Homologs in group_1160

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06655 FBDBKF_06655 100.0 Morganella morganii S1 ureC urease subunit alpha
EHELCC_09700 EHELCC_09700 100.0 Morganella morganii S2 ureC urease subunit alpha
NLDBIP_10080 NLDBIP_10080 100.0 Morganella morganii S4 ureC urease subunit alpha
LHKJJB_07670 LHKJJB_07670 100.0 Morganella morganii S3 ureC urease subunit alpha
F4V73_RS15280 F4V73_RS15280 97.7 Morganella psychrotolerans - urease subunit alpha
PMI_RS18335 PMI_RS18335 57.0 Proteus mirabilis HI4320 ureC urease subunit alpha

Distribution of the homologs in the orthogroup group_1160

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1160

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31494 0.0 1059 88 0 572 3 ureC Urease subunit alpha Yersinia enterocolitica
A1JKD9 0.0 1059 88 0 572 3 ureC Urease subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JR71 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P52313 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TL32 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pestis (strain Pestoides F)
Q1CKJ9 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3V0 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Angola)
Q9ZFR9 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pestis
B2KAA4 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5B3 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFN2 0.0 1058 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BBR6 0.0 1008 83 0 572 3 ureC Urease subunit alpha Edwardsiella ictaluri (strain 93-146)
Q7N4Y7 0.0 999 83 1 571 3 ureC Urease subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C1D5Z8 0.0 874 72 0 571 3 ureC Urease subunit alpha Laribacter hongkongensis (strain HLHK9)
Q8YHZ8 0.0 833 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57CE8 0.0 832 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella abortus biovar 1 (strain 9-941)
Q2YQD8 0.0 832 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella abortus (strain 2308)
Q8FZW2 0.0 830 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella suis biovar 1 (strain 1330)
Q2JQ88 0.0 727 60 1 569 3 ureC Urease subunit alpha Synechococcus sp. (strain JA-2-3B'a(2-13))
A5FAD1 0.0 724 59 2 570 3 ureC Urease subunit alpha Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B3H2L3 0.0 718 58 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BRU2 0.0 718 58 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2R4 0.0 718 58 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3DGF8 0.0 716 59 1 569 3 ureC Urease subunit alpha Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
O54420 0.0 713 58 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae
A5U9V6 0.0 711 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain PittEE)
Q4QN09 0.0 711 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain 86-028NP)
P44391 0.0 708 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1R1C5 0.0 707 60 3 575 3 ureC Urease subunit alpha Paenarthrobacter aurescens (strain TC1)
A5UH45 0.0 706 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain PittGG)
B8HA07 0.0 704 59 3 584 3 ureC Urease subunit alpha Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
P77837 0.0 704 58 2 569 1 ureC Urease subunit alpha Bacillus subtilis (strain 168)
A0JRH4 0.0 703 58 3 575 3 ureC Urease subunit alpha Arthrobacter sp. (strain FB24)
Q9KG59 0.0 702 59 2 570 3 ureC Urease subunit alpha Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q733J6 0.0 702 57 2 569 3 ureC Urease subunit alpha Bacillus cereus (strain ATCC 10987 / NRS 248)
A7Z9N4 0.0 699 57 2 569 3 ureC Urease subunit alpha Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q07397 0.0 699 60 3 568 1 ureC Urease subunit alpha Bacillus sp. (strain TB-90)
B3PXB3 0.0 691 57 5 573 3 ureC Urease subunit alpha Rhizobium etli (strain CIAT 652)
Q9RYJ4 0.0 691 60 4 570 3 ureC Urease subunit alpha Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P41020 0.0 691 57 3 570 1 ureC Urease subunit alpha Sporosarcina pasteurii
A9KJR9 0.0 690 58 2 568 3 ureC Urease subunit alpha Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2K517 0.0 689 57 5 573 3 ureC Urease subunit alpha Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B8EPU9 0.0 689 58 5 573 3 ureC Urease subunit alpha Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q47G55 0.0 689 59 3 569 3 ureC Urease subunit alpha Dechloromonas aromatica (strain RCB)
