEMGRAQIFQAEAAGIEPDVRMNPVLLKPTSDRKSQVILMGKVAQNMDAAEYHLYKPQLKAMIRDVYNDLASEHDIIVLEGAGSPAEINLRDGDIVNMGMAEMIDAPVILVADIDRGGVFASIYGTLALLTDDERARVIGVIINKFRGDVALLMPGIKQIEDLTNVPVLGVLPWLDVDLEDEDGVALQVGKYDGKTEEVLDIVVVQLPHIANFTDFNALAAQPDVRLRYESDPLLVGEPDLLIIPGSKNTLGDLLWLRQKGMDKAILTRHAQGTPVAGICGGYQILGKHIYDDVESGLSDLPGLGLLDITTRFSPEKNTTQTAGTVCGALPGIWSACQGEPISGYEIHMGVSETGADAIPFAQMHEKNREPCNHADGAVSPDGSVMGSYLHGIFDRNNFTRPLLNQLRKKKGLEPLPESTFDYALHKEQQFNILAQQMREHLNIDEICRLMRVHKEKKA

Flanking regions ( +/- flanking 50bp)

CAATTGCAGCAGCAGACAACTCCCGCCGCCGGAACACACGAGGTAATGGCATGACATTTTCACTGATGATCCAGGGTACTGCTTCCGATGTCGGAAAAAGTGTATTAGTTGCCGGATTCTGCCGGATTTTTTCTCAGGATGGCTATCACTGCGCGCCGTTCAAATCACAGAATATGGCACTGAACTCGGGGATCACCCGTGACGGCAAAGAGATGGGCCGGGCGCAGATCTTTCAGGCGGAAGCTGCCGGTATAGAACCGGATGTGCGCATGAACCCGGTTCTGCTCAAACCGACCTCTGACCGCAAATCCCAGGTGATTCTGATGGGAAAAGTCGCGCAGAATATGGATGCGGCAGAGTATCACCTCTACAAACCTCAGCTGAAAGCCATGATCCGTGATGTTTACAATGACCTGGCTTCTGAGCACGACATCATTGTGCTGGAAGGTGCGGGCAGCCCGGCGGAGATCAATCTGCGCGACGGCGATATTGTGAATATGGGCATGGCGGAGATGATAGACGCACCGGTGATCCTGGTAGCAGATATCGATCGCGGTGGTGTGTTCGCCTCGATTTACGGCACACTCGCCCTGCTGACAGACGACGAACGCGCCCGGGTGATCGGCGTGATCATCAATAAATTCCGCGGTGATGTCGCCCTGCTGATGCCGGGCATTAAACAAATCGAAGACCTGACCAACGTTCCGGTGCTCGGCGTACTGCCGTGGCTGGATGTGGATCTGGAAGATGAAGACGGGGTAGCGTTACAGGTCGGCAAATATGACGGCAAAACAGAGGAAGTGCTGGATATTGTGGTGGTTCAGCTGCCGCACATTGCCAACTTCACCGATTTCAATGCCCTTGCCGCCCAGCCGGATGTCCGCCTGCGTTATGAATCCGATCCGCTGCTGGTCGGTGAGCCGGATCTGCTGATTATCCCGGGCAGTAAAAATACCCTCGGTGACCTGCTGTGGCTGCGTCAGAAAGGAATGGATAAAGCTATTCTCACCCGCCATGCACAGGGCACTCCGGTCGCCGGGATCTGCGGCGGCTATCAGATCCTCGGTAAACATATTTATGATGATGTTGAATCCGGATTATCCGATCTGCCGGGACTGGGGCTGCTCGATATCACCACCCGCTTTTCACCGGAAAAAAATACCACCCAAACCGCCGGAACCGTGTGCGGCGCACTGCCGGGGATCTGGTCTGCCTGTCAGGGTGAACCGATCAGCGGCTATGAGATCCACATGGGCGTATCCGAAACCGGCGCGGATGCCATCCCGTTTGCACAAATGCATGAGAAAAACCGCGAGCCGTGCAACCATGCTGACGGTGCGGTCAGCCCGGACGGCAGTGTGATGGGCTCTTATCTGCACGGAATTTTTGACCGCAACAATTTCACCCGTCCGCTGCTCAATCAGCTGCGGAAAAAGAAAGGGCTGGAGCCCCTGCCGGAGAGCACGTTTGACTATGCGCTGCATAAAGAACAGCAGTTTAATATTCTGGCGCAGCAGATGCGGGAACACCTCAATATTGATGAAATCTGCCGTCTGATGCGTGTACACAAGGAGAAAAAAGCATGATTTTAATTACCGGCGGCGCCCGCAGCGGTAAAAGCAGTTTTGCTGAAGAA