Homologs in group_1103

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06275 FBDBKF_06275 100.0 Morganella morganii S1 apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
EHELCC_09320 EHELCC_09320 100.0 Morganella morganii S2 apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
NLDBIP_09700 NLDBIP_09700 100.0 Morganella morganii S4 apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
LHKJJB_08055 LHKJJB_08055 100.0 Morganella morganii S3 apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
F4V73_RS15645 F4V73_RS15645 89.5 Morganella psychrotolerans apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
PMI_RS11555 PMI_RS11555 77.3 Proteus mirabilis HI4320 apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH

Distribution of the homologs in the orthogroup group_1103

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1103

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2I4 4.26e-161 451 78 0 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Proteus mirabilis (strain HI4320)
A1JJF2 6.11e-157 441 75 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q66ER0 6.31e-155 436 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K485 6.31e-155 436 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMC3 6.38e-155 436 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JKY5 6.45e-155 436 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P0A1B1 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1B2 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella typhi
A9MYM2 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T6L4 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella newport (strain SL254)
B4TJ45 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella heidelberg (strain SL476)
B5RGC0 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1S6 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella enteritidis PT4 (strain P125109)
B5FI32 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella dublin (strain CT_02021853)
B5F769 1.6e-154 435 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella agona (strain SL483)
Q6D0D8 2.89e-154 434 73 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4TQE0 3.64e-154 434 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pestis (strain Pestoides F)
Q1CMT4 3.64e-154 434 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZZ2 3.64e-154 434 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIK7 3.64e-154 434 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pestis
Q1C0H7 3.64e-154 434 74 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Yersinia pestis bv. Antiqua (strain Antiqua)
B5BL25 5.23e-154 433 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella paratyphi A (strain AKU_12601)
Q5PDE1 5.23e-154 433 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MQG4 6.03e-154 433 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ALQ2 6.1e-154 433 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TWT4 9.45e-154 433 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella schwarzengrund (strain CVM19633)
B5Y1Z6 1.04e-153 432 73 0 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Klebsiella pneumoniae (strain 342)
Q57TH2 1.22e-153 432 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella choleraesuis (strain SC-B67)
Q7N8V9 2.22e-153 431 73 0 269 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MIB2 4.54e-153 431 72 0 277 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Cronobacter sakazakii (strain ATCC BAA-894)
Q83SQ2 4.81e-153 431 75 0 273 1 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella flexneri
Q0T8E6 4.81e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella flexneri serotype 5b (strain 8401)
B6HZ30 4.81e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain SE11)
A7ZW01 4.81e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O9:H4 (strain HS)
B7M0E6 4.81e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O8 (strain IAI1)
A7ZHE2 4.81e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O139:H28 (strain E24377A / ETEC)
A6T4I5 5.34e-153 431 73 0 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3Z5W0 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella sonnei (strain Ss046)
Q326I4 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella boydii serotype 4 (strain Sb227)
B2U257 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P05637 5.86e-153 431 75 0 273 1 apaH Bis(5'-nucleosyl)-tetraphosphatase [symmetrical] Escherichia coli (strain K12)
B1IRC7 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC50 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain K12 / DH10B)
C4ZPX5 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain K12 / MC4100 / BW2952)
B7L4H2 5.86e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain 55989 / EAEC)
C0Q5E5 5.89e-153 431 76 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Salmonella paratyphi C (strain RKS4594)
B5YZ87 6.72e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA15 6.72e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O157:H7
B7LVU3 7.75e-153 431 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LFY5 8.18e-153 430 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain SMS-3-5 / SECEC)
B7NHF5 8.18e-153 430 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7N7S4 9.08e-153 430 75 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TLT8 2.03e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MNQ8 2.03e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O81 (strain ED1a)
Q8FL98 2.37e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UI97 2.37e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1RGE8 2.61e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli (strain UTI89 / UPEC)
A1A798 2.61e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O1:K1 / APEC
B7MAH4 2.61e-152 429 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Escherichia coli O45:K1 (strain S88 / ExPEC)
Q32K45 8.08e-152 428 74 0 273 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shigella dysenteriae serotype 1 (strain Sd197)
A4W6F5 8.82e-152 428 74 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Enterobacter sp. (strain 638)
A8G9N8 1.74e-151 427 74 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Serratia proteamaculans (strain 568)
C6DEY8 9.27e-151 425 74 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2VGQ8 6.39e-150 423 73 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NVX8 3.53e-149 421 73 0 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Sodalis glossinidius (strain morsitans)
C5B7N9 4.35e-148 418 76 1 265 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Edwardsiella ictaluri (strain 93-146)
P27510 1.24e-138 394 73 0 253 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical (Fragment) Klebsiella aerogenes
Q1LSS3 2.8e-131 376 63 0 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Baumannia cicadellinicola subsp. Homalodisca coagulata