Q11EW4 0.0 688 57 5 573 3 ureC Urease subunit alpha Chelativorans sp. (strain BNC1)
B5ZMP0 0.0 687 57 5 573 3 ureC Urease subunit alpha Rhizobium leguminosarum bv. trifolii (strain WSM2304)
C5C8U3 0.0 687 58 3 570 3 ureC Urease subunit alpha Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
B5YUX3 0.0 686 58 3 571 3 ureC Urease subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAG0 0.0 686 58 3 571 3 ureC1 Urease subunit alpha Escherichia coli O157:H7
Q1MCV9 0.0 686 57 5 573 3 ureC Urease subunit alpha Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B2GI06 0.0 684 58 3 570 3 ureC Urease subunit alpha Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q93T81 0.0 684 57 5 573 3 ureC1 Urease subunit alpha 1 Brucella abortus biovar 1 (strain 9-941)
Q2YPD5 0.0 684 57 5 573 1 ureC1 Urease subunit alpha 1 Brucella abortus (strain 2308)
Q98CY9 0.0 684 56 3 572 3 ureC Urease subunit alpha Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q87VP0 0.0 682 58 3 569 3 ureC Urease subunit alpha Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B4UFU2 0.0 682 58 2 568 3 ureC Urease subunit alpha Anaeromyxobacter sp. (strain K)
Q8G2P8 0.0 682 57 5 573 1 ureC1 Urease subunit alpha 1 Brucella suis biovar 1 (strain 1330)
A6UC35 0.0 681 57 4 570 3 ureC Urease subunit alpha Sinorhizobium medicae (strain WSM419)
Q4ZN06 0.0 681 58 3 569 3 ureC2 Urease subunit alpha 2 Pseudomonas syringae pv. syringae (strain B728a)
P42885 0.0 681 57 4 570 3 ureC Urease subunit alpha Rhizobium meliloti (strain 1021)
P17086 0.0 681 56 3 571 1 ureC Urease subunit alpha Proteus mirabilis (strain HI4320)
A6SZ07 0.0 681 58 4 571 3 ureC Urease subunit alpha Janthinobacterium sp. (strain Marseille)
B4ECC7 0.0 681 59 3 569 3 ureC Urease subunit alpha Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8YF72 0.0 681 57 5 573 3 ureC1 Urease subunit alpha 1 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9AZE6 0.0 681 58 2 568 3 ureC Urease subunit alpha Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q1QCE0 0.0 681 58 5 570 3 ureC1 Urease subunit alpha 1 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q48DE6 0.0 680 58 3 569 3 ureC Urease subunit alpha Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1BYH2 0.0 680 59 3 569 3 ureC Urease subunit alpha Burkholderia orbicola (strain AU 1054)
B1JX29 0.0 680 59 3 569 3 ureC Urease subunit alpha Burkholderia orbicola (strain MC0-3)
Q39IW3 0.0 680 58 3 569 3 ureC Urease subunit alpha Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BHN5 0.0 680 59 3 569 3 ureC Urease subunit alpha Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K576 0.0 680 59 3 569 3 ureC Urease subunit alpha Burkholderia cenocepacia (strain HI2424)
Q8UCT2 0.0 680 57 6 573 3 ureC Urease subunit alpha Agrobacterium fabrum (strain C58 / ATCC 33970)
A4JC42 0.0 679 59 3 569 3 ureC Urease subunit alpha Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2SYF7 0.0 679 59 3 568 3 ureC Urease subunit alpha Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B9J8M3 0.0 678 57 5 570 3 ureC Urease subunit alpha Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q8FQX2 0.0 678 57 3 573 3 ureC Urease subunit alpha Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q2JWP0 0.0 677 59 4 570 3 ureC Urease subunit alpha Synechococcus sp. (strain JA-3-3Ab)
Q210F9 0.0 677 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisB18)
A9AF72 0.0 677 58 3 569 3 ureC Urease subunit alpha Burkholderia multivorans (strain ATCC 17616 / 249)
Q07K73 0.0 677 58 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisA53)
Q5KYM1 0.0 677 58 3 569 3 ureC Urease subunit alpha Geobacillus kaustophilus (strain HTA426)
P42823 0.0 676 57 3 569 3 ureB Urease subunit beta Helicobacter heilmannii
B1YUF9 0.0 676 58 3 569 3 ureC Urease subunit alpha Burkholderia ambifaria (strain MC40-6)
B5FBC6 0.0 676 56 3 571 3 ureC Urease subunit alpha Aliivibrio fischeri (strain MJ11)
Q89UG0 0.0 676 57 5 571 3 ureC Urease subunit alpha Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5E728 0.0 675 56 3 571 3 ureC Urease subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
A9BUC4 0.0 674 59 3 571 3 ureC Urease subunit alpha Delftia acidovorans (strain DSM 14801 / SPH-1)
Q2Y9M7 0.0 674 59 3 569 3 ureC Urease subunit alpha Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A3NYC9 0.0 674 59 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 1106a)
