Homologs in group_3077

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18835 FBDBKF_18835 90.0 Morganella morganii S1 cobQ cobyric acid synthase
EHELCC_17030 EHELCC_17030 90.0 Morganella morganii S2 cobQ cobyric acid synthase
NLDBIP_18410 NLDBIP_18410 90.0 Morganella morganii S4 cobQ cobyric acid synthase
LHKJJB_09215 LHKJJB_09215 90.0 Morganella morganii S3 cobQ cobyric acid synthase
HKOGLL_08765 HKOGLL_08765 90.0 Morganella morganii S5 cobQ cobyric acid synthase

Distribution of the homologs in the orthogroup group_3077

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3077

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N2T7 0.0 731 69 0 510 3 cobQ Cobyric acid synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JTQ2 0.0 730 69 0 511 3 cobQ Cobyric acid synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Z5N6 0.0 682 67 3 508 3 cobQ Cobyric acid synthase Salmonella typhi
B5BG57 0.0 682 67 3 508 3 cobQ Cobyric acid synthase Salmonella paratyphi A (strain AKU_12601)
Q5PDU3 0.0 682 67 3 508 3 cobQ Cobyric acid synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T8X1 0.0 682 67 3 508 3 cobQ Cobyric acid synthase Salmonella heidelberg (strain SL476)
B5EWY5 0.0 679 67 3 508 3 cobQ Cobyric acid synthase Salmonella agona (strain SL483)
Q05597 0.0 679 67 3 508 3 cbiP Cobyric acid synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5QYX6 0.0 678 67 3 508 3 cobQ Cobyric acid synthase Salmonella enteritidis PT4 (strain P125109)
B5FLY7 0.0 678 67 3 508 3 cobQ Cobyric acid synthase Salmonella dublin (strain CT_02021853)
Q57MX8 0.0 678 67 3 508 3 cobQ Cobyric acid synthase Salmonella choleraesuis (strain SC-B67)
B4TZP8 0.0 677 67 3 508 3 cobQ Cobyric acid synthase Salmonella schwarzengrund (strain CVM19633)
A9MLS5 0.0 676 67 3 508 3 cobQ Cobyric acid synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5RBK9 0.0 670 66 4 508 3 cobQ Cobyric acid synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A6TDB1 0.0 658 65 2 508 3 cobQ Cobyric acid synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XUV5 0.0 658 65 2 508 3 cobQ Cobyric acid synthase Klebsiella pneumoniae (strain 342)
A8AEQ8 0.0 654 67 3 508 3 cobQ Cobyric acid synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B0K2J6 0.0 545 53 3 510 3 cobQ Cobyric acid synthase Thermoanaerobacter sp. (strain X514)
A0AHV1 0.0 543 54 3 509 3 cobQ Cobyric acid synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B0KCS6 0.0 542 52 3 510 3 cobQ Cobyric acid synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q92CK0 0.0 539 53 2 509 3 cobQ Cobyric acid synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A3CL74 0.0 535 53 2 510 3 cobQ Cobyric acid synthase Streptococcus sanguinis (strain SK36)
Q720M1 0.0 534 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4b (strain F2365)
Q8Y7R3 0.0 533 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8D9Y4 0.0 533 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4a (strain HCC23)
C1L2B3 0.0 532 53 2 509 3 cobQ Cobyric acid synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
B2G9H7 0.0 522 52 3 507 3 cobQ Cobyric acid synthase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM70 0.0 522 52 3 507 3 cobQ Cobyric acid synthase Limosilactobacillus reuteri (strain DSM 20016)
Q8RCP3 3.95e-178 513 49 3 511 3 cobQ Cobyric acid synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q180T4 1.09e-177 512 50 2 506 3 cobQ Cobyric acid synthase Clostridioides difficile (strain 630)
A6TU70 2.81e-173 500 48 2 503 3 cobQ Cobyric acid synthase Alkaliphilus metalliredigens (strain QYMF)
B1IHC4 9.47e-173 499 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Okra / Type B1)
B1KY08 2.19e-172 498 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Loch Maree / Type A3)
A5I0A5 3.17e-172 498 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FSG1 3.17e-172 498 49 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain ATCC 19397 / Type A)
C3L2K4 5.18e-172 497 49 6 503 3 cobQ Cobyric acid synthase Clostridium botulinum (strain 657 / Type Ba4)
A7GBV6 3.23e-171 495 48 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A0Q0K2 5.54e-171 494 47 5 509 3 cobQ Cobyric acid synthase Clostridium novyi (strain NT)
C1FVB2 2.88e-170 493 48 5 502 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Kyoto / Type A2)