C4K4K8 6.44e-121 349 57 0 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q8K9Z9 5.53e-107 314 49 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57242 1.94e-106 313 51 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D747 2.47e-106 312 51 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8U3 4.56e-106 311 51 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A7N0G6 2.84e-99 294 52 4 271 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio campbellii (strain ATCC BAA-1116)
Q0I5C4 4.76e-98 291 52 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Histophilus somni (strain 129Pt)
A1STS0 5.5e-98 291 51 3 275 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
O52655 1.07e-97 290 51 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aggregatibacter actinomycetemcomitans
C3LRH2 1.15e-97 290 52 4 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio cholerae serotype O1 (strain M66-2)
Q9KUS4 1.15e-97 290 52 4 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F8N0 1.15e-97 290 52 4 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q89AV3 2.04e-97 290 48 2 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B0URM8 5.09e-97 288 52 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Histophilus somni (strain 2336)
P44751 5.15e-97 289 50 1 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMZ7 8.7e-97 288 49 1 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Haemophilus influenzae (strain 86-028NP)
A5U9U1 1.18e-96 288 50 1 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Haemophilus influenzae (strain PittEE)
P57922 1.08e-95 285 51 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pasteurella multocida (strain Pm70)
A5UH58 2.79e-95 284 49 1 276 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Haemophilus influenzae (strain PittGG)
Q7MP88 2.34e-94 282 50 3 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio vulnificus (strain YJ016)
B8F4P0 2.76e-94 281 49 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Glaesserella parasuis serovar 5 (strain SH0165)
Q47VJ7 8.99e-94 281 48 3 282 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B6EL47 1.92e-93 280 50 2 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aliivibrio salmonicida (strain LFI1238)
A6VMA9 1.95e-93 280 49 0 268 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q8DED0 2.44e-93 279 50 3 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio vulnificus (strain CMCP6)
Q65UX2 3.83e-93 279 50 0 266 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5E866 4.21e-92 276 51 2 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87ST8 1.09e-91 275 50 4 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VLX9 5.23e-91 273 47 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BP40 5.23e-91 273 48 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXJ7 6.79e-91 273 48 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0C2 6.79e-91 273 48 0 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C4L9L6 7.75e-91 273 51 0 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B5FGG4 1.62e-89 270 50 2 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aliivibrio fischeri (strain MJ11)
A6VU51 8.06e-89 268 50 0 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Marinomonas sp. (strain MWYL1)
Q0HS04 4.66e-88 266 51 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella sp. (strain MR-7)
A4SR08 1.65e-87 265 50 0 260 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aeromonas salmonicida (strain A449)
A0L066 5.41e-87 263 50 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella sp. (strain ANA-3)
A0KGT6 5.84e-87 263 49 0 260 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6LV43 1.2e-86 262 50 2 265 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Photobacterium profundum (strain SS9)
Q0HLT4 2.93e-86 261 50 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella sp. (strain MR-4)
Q8EB91 5.11e-86 261 49 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RMV0 5.95e-86 261 48 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella sp. (strain W3-18-1)
A9L436 6.85e-86 260 47 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella baltica (strain OS195)
A4Y433 9.5e-86 260 48 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3D186 1.64e-85 259 47 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8D3I0 2.32e-85 259 42 1 267 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Wigglesworthia glossinidia brevipalpis
A6WK57 2.4e-85 259 47 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella baltica (strain OS185)
B8EB37 7.53e-85 258 47 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella baltica (strain OS223)
Q07YJ6 9.74e-84 255 47 2 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella frigidimarina (strain NCIMB 400)
C3K329 1.55e-83 254 48 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas fluorescens (strain SBW25)
A3QBA1 2.51e-83 254 45 2 271 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q1IG22 5.2e-82 251 48 1 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas entomophila (strain L48)
Q60CE9 3.91e-81 248 50 2 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9I5U7 4.95e-81 248 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02TH3 4.95e-81 248 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V4H6 4.95e-81 248 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas aeruginosa (strain LESB58)
Q4K4X3 6.19e-81 248 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B8GMY8 9.92e-81 247 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B0KJ91 1.03e-80 248 47 1 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas putida (strain GB-1)
A4XZJ6 1.73e-80 246 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas mendocina (strain ymp)
Q3JBF6 2.57e-80 246 48 1 258 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1JE09 4.39e-80 246 47 1 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas putida (strain W619)
B3PKV6 5.02e-80 245 46 0 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Cellvibrio japonicus (strain Ueda107)
Q3K5T0 1.03e-79 245 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas fluorescens (strain Pf0-1)
A6UZ94 1.49e-79 244 45 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas aeruginosa (strain PA7)
Q5P6P9 6.19e-79 243 48 3 265 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4VHH8 2.99e-78 241 46 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Stutzerimonas stutzeri (strain A1501)
Q1H450 9.16e-78 240 46 2 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C1DIX1 1.35e-77 239 47 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q2YCK7 1.84e-77 239 46 2 270 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q48NT9 2.92e-77 239 45 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A8FRV0 3.28e-77 238 47 2 271 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Shewanella sediminis (strain HAW-EB3)
C5BPC0 5.02e-77 238 48 0 254 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Teredinibacter turnerae (strain ATCC 39867 / T7901)
A9BVD2 7.51e-77 238 45 2 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Delftia acidovorans (strain DSM 14801 / SPH-1)