C3MGI5 0.0 673 56 4 570 3 ureC Urease subunit alpha Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0KCP6 0.0 673 59 4 575 3 ureC Urease subunit alpha Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q63RL3 0.0 673 59 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain K96243)
A3NCL7 0.0 673 59 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 668)
P08298 0.0 672 58 3 568 2 EU4 Urease Glycine max
A1V1G6 0.0 672 59 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain SAVP1)
Q62HS0 0.0 672 59 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain ATCC 23344)
A2S996 0.0 672 59 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain NCTC 10229)
A3MMV2 0.0 672 59 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain NCTC 10247)
B8HW50 0.0 672 57 3 568 3 ureC Urease subunit alpha Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3JPJ6 0.0 671 59 3 568 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 1710b)
B9JR81 0.0 671 56 5 573 3 ureC Urease subunit alpha Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
P16122 0.0 671 55 3 571 3 ureC Urease subunit alpha Proteus hauseri
C5BUN9 0.0 670 58 3 571 3 ureC Urease subunit alpha Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q08716 0.0 669 56 2 569 1 ureB Urease subunit beta Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
B4RSX9 0.0 669 56 3 571 3 ureC Urease subunit alpha Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B5XU27 0.0 668 59 3 571 3 ureC Urease subunit alpha Klebsiella pneumoniae (strain 342)
B3QGK1 0.0 668 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain TIE-1)
Q3KIT2 0.0 668 57 3 569 3 ureC Urease subunit alpha Pseudomonas fluorescens (strain Pf0-1)
A6TE42 0.0 668 59 3 571 3 ureC Urease subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P18314 0.0 668 59 3 571 1 ureC Urease subunit alpha Klebsiella aerogenes
Q0I656 0.0 667 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9311)
A0L6F2 0.0 667 57 3 568 3 ureC Urease subunit alpha Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B1ZP06 0.0 667 57 5 588 3 ureC Urease subunit alpha Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q473Q9 0.0 667 58 4 575 3 ureC Urease subunit alpha Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4KJ10 0.0 666 57 3 569 3 ureC Urease subunit alpha Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5LSQ2 0.0 666 56 4 572 3 ureC Urease subunit alpha Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A7HHN1 0.0 666 57 2 569 3 ureC Urease subunit alpha Anaeromyxobacter sp. (strain Fw109-5)
Q6N3N3 0.0 665 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A4XMA9 0.0 665 55 3 567 3 ureC Urease subunit alpha Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q3IH68 0.0 664 57 4 570 3 ureC Urease subunit alpha Pseudoalteromonas translucida (strain TAC 125)
Q3AGD0 0.0 664 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9605)
Q46IY3 0.0 664 57 4 572 3 ureC Urease subunit alpha Prochlorococcus marinus (strain NATL2A)
Q3J770 0.0 664 57 3 569 3 ureC Urease subunit alpha Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6FD83 0.0 664 58 3 569 3 ureC Urease subunit alpha Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7U3I3 0.0 663 58 4 572 3 ureC Urease subunit alpha Parasynechococcus marenigrum (strain WH8102)
P73061 0.0 662 58 3 569 3 ureC Urease subunit alpha Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2C4S2 0.0 662 57 4 572 3 ureC Urease subunit alpha Prochlorococcus marinus (strain NATL1A)
Q133L6 0.0 661 56 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisB5)
B2IT66 0.0 661 57 6 576 3 ureC Urease subunit alpha Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q5FB23 0.0 660 55 3 571 3 ureB Urease subunit beta Campylobacter lari
Q3M712 0.0 660 57 5 572 3 ureC Urease subunit alpha Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQZ0 0.0 660 57 5 572 3 ureC Urease subunit alpha Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A4WEJ5 0.0 660 57 3 571 3 ureC Urease subunit alpha Enterobacter sp. (strain 638)
Q2SDQ1 0.0 659 57 3 571 3 ureC Urease subunit alpha Hahella chejuensis (strain KCTC 2396)
Q492E9 0.0 659 57 4 569 3 ureC Urease subunit alpha Blochmanniella pennsylvanica (strain BPEN)
Q79VJ3 0.0 659 56 2 569 1 ureC Urease subunit alpha Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4SY44 0.0 658 57 3 571 3 ureC Urease subunit alpha Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q3AVR1 0.0 657 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9902)
Q2IZ49 0.0 657 56 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain HaA2)