Q97JB2 1e-168 488 48 5 507 3 cobQ Cobyric acid synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q897L4 1.12e-166 483 47 5 502 3 cobQ Cobyric acid synthase Clostridium tetani (strain Massachusetts / E88)
A8MET3 9.3e-165 479 48 7 510 3 cobQ Cobyric acid synthase Alkaliphilus oremlandii (strain OhILAs)
A9KMP5 1.53e-162 473 48 6 515 3 cobQ Cobyric acid synthase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B8I0R5 2.67e-162 473 49 7 512 3 cobQ Cobyric acid synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A5N643 5.89e-162 471 45 4 506 3 cobQ Cobyric acid synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZL9 5.89e-162 471 45 4 506 3 cobQ Cobyric acid synthase Clostridium kluyveri (strain NBRC 12016)
C4ZBD8 9.9e-157 458 48 7 510 3 cobQ Cobyric acid synthase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q2RJH7 1.28e-152 448 48 8 509 3 cobQ Cobyric acid synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A5FQW8 5.87e-152 446 47 9 507 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3ZXQ8 6.14e-152 446 47 9 507 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain CBDB1)
B2UXD4 2.09e-151 445 45 5 503 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Alaska E43 / Type E3)
Q3Z7Y8 3.17e-150 442 47 7 506 3 cobQ Cobyric acid synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q0STW6 6.25e-149 438 44 7 503 3 cobQ Cobyric acid synthase Clostridium perfringens (strain SM101 / Type A)
Q8XLJ6 1.1e-148 437 44 7 504 3 cobQ Cobyric acid synthase Clostridium perfringens (strain 13 / Type A)
Q0TRJ4 1.1e-148 437 44 7 504 3 cobQ Cobyric acid synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B2TPE7 8.42e-148 436 44 6 506 3 cobQ Cobyric acid synthase Clostridium botulinum (strain Eklund 17B / Type B)
Q24Q41 8.44e-148 436 47 11 513 3 cobQ Cobyric acid synthase Desulfitobacterium hafniense (strain Y51)
B8G242 8.44e-148 436 47 11 513 3 cobQ Cobyric acid synthase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A5D3N4 1.99e-147 436 48 7 511 3 cobQ Cobyric acid synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A4J806 4.07e-146 432 47 6 504 3 cobQ Cobyric acid synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A6LSX2 2.11e-143 424 44 6 503 3 cobQ Cobyric acid synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A0LJ24 5.19e-143 424 45 8 507 3 cobQ Cobyric acid synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q72DW3 4.41e-141 420 46 11 538 3 cobQ Cobyric acid synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C5DAP4 2.01e-140 417 44 8 511 3 cobQ Cobyric acid synthase Geobacillus sp. (strain WCH70)
A1VFG1 3.11e-140 417 45 11 538 3 cobQ Cobyric acid synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q3IG44 2.36e-139 414 44 8 511 3 cobQ Cobyric acid synthase Pseudoalteromonas translucida (strain TAC 125)
O26880 3.3e-136 406 45 9 507 3 cobQ Probable cobyric acid synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A4INZ4 6.68e-136 405 44 8 513 3 cobQ Cobyric acid synthase Geobacillus thermodenitrificans (strain NG80-2)
C1B2W9 4.38e-135 403 43 9 516 3 cobQ Cobyric acid synthase Rhodococcus opacus (strain B4)
Q87HN1 5e-135 402 45 8 496 3 cobQ Cobyric acid synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7GLS9 7.48e-135 402 44 7 507 3 cobQ Cobyric acid synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q88M97 1.38e-134 401 45 10 502 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A9GM36 1.48e-134 402 44 8 521 3 cobQ Cobyric acid synthase Sorangium cellulosum (strain So ce56)
Q7NXQ0 1.91e-134 401 46 12 506 3 cobQ Cobyric acid synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A7N8K5 7.45e-134 399 45 8 494 3 cobQ Cobyric acid synthase Vibrio campbellii (strain ATCC BAA-1116)
B1J1N6 1.55e-133 399 44 9 502 3 cobQ Cobyric acid synthase Pseudomonas putida (strain W619)
Q8Q0P3 1.59e-133 399 47 11 502 3 cobQ Probable cobyric acid synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q0S258 3.16e-133 399 43 9 516 3 cobQ Cobyric acid synthase Rhodococcus jostii (strain RHA1)
Q1GXH3 5.4e-133 397 45 10 497 3 cobQ Cobyric acid synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B2T167 6.93e-133 397 47 11 499 3 cobQ Cobyric acid synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q5KZ06 1.23e-132 397 44 9 505 3 cobQ Cobyric acid synthase Geobacillus kaustophilus (strain HTA426)
A6L4Y5 1.61e-132 396 45 10 504 3 cobQ Cobyric acid synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5W7Q6 7.61e-132 394 45 10 502 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KT65 9.34e-132 394 45 9 502 3 cobQ Cobyric acid synthase Pseudomonas putida (strain GB-1)
Q466W7 1.39e-131 394 45 10 503 3 cobQ Probable cobyric acid synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q63WA1 1.55e-131 393 48 11 499 3 cobQ Cobyric acid synthase Burkholderia pseudomallei (strain K96243)
Q64TD9 2e-131 394 46 10 508 3 cobQ Cobyric acid synthase Bacteroides fragilis (strain YCH46)
Q5LCE1 2e-131 394 46 10 508 3 cobQ Cobyric acid synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9KLL6 2.22e-131 393 45 10 505 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q62LF1 4.21e-131 392 48 11 499 3 cobQ Cobyric acid synthase Burkholderia mallei (strain ATCC 23344)
B5YL83 7.37e-131 392 43 10 508 3 cobQ Cobyric acid synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5EZT5 8.25e-131 391 44 10 505 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6V8T2 9.37e-131 392 45 8 504 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain PA7)
Q4K8B9 1.78e-130 390 45 9 502 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0VLY5 2.69e-130 390 44 10 505 3 cobQ Cobyric acid synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A6W1K0 7.2e-130 390 44 9 502 3 cobQ Cobyric acid synthase Marinomonas sp. (strain MWYL1)
Q9I467 8.63e-130 389 44 8 504 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UWH3 9.83e-130 389 44 8 504 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain LESB58)
B6ES52 2.48e-129 388 45 10 501 3 cobQ Cobyric acid synthase Aliivibrio salmonicida (strain LFI1238)
A1TXB6 3.53e-129 387 43 7 505 3 cobQ Cobyric acid synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q02JB8 1.1e-128 386 44 8 504 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8XWT0 1.34e-128 385 46 9 496 3 cobQ Cobyric acid synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8TKZ3 1.58e-128 385 45 11 502 3 cobQ Probable cobyric acid synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q47JS8 1.77e-128 385 44 11 511 3 cobQ Cobyric acid synthase Dechloromonas aromatica (strain RCB)
Q7NJR0 2.88e-128 385 44 9 504 3 cobQ Cobyric acid synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q12TL2 4.67e-128 385 46 9 509 3 cobQ Probable cobyric acid synthase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A6LBQ5 7.05e-128 384 45 10 501 3 cobQ Cobyric acid synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A4FM88 7.57e-128 385 43 6 507 3 cobQ Cobyric acid synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A4XT53 1.29e-127 383 45 9 503 3 cobQ Cobyric acid synthase Pseudomonas mendocina (strain ymp)
Q5P3B0 1.78e-127 383 45 9 504 3 cobQ Cobyric acid synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0BCS3 6.89e-127 382 46 9 496 3 cobQ Cobyric acid synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B6YV97 8.31e-127 381 44 10 500 3 cobQ Probable cobyric acid synthase Thermococcus onnurineus (strain NA1)
Q7ME60 8.7e-127 381 44 8 506 3 cobQ Cobyric acid synthase Vibrio vulnificus (strain YJ016)
Q1IDJ9 1.6e-126 380 43 9 504 3 cobQ Cobyric acid synthase Pseudomonas entomophila (strain L48)
Q8YUG9 1.96e-126 380 43 8 499 3 cobQ Cobyric acid synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MGR4 2.72e-126 380 43 8 499 3 cobQ Cobyric acid synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A1KBC7 3.16e-126 380 44 9 501 3 cobQ Cobyric acid synthase Azoarcus sp. (strain BH72)
Q2SNC4 3.36e-126 380 43 9 507 3 cobQ Cobyric acid synthase Hahella chejuensis (strain KCTC 2396)
Q8D737 3.78e-126 379 44 7 501 3 cobQ Cobyric acid synthase Vibrio vulnificus (strain CMCP6)
Q6LIL7 4.28e-126 380 45 10 501 3 cobQ Cobyric acid synthase Photobacterium profundum (strain SS9)
Q5E0T7 5.41e-126 379 43 13 505 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8EXQ7 5.65e-126 391 44 10 507 3 cobDQ Adenosylcobalamin biosynthesis bifunctional protein CobDQ Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q5YSA4 5.72e-126 380 41 11 523 3 cobQ Cobyric acid synthase Nocardia farcinica (strain IFM 10152)
B2JER3 6.29e-126 379 45 9 495 3 cobQ Cobyric acid synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B1I5R2 1.14e-125 379 43 5 496 3 cobQ Cobyric acid synthase Desulforudis audaxviator (strain MP104C)
Q474Y6 1.43e-125 378 43 6 504 3 cobQ Cobyric acid synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8U3Z8 1.53e-125 378 42 10 504 3 cobQ Probable cobyric acid synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C1DPP2 1.82e-125 378 44 8 503 3 cobQ Cobyric acid synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4G3R6 1.91e-125 378 47 7 467 3 cobQ Cobyric acid synthase Herminiimonas arsenicoxydans
B8GDE3 2.09e-125 378 44 6 509 3 cobQ Probable cobyric acid synthase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q8PHR1 3.27e-125 377 44 8 502 3 cobQ Cobyric acid synthase Xanthomonas axonopodis pv. citri (strain 306)
B5ET63 5.54e-125 377 43 13 505 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain MJ11)
Q8EI15 1.01e-124 377 43 12 522 3 cobQ Cobyric acid synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B1WYU3 1.26e-124 376 41 7 505 3 cobQ Cobyric acid synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2NEZ9 1.39e-124 376 43 12 507 3 cobQ Probable cobyric acid synthase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A4JGX5 1.48e-124 375 46 9 498 3 cobQ Cobyric acid synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q21P75 2.19e-124 375 43 13 505 3 cobQ Cobyric acid synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B0RPU7 3.07e-124 375 45 10 501 3 cobQ Cobyric acid synthase Xanthomonas campestris pv. campestris (strain B100)
B2J764 3.2e-124 375 42 8 505 3 cobQ Cobyric acid synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q10XP0 7.82e-124 374 41 7 501 3 cobQ Cobyric acid synthase Trichodesmium erythraeum (strain IMS101)
Q3AE11 9.61e-124 374 43 8 511 3 cobQ Cobyric acid synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q31RS6 2.06e-123 373 41 5 499 3 cobQ Cobyric acid synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2JRG5 2.12e-123 373 42 9 507 3 cobQ Cobyric acid synthase Synechococcus sp. (strain JA-3-3Ab)
Q605I0 3.3e-123 373 45 11 506 3 cobQ Cobyric acid synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2J9S7 3.59e-123 373 41 8 530 3 cobQ Cobyric acid synthase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q5N2H9 4.35e-123 372 41 5 499 3 cobQ Cobyric acid synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A4VJ40 6e-123 371 45 9 502 3 cobQ Cobyric acid synthase Stutzerimonas stutzeri (strain A1501)
Q9RJ20 2.22e-122 370 42 7 516 3 cobQ Cobyric acid synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B0JHX2 2.33e-122 370 44 6 499 3 cobQ Cobyric acid synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B9JGD3 8.13e-122 369 42 9 507 3 cobQ Cobyric acid synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q3BQB5 9.42e-122 368 46 6 446 3 cobQ Cobyric acid synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q55860 1.05e-121 369 43 8 509 3 cobQ Cobyric acid synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7KHS7 1.59e-121 368 42 7 503 3 cobQ Cobyric acid synthase Gloeothece citriformis (strain PCC 7424)
O33475 1.98e-121 367 45 8 471 3 cobQ Probable cobyric acid synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q4ZQ64 5.62e-121 366 45 9 495 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. syringae (strain B728a)
B4S8A8 7.79e-121 366 42 7 506 3 cobQ Cobyric acid synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q1MFE8 1.35e-120 365 42 8 500 3 cobQ Cobyric acid synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2JJP4 3.59e-120 365 41 11 508 3 cobQ Cobyric acid synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
B0CCR3 6.59e-120 364 42 7 499 3 cobQ Cobyric acid synthase Acaryochloris marina (strain MBIC 11017)
A6X034 1.2e-119 363 42 10 508 3 cobQ Cobyric acid synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B2HNJ6 1.27e-119 363 41 9 507 3 cobQ Cobyric acid synthase Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PU57 1.74e-119 363 41 9 507 3 cobQ Cobyric acid synthase Mycobacterium ulcerans (strain Agy99)
A6SWZ4 2.53e-119 362 46 6 455 3 cobQ Cobyric acid synthase Janthinobacterium sp. (strain Marseille)
C5A475 3.78e-119 362 43 12 502 3 cobQ Probable cobyric acid synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q48FJ7 4.15e-119 362 44 9 495 3 cobQ Cobyric acid synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q885W8 4.88e-119 361 43 8 496 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8G005 1.2e-118 360 42 9 502 3 cobQ Cobyric acid synthase Brucella suis biovar 1 (strain 1330)
Q829J5 1.27e-118 361 42 8 517 3 cobQ Cobyric acid synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9M5X3 1.66e-118 360 42 9 502 3 cobQ Cobyric acid synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8DI74 2.24e-118 360 42 9 509 3 cobQ Cobyric acid synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2FTC7 2.69e-118 359 42 8 500 3 cobQ Probable cobyric acid synthase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q57CI7 2.82e-118 359 42 9 502 3 cobQ Cobyric acid synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQK2 2.82e-118 359 42 9 502 3 cobQ Cobyric acid synthase Brucella abortus (strain 2308)
B2S6E8 2.82e-118 359 42 9 502 3 cobQ Cobyric acid synthase Brucella abortus (strain S19)
B4SH62 3.08e-118 360 42 4 505 3 cobQ Cobyric acid synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B0CHA6 3.18e-118 359 42 9 502 3 cobQ Cobyric acid synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
B9LKN1 4.97e-118 359 42 10 506 3 cobQ Cobyric acid synthase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WIN9 4.97e-118 359 42 10 506 3 cobQ Cobyric acid synthase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A9AZZ2 9.91e-118 358 43 10 459 3 cobQ Cobyric acid synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P0CY57 1.95e-117 357 43 9 506 3 cobQ Cobyric acid synthase Rhodobacter capsulatus
Q8KDV6 2.52e-117 357 43 7 502 3 cobQ Cobyric acid synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1B8D6 2.55e-117 357 44 10 509 3 cobQ Cobyric acid synthase Paracoccus denitrificans (strain Pd 1222)
Q8YHV6 3.01e-117 357 42 9 502 3 cobQ Cobyric acid synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJS3 3.01e-117 357 42 9 502 3 cobQ Cobyric acid synthase Brucella melitensis biotype 2 (strain ATCC 23457)
C3MDR9 3.17e-117 357 42 10 511 3 cobQ Cobyric acid synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D5AV13 3.44e-117 357 42 8 506 3 cobQ Cobyric acid synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
A3CX25 5.04e-117 356 42 7 503 3 cobQ Probable cobyric acid synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A1BFI0 5.92e-117 357 41 6 513 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q0W1N4 7.41e-117 356 42 9 512 3 cobQ Probable cobyric acid synthase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P29932 1.02e-116 355 41 8 509 1 cobQ Cobyric acid synthase Sinorhizobium sp.
B3EJS3 1.45e-116 355 43 6 506 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain BS1)
Q9KCI0 2.7e-116 355 42 7 473 3 cobQ Cobyric acid synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3ARV1 3.25e-116 355 42 5 507 3 cobQ Cobyric acid synthase Chlorobium chlorochromatii (strain CaD3)
B5ZT17 6.12e-116 353 41 8 500 3 cobQ Cobyric acid synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3KFR7 1.01e-115 353 44 8 503 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain Pf0-1)
B3PQX7 1.88e-115 352 41 10 501 3 cobQ Cobyric acid synthase Rhizobium etli (strain CIAT 652)
A7I9K5 3.86e-115 351 44 8 501 3 cobQ Probable cobyric acid synthase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
Q0C077 4.15e-115 352 40 9 514 3 cobQ Cobyric acid synthase Hyphomonas neptunium (strain ATCC 15444)
Q89Q71 4.29e-115 351 42 10 510 3 cobQ Cobyric acid synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A6UAC0 4.37e-115 351 44 7 466 3 cobQ Cobyric acid synthase Sinorhizobium medicae (strain WSM419)
Q2K7B5 4.61e-115 351 41 8 500 3 cobQ Cobyric acid synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B7JVZ0 7.84e-115 351 39 7 507 3 cobQ Cobyric acid synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q92P31 8.26e-115 350 43 7 466 3 cobQ Cobyric acid synthase Rhizobium meliloti (strain 1021)
A1S3L6 1.13e-114 350 41 8 511 3 cobQ Cobyric acid synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q3IZR0 1.32e-114 350 41 11 509 3 cobQ Cobyric acid synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A7NH10 4.26e-114 349 42 9 496 3 cobQ Cobyric acid synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
P9WP95 4.42e-114 349 40 10 510 1 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP94 4.42e-114 349 40 10 510 3 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TYY1 4.42e-114 349 40 10 510 3 cobQ Cobyric acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AJT1 4.42e-114 349 40 10 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KF76 4.42e-114 349 40 10 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A533 4.42e-114 349 40 10 510 3 cobQ Cobyric acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A4T0R6 1.08e-113 348 39 11 511 3 cobQ Cobyric acid synthase Mycolicibacterium gilvum (strain PYR-GCK)
Q73VS8 1.33e-113 348 42 8 476 3 cobQ Cobyric acid synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6NGL6 2.08e-113 347 37 8 506 3 cobQ Cobyric acid synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A1T225 3.65e-113 347 42 13 509 3 cobQ Cobyric acid synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A5VFK5 6.11e-113 346 40 7 507 3 cobQ Cobyric acid synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
C3K0Z0 1.25e-112 345 43 11 506 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain SBW25)
Q98L33 4.08e-112 344 39 11 519 3 cobQ Cobyric acid synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q28N58 5.33e-112 343 42 10 502 3 cobQ Cobyric acid synthase Jannaschia sp. (strain CCS1)
C5CKN7 6.85e-112 343 42 7 448 3 cobQ Cobyric acid synthase Variovorax paradoxus (strain S110)
B1Z9X0 4.55e-111 341 41 8 509 3 cobQ Cobyric acid synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B0SXF9 4.98e-111 341 42 9 511 3 cobQ Cobyric acid synthase Caulobacter sp. (strain K31)
Q1BAC5 1.2e-110 340 39 5 500 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain MCS)
A1UEN7 1.2e-110 340 39 5 500 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain KMS)
A3PY44 1.2e-110 340 39 5 500 3 cobQ Cobyric acid synthase Mycobacterium sp. (strain JLS)
A1WYA9 3.56e-110 338 42 7 456 3 cobQ Cobyric acid synthase Halorhodospira halophila (strain DSM 244 / SL1)
Q1GF45 9.73e-110 337 43 11 502 3 cobQ Cobyric acid synthase Ruegeria sp. (strain TM1040)
A4WPH6 2.17e-109 337 41 11 509 3 cobQ Cobyric acid synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B9JX68 2.3e-109 337 42 8 508 3 cobQ Cobyric acid synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q6AAP6 2.97e-109 336 40 10 511 3 cobQ Cobyric acid synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q2GBK2 8e-108 333 41 10 512 3 cobQ Cobyric acid synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q7U5J9 2.82e-107 332 39 9 504 3 cobQ Cobyric acid synthase Parasynechococcus marenigrum (strain WH8102)
O28931 1.64e-106 328 42 8 455 3 cobQ Probable cobyric acid synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9RZU9 1.89e-106 328 41 6 457 3 cobQ Cobyric acid synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q167R8 1.38e-105 327 39 10 513 3 cobQ Cobyric acid synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B8G7Y8 1.72e-104 324 42 8 458 3 cobQ Cobyric acid synthase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q21V75 3.09e-104 323 39 8 485 3 cobQ Cobyric acid synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0QVI7 3.9e-104 323 39 6 507 3 cobQ Cobyric acid synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1VP76 4.14e-104 323 39 11 488 3 cobQ Cobyric acid synthase Polaromonas naphthalenivorans (strain CJ2)
B8EQG6 4.15e-104 323 39 10 503 3 cobQ Cobyric acid synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q0IBR6 1.2e-102 320 37 10 508 3 cobQ Cobyric acid synthase Synechococcus sp. (strain CC9311)
Q3ALJ7 1.93e-101 317 38 12 510 3 cobQ Cobyric acid synthase Synechococcus sp. (strain CC9605)
Q1GPG1 2.47e-101 316 39 9 504 3 cobQ Cobyric acid synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q129W6 3.39e-101 316 39 9 475 3 cobQ Cobyric acid synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0UH14 3.55e-101 315 40 12 498 3 cobQ Cobyric acid synthase Methylobacterium sp. (strain 4-46)
Q0BUF0 9.25e-101 314 39 6 511 3 cobQ Cobyric acid synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q46JR6 3.16e-100 313 36 9 510 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain NATL2A)
A5GUP3 3.17e-100 313 37 8 502 3 cobQ Cobyric acid synthase Synechococcus sp. (strain RCC307)
B2IE16 1.25e-99 311 37 9 512 3 cobQ Cobyric acid synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q6LXX9 1.33e-99 311 37 8 503 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A1WAM6 8.4e-99 310 39 9 473 3 cobQ Cobyric acid synthase Acidovorax sp. (strain JS42)
A2SI71 1.07e-98 310 40 11 489 3 cobQ Cobyric acid synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1TMF3 1.19e-98 309 40 7 461 3 cobQ Cobyric acid synthase Paracidovorax citrulli (strain AAC00-1)
Q7V6H6 1.87e-98 309 37 10 514 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9313)
A2C3V9 5.19e-98 308 36 11 508 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain NATL1A)
Q8UBP3 5.95e-98 307 39 9 505 3 cobQ Cobyric acid synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
B8IUQ6 1.23e-97 306 41 8 452 3 cobQ Cobyric acid synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B9MD32 7.62e-97 305 40 9 479 3 cobQ Cobyric acid synthase Acidovorax ebreus (strain TPSY)
A2C7X7 8.18e-97 305 36 10 514 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9303)
A9AA97 8.41e-97 304 37 8 505 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A4FWW2 1.04e-96 304 37 11 509 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A5GMB9 1.3e-96 304 37 10 513 3 cobQ Cobyric acid synthase Synechococcus sp. (strain WH7803)
Q7VB41 4.24e-96 303 36 9 507 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q6L0V5 1.14e-95 301 40 11 457 3 cobQ Probable cobyric acid synthase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q8FP85 1.24e-95 301 42 3 373 3 cobQ Cobyric acid synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8TVH5 3.27e-95 300 38 15 514 3 cobQ Probable cobyric acid synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A7ILW0 3.41e-95 300 40 8 467 3 cobQ Cobyric acid synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q57908 4.74e-95 300 39 8 474 3 cobQ Probable cobyric acid synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4YXJ9 1.79e-94 298 39 10 508 3 cobQ Cobyric acid synthase Bradyrhizobium sp. (strain ORS 278)
A2BXM3 9.05e-93 295 34 11 516 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9515)
Q5V0Z6 1.49e-92 293 42 11 478 3 cobQ Probable cobyric acid synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A8I5C0 1.03e-91 291 39 8 511 3 cobQ Cobyric acid synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A6VGF5 8.63e-91 289 37 11 508 3 cobQ Probable cobyric acid synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A5EGF9 1.97e-90 288 38 9 512 3 cobQ Cobyric acid synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B1Y856 9.4e-90 287 38 11 500 3 cobQ Cobyric acid synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q7V0U2 1.26e-89 286 35 10 509 3 cobQ Cobyric acid synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2BS60 1.86e-88 283 34 11 507 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain AS9601)
A6UWF6 2.79e-88 282 36 8 506 3 cobQ Probable cobyric acid synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A8G5V0 6.43e-88 282 33 11 515 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9215)
A6UPL5 1.81e-87 280 36 10 510 3 cobQ Probable cobyric acid synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q319X7 1.65e-86 278 32 11 515 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9312)
A3PE00 4.12e-86 277 33 10 505 3 cobQ Cobyric acid synthase Prochlorococcus marinus (strain MIT 9301)
Q9HPL5 7.37e-86 276 38 14 517 3 cobQ Probable cobyric acid synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5X2 7.37e-86 276 38 14 517 3 cobQ Probable cobyric acid synthase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9HLZ8 4.21e-85 273 38 13 453 3 cobQ Probable cobyric acid synthase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q43989 6.67e-85 273 34 10 499 3 cobQ Cobyric acid synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P21157 9.92e-65 213 46 0 226 3 cobQ Probable cobyric acid synthase (Fragment) Methanococcus voltae
Q9KER6 1.25e-08 59 25 9 230 3 bioD ATP-dependent dethiobiotin synthetase BioD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q97JC5 1.61e-07 55 25 9 227 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Z890 3.84e-05 48 25 7 234 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhi
B9MP52 3.99e-05 48 24 12 240 3 bioD ATP-dependent dethiobiotin synthetase BioD Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A0A0H3JN63 4.07e-05 48 29 6 155 1 gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD Staphylococcus aureus (strain N315)
A0A0H2WZ38 4.07e-05 48 29 6 155 1 gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD Staphylococcus aureus (strain COL)
Q8ZQQ5 6.08e-05 48 24 7 234 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C5D7P0 0.000122 47 38 4 88 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus sp. (strain WCH70)
Q97KI0 0.000222 46 35 2 77 3 hisH Imidazole glycerol phosphate synthase subunit HisH Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A5N6Q7 0.000235 46 23 9 243 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E076 0.000235 46 23 9 243 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium kluyveri (strain NBRC 12016)
Q81MA9 0.000277 46 25 9 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis
C3LJP5 0.000277 46 25 9 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P7Q4 0.000277 46 25 9 232 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain A0248)
Q8FPS0 0.000428 45 27 9 241 3 bioD ATP-dependent dethiobiotin synthetase BioD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7M9X0 0.000628 44 36 4 93 3 hisH Imidazole glycerol phosphate synthase subunit HisH Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q30PY0 0.000703 44 36 5 93 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q8RBJ4 0.00089 43 32 4 96 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13760
Feature type CDS
Gene -
Product cobyric acid synthase
Location 385268 - 386803 (strand: 1)
Length 1536 (nucleotides) / 511 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3077
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01656 CobQ/CobB/MinD/ParA nucleotide binding domain
PF07685 CobB/CobQ-like glutamine amidotransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1492 Coenzyme transport and metabolism (H) H Cobyric acid synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MTVSLMIQGTASDVGKSVLVAGFCRIFSQDGYHCAPFKSQNMALNSGITRDGKEMGRAQIFQAEAAGIEPDVRMNPVLLKPTSDRKSQVVLMGKVASNMDAVEYHNYKPQLRTMIHEVYNSLAAEHGIIVLEGAGSPAEINLRDGDIVNMGMAEMIDAPVILVADIDRGGVFASIYGTLALLSDQERARVIGVIINKFRGDVALLMPGITQIEGLTNVPVLGVLPWLDVDLEDEDGVALQVGKYDGKTEKVLDIVVVQLPHIANFTDFNALATQPDVRLRYESDPKALGEPDLLIIPGSKNTLGDLLWLRQKGMDKAILAQHAKGTPVAGICGGYQILGKHIYDDVESGMSDLPGLGLLDITTRFSPEKNTTQTAGTISSTLPGIWSACTTQPVSGYEIHMGVSELGPDALAFAHMHQKNREPCNHADGAVSPDGSVMGSYLHGIFDRTNFTRPLLNKLRESKGLEPLPESIFDYALHKEEQFNILAAQMREHLDIAEITRLMRAHKEKTA

Flanking regions ( +/- flanking 50bp)

CAACTGCAACAGCAGACAACTCCCGCCGCCGGGACACGAGAGGTAATGGCATGACAGTTTCACTGATGATCCAGGGCACCGCTTCCGATGTCGGAAAAAGTGTATTAGTCGCCGGATTCTGCCGGATTTTCTCTCAGGACGGCTATCACTGCGCCCCGTTTAAATCACAGAACATGGCACTGAACTCGGGGATCACCCGTGACGGCAAGGAGATGGGACGCGCCCAGATTTTTCAGGCGGAAGCCGCCGGTATTGAGCCGGATGTGCGCATGAACCCTGTTTTACTCAAACCCACCTCTGACCGCAAATCGCAGGTGGTACTGATGGGCAAAGTCGCCAGCAACATGGACGCGGTGGAATATCACAACTATAAACCCCAACTGCGGACAATGATCCACGAGGTGTATAACAGCCTTGCCGCTGAGCATGGCATCATTGTGCTGGAAGGTGCGGGCAGCCCGGCGGAGATCAATCTGCGCGACGGCGATATCGTCAATATGGGCATGGCGGAGATGATCGACGCGCCCGTGATCCTGGTGGCAGATATCGATCGCGGCGGGGTATTTGCGTCTATTTACGGCACACTGGCACTGCTCAGTGATCAGGAACGCGCCCGGGTTATCGGGGTTATCATCAATAAATTCCGTGGCGATGTTGCTCTGTTGATGCCCGGGATCACACAGATCGAAGGGCTCACCAACGTTCCTGTTCTGGGCGTGTTACCGTGGCTGGATGTCGATCTGGAAGATGAAGACGGCGTTGCATTGCAGGTCGGTAAATATGACGGCAAAACAGAAAAAGTGCTGGATATTGTGGTAGTTCAGTTGCCGCACATTGCTAATTTCACTGATTTTAATGCCCTTGCCACGCAACCGGATGTCCGTCTGCGCTATGAATCAGACCCGAAAGCCCTCGGCGAACCGGATCTGCTGATTATTCCGGGCAGTAAAAATACCCTGGGTGATCTGCTGTGGCTGCGCCAGAAAGGCATGGATAAAGCGATCCTCGCACAACACGCAAAAGGCACGCCGGTTGCCGGTATTTGCGGCGGGTATCAGATCCTCGGTAAACATATTTATGACGATGTCGAATCCGGCATGTCAGATTTACCGGGACTGGGGCTGCTTGATATCACCACCCGCTTCTCCCCGGAAAAAAATACCACACAAACCGCCGGAACCATCAGCAGCACACTGCCGGGTATCTGGTCGGCATGCACCACACAGCCGGTCAGCGGTTATGAGATCCACATGGGTGTATCAGAATTAGGTCCGGATGCATTGGCGTTTGCGCACATGCATCAGAAAAACCGGGAGCCCTGCAACCATGCAGATGGCGCAGTCAGCCCGGACGGCAGCGTGATGGGATCGTATCTGCACGGAATATTCGACAGAACTAATTTCACCCGCCCTCTGCTCAATAAATTACGTGAATCTAAAGGACTTGAACCCTTGCCCGAAAGTATCTTTGATTATGCCCTGCACAAGGAAGAGCAGTTCAATATTCTCGCCGCACAGATGCGGGAGCATCTGGATATCGCAGAAATCACCCGTCTGATGCGCGCGCACAAGGAAAAAACAGCATGATTATTATCACCGGCGGCGCCCGCAGCGGCAAAAGCAGCTTTGCCGAAAAT