Q21MT2 1.96e-76 236 46 1 265 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q88QT8 2e-76 237 44 1 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VXJ3 2e-76 237 44 1 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88A48 4.95e-76 236 44 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0AC59 7.31e-76 235 47 2 260 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q82WQ0 2.53e-74 231 44 2 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q4ZMG3 2.11e-73 229 44 1 257 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Pseudomonas syringae pv. syringae (strain B728a)
Q3SMC6 3.65e-72 225 45 2 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Thiobacillus denitrificans (strain ATCC 25259)
A5IIB8 6.39e-72 225 48 1 272 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Legionella pneumophila (strain Corby)
Q5X0V3 6.39e-72 225 48 1 272 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Legionella pneumophila (strain Paris)
A1TLA3 1.01e-71 224 45 3 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Paracidovorax citrulli (strain AAC00-1)
Q5ZRF6 1.24e-71 224 48 1 272 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WSM5 2.18e-71 223 47 1 272 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Legionella pneumophila (strain Lens)
A1W551 5.93e-71 223 45 2 260 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Acidovorax sp. (strain JS42)
Q1QZ29 7.08e-71 222 45 2 274 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B9MFH8 8.21e-71 222 44 3 271 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Acidovorax ebreus (strain TPSY)
Q478S1 6.73e-70 220 46 3 265 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Dechloromonas aromatica (strain RCB)
Q7NQS0 3.38e-69 218 43 2 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9JVF4 3.08e-66 210 43 2 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q83AB7 2.79e-65 208 41 2 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N9I1 2.79e-65 208 41 2 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J3B1 8.08e-65 207 40 3 271 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Coxiella burnetii (strain CbuG_Q212)
B4RJQ3 8.96e-65 207 43 2 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Neisseria gonorrhoeae (strain NCCP11945)
Q5FA03 8.96e-65 207 43 2 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9KH04 2.26e-64 206 41 2 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Coxiella burnetii (strain Dugway 5J108-111)
A4G8L5 2.54e-64 205 42 3 261 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Herminiimonas arsenicoxydans
B6J646 2.63e-64 206 41 2 263 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Coxiella burnetii (strain CbuK_Q154)
A6T287 6.9e-64 204 42 2 264 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Janthinobacterium sp. (strain Marseille)
Q2SYI5 1.79e-63 203 42 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q87C83 2.75e-63 203 41 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5R6 2.75e-63 203 41 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xylella fastidiosa (strain M23)
Q9PBJ4 2.99e-63 203 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xylella fastidiosa (strain 9a5c)
Q7W3V0 1.85e-61 198 39 3 277 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF80 1.85e-61 198 39 3 277 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W041 2.15e-61 198 40 3 275 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8PCE5 2.16e-61 199 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PP27 8.22e-61 197 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas axonopodis pv. citri (strain 306)
Q3BX84 2.86e-60 196 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GWB7 8.86e-60 195 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
A9I1T6 1.03e-59 194 40 4 262 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2NZI2 1.36e-59 195 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2SPT1 1.46e-59 194 42 3 259 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Xanthomonas oryzae pv. oryzae (strain PXO99A)
B2JFC8 1.53e-59 193 39 3 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1V209 4.46e-59 192 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia mallei (strain SAVP1)
Q9AEV8 4.46e-59 192 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia mallei (strain ATCC 23344)
A2S9T5 4.46e-59 192 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia mallei (strain NCTC 10229)
A3MMA4 4.46e-59 192 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia mallei (strain NCTC 10247)
P0DMK2 1.4e-58 191 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia pseudomallei (strain K96243)
I1WGA2 1.4e-58 191 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia pseudomallei (strain 1026b)
Q3JPG7 1.4e-58 191 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia pseudomallei (strain 1710b)
A3NYF9 1.4e-58 191 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia pseudomallei (strain 1106a)
A3NCP7 1.53e-58 191 41 4 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Burkholderia pseudomallei (strain 668)
Q8Y1K9 8.19e-57 186 42 5 256 3 apaH Bis(5'-nucleosyl)-tetraphosphatase, symmetrical Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q65LA0 8.53e-10 61 30 5 146 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O31614 1.78e-09 60 24 11 280 1 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus subtilis (strain 168)
A7Z3F2 6.67e-09 58 26 13 291 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A4IL88 5.97e-07 52 25 12 277 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Geobacillus thermodenitrificans (strain NG80-2)
Q9K907 1.1e-06 52 24 9 273 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8ZMH3 1.22e-06 51 26 4 162 1 pphB Serine/threonine-protein phosphatase 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40152 1.22e-06 52 24 10 262 1 PPN2 Zinc-dependent endopolyphosphatase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8ZNY9 1.86e-06 51 40 1 65 1 pphA Serine/threonine-protein phosphatase 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5L1R3 1.94e-06 51 31 6 144 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Geobacillus kaustophilus (strain HTA426)
P55798 3.77e-06 50 42 1 64 1 pphA Serine/threonine-protein phosphatase 1 Escherichia coli (strain K12)
P55799 1.37e-05 48 42 1 64 1 pphB Serine/threonine-protein phosphatase 2 Escherichia coli (strain K12)
B7GLK2 1.64e-05 48 29 4 140 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B9IU03 6.62e-05 47 22 8 241 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus cereus (strain Q1)
Q73BU4 8.18e-05 46 22 8 241 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus cereus (strain ATCC 10987 / NRS 248)
C5D7A6 0.000118 46 22 12 284 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Geobacillus sp. (strain WCH70)
B7ILE8 0.000142 45 21 8 241 3 prpE Bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical] Bacillus cereus (strain G9842)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_07605
Feature type CDS
Gene apaH
Product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
Location 128124 - 128957 (strand: -1)
Length 834 (nucleotides) / 277 (amino acids)

Contig

Accession ZDB_684
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1103
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00149 Calcineurin-like phosphoesterase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0639 Signal transduction mechanisms (T) T Diadenosine tetraphosphatase ApaH/serine/threonine protein phosphatase, PP2A family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01525 bis(5'-nucleosyl)-tetraphosphatase (symmetrical) [EC:3.6.1.41] Purine metabolism
Metabolic pathways		 -

Protein Sequence

MATYLIGDVHGCYHELRALLAQADFDPLADTLWLTGDLVARGPDSLDVLRYVKSLGDCVRLVLGNHDLHLLGIYAGISRNKPRDHLNKLLSAPDLDELINWLRRQPMLQVDHEKKLVMAHAGITPQWDLDTAIICAREVEAVLSSDTYPLFINAMYGDLPNDWSPSLTGLPRLRFSTNALTRMRYCFPGGQLDMVCKDKPDQVSAPLKPWFALPSKLPEGYSVAFGHWASLEGKGAPRGIYALDTGCCWGGQLTMLRWEDRCYFWQESFAVRDEDDD

Flanking regions ( +/- flanking 50bp)

AGATCCCTGTTTTCCGGCTCGCAATACCAACCTTTATTCACTGATTTTCTATGGCAACCTATCTTATCGGCGATGTTCATGGCTGTTACCATGAACTTCGCGCATTACTGGCTCAGGCTGATTTTGATCCGCTGGCTGATACCCTGTGGCTGACCGGCGATCTGGTCGCCCGCGGCCCTGATTCACTGGATGTCCTCCGCTATGTCAAAAGCCTGGGTGACTGCGTCAGGTTGGTACTCGGCAATCATGATCTGCATCTGCTGGGGATCTACGCGGGGATCAGCCGTAACAAACCGCGCGATCATCTGAACAAACTGCTCAGCGCACCGGATCTGGATGAGCTGATCAACTGGCTGCGCCGTCAGCCGATGTTGCAGGTTGATCATGAGAAAAAACTGGTCATGGCACACGCGGGGATCACCCCGCAGTGGGATCTGGATACCGCTATTATATGTGCCCGTGAAGTGGAAGCGGTTCTCAGCAGTGATACCTATCCGCTGTTTATTAATGCGATGTATGGTGACCTGCCGAATGACTGGTCACCTTCCCTCACCGGCCTGCCGCGTCTGCGCTTTTCCACCAATGCCCTGACACGGATGCGTTACTGTTTCCCGGGCGGGCAGTTGGATATGGTCTGCAAAGATAAACCGGATCAGGTTTCCGCGCCGCTGAAACCCTGGTTTGCCCTGCCGTCAAAACTGCCGGAAGGCTACAGTGTGGCCTTTGGTCACTGGGCGTCACTGGAAGGCAAAGGAGCACCACGCGGTATCTATGCACTGGATACCGGCTGCTGCTGGGGCGGACAACTCACCATGCTGCGCTGGGAAGATCGCTGCTATTTCTGGCAGGAGTCTTTTGCGGTGCGGGATGAGGATGATGACTGACCGGCCACCGGTAACAGACAAGAAAAAAGCAGAGCCGGTGGCTCTGCTTT