A1KBB4 0.0 657 60 4 572 3 ureC Urease subunit alpha Azoarcus sp. (strain BH72)
Q8DMV6 0.0 656 58 4 572 3 ureC Urease subunit alpha Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O87402 0.0 656 57 4 572 1 ureC Urease subunit alpha Synechococcus sp. (strain WH7805)
B2UW70 0.0 656 57 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain Shi470)
A8APV0 0.0 655 57 3 571 3 ureC Urease subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9SR52 0.0 655 56 2 568 1 URE Urease Arabidopsis thaliana
Q161S8 0.0 655 56 4 572 3 ureC Urease subunit alpha Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P69996 0.0 655 56 2 569 1 ureB Urease subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
P69997 0.0 655 56 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
B5Z674 0.0 655 56 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain G27)
B6JPH5 0.0 655 56 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain P12)
B0JKA1 0.0 654 56 3 569 3 ureC Urease subunit alpha Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A1SYY1 0.0 653 56 3 571 3 ureC Urease subunit alpha Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1U4Z8 0.0 653 58 4 570 3 ureC Urease subunit alpha Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A8LRS0 0.0 653 55 4 572 3 ureC Urease subunit alpha Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A6VTV8 0.0 652 57 4 570 3 ureC Urease subunit alpha Marinomonas sp. (strain MWYL1)
Q1CV82 0.0 651 56 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain HPAG1)
B2IIJ1 0.0 651 57 4 569 3 ureC Urease subunit alpha Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1H0F2 0.0 651 56 4 569 3 ureC Urease subunit alpha Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4WR75 0.0 651 57 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q0VKY1 0.0 650 58 3 571 3 ureC Urease subunit alpha Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C5CY00 0.0 649 58 5 575 3 ureC Urease subunit alpha Variovorax paradoxus (strain S110)
Q8XXT1 0.0 649 57 5 573 3 ureC Urease subunit alpha Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3J154 0.0 649 57 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q826R9 0.0 649 55 4 575 3 ureC2 Urease subunit alpha 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q21P94 0.0 648 57 5 572 3 ureC Urease subunit alpha Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7V3V2 0.0 648 57 4 574 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9313)
A3PL38 0.0 648 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A2CE01 0.0 647 56 4 574 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9303)
B9KK46 0.0 647 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain KD131 / KCTC 12085)
C4LF63 0.0 647 56 3 571 3 ureC Urease subunit alpha Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1GJP8 0.0 647 55 5 573 3 ureC Urease subunit alpha Ruegeria sp. (strain TM1040)
Q28RJ3 0.0 645 54 4 572 3 ureC Urease subunit alpha Jannaschia sp. (strain CCS1)
Q9FCD3 0.0 645 54 4 575 3 ureC1 Urease subunit alpha 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q11VN3 0.0 644 58 4 567 3 ureC Urease subunit alpha Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
P50047 0.0 644 54 4 571 1 ureC Urease subunit alpha Streptococcus salivarius (strain 57.I)
Q9HUU5 0.0 644 57 3 569 3 ureC Urease subunit alpha Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31B49 0.0 644 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9312)
Q117Z3 0.0 644 56 4 570 3 ureC Urease subunit alpha Trichodesmium erythraeum (strain IMS101)
Q93PJ4 0.0 644 56 2 569 2 ureB Urease subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q1QC36 0.0 643 53 5 600 3 ureC2 Urease subunit alpha 2 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q03ME3 0.0 643 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M607 0.0 642 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1G6 0.0 642 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain CNRZ 1066)
B1J815 0.0 642 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain W619)
P94669 0.0 641 56 4 571 3 ureC Urease subunit alpha Clostridium perfringens
A2BQW8 0.0 639 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain AS9601)
A1VKW3 0.0 639 55 5 575 3 ureC Urease subunit alpha Polaromonas naphthalenivorans (strain CJ2)
A5GWV7 0.0 639 57 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain RCC307)
A9GP84 0.0 639 55 2 566 3 ureC Urease subunit alpha Sorangium cellulosum (strain So ce56)
Q1IBP0 0.0 639 56 3 571 3 ureC Urease subunit alpha Pseudomonas entomophila (strain L48)
B1Y3V1 0.0 639 55 4 577 3 ureC Urease subunit alpha Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q0RQS0 0.0 639 54 4 577 3 ureC Urease subunit alpha Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q4A0J5 0.0 637 52 3 570 1 ureC Urease subunit alpha Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A3PCP1 0.0 637 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9301)
E6Y5X0 0.0 637 55 2 568 1 JBURE-II Urease 2 Canavalia ensiformis
B7K912 0.0 636 57 5 584 3 ureC Urease subunit alpha Gloeothece citriformis (strain PCC 7424)
A1TSZ6 0.0 635 55 4 575 3 ureC Urease subunit alpha Paracidovorax citrulli (strain AAC00-1)
B9DLY0 0.0 635 54 3 570 3 ureC Urease subunit alpha Staphylococcus carnosus (strain TM300)
Q88J04 0.0 635 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B1VHT2 0.0 635 56 3 570 3 ureC Urease subunit alpha Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B9GCH9 0.0 634 55 4 576 3 Os12g0234800 Urease Oryza sativa subsp. japonica
E0ZS48 0.0 634 55 4 575 1 None Urease Oryza sativa subsp. indica
A8L7B0 0.0 634 55 5 577 3 ureC Urease subunit alpha Parafrankia sp. (strain EAN1pec)
B0KUZ7 0.0 634 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain GB-1)
Q2JES6 0.0 632 54 4 577 3 ureC Urease subunit alpha Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q6GEE4 0.0 632 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MRSA252)
A8G4K9 0.0 631 54 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9215)
A5W4B6 0.0 630 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1T9N4 0.0 630 54 4 575 3 ureC Urease subunit alpha Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P0CB00 0.0 629 52 6 601 1 ureC Urease subunit alpha Ureaplasma urealyticum
B5ZBS9 0.0 629 52 6 601 3 ureC Urease subunit alpha Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
P42873 0.0 629 52 3 570 1 ureC Urease subunit alpha Staphylococcus xylosus
Q8CNC9 0.0 629 52 3 570 3 ureC Urease subunit alpha Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLW1 0.0 629 52 3 570 3 ureC Urease subunit alpha Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P67405 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MW2)
A8Z387 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain USA300 / TCH1516)
Q6G732 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MSSA476)
P67404 0.0 629 53 3 570 1 ureC Urease subunit alpha Staphylococcus aureus (strain N315)
P67403 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJD0 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Newman)
Q5HDR8 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain COL)
A5IV71 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain JH9)
Q2G2K5 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEK3 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain USA300)
A6U414 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain JH1)
A7X5M3 0.0 629 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YYQ6 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain bovine RF122 / ET3-1)
P26929 0.0 626 52 4 571 3 ureC Urease subunit alpha Limosilactobacillus fermentum
Q7VRS6 0.0 626 55 3 571 3 ureC Urease subunit alpha Blochmanniella floridana
Q1B872 0.0 625 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain MCS)
A1UGT5 0.0 625 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain KMS)
A3Q0D5 0.0 625 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain JLS)
B0TT71 0.0 624 54 3 571 3 ureC Urease subunit alpha Shewanella halifaxensis (strain HAW-EB4)
A8ESZ8 0.0 624 56 3 569 3 ureB Urease subunit beta Aliarcobacter butzleri (strain RM4018)
Q9L644 0.0 622 55 3 569 1 ureC Urease subunit alpha Prochlorococcus marinus subsp. pastoris (strain PCC 9511)
Q7V1B6 0.0 622 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q12DU3 0.0 622 54 5 575 3 ureC Urease subunit alpha Polaromonas sp. (strain JS666 / ATCC BAA-500)
B6YQL8 0.0 619 54 5 570 3 ureC Urease subunit alpha Azobacteroides pseudotrichonymphae genomovar. CFP2
P0C7K7 0.0 618 50 6 601 3 ureC Urease subunit alpha Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ73 0.0 618 50 6 601 3 ureC Urease subunit alpha Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A2SDJ0 0.0 617 55 5 577 3 ureC Urease subunit alpha Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q5YWR8 0.0 616 54 4 575 3 ureC Urease subunit alpha Nocardia farcinica (strain IFM 10152)
Q7VUD3 0.0 616 53 4 575 3 ureC Urease subunit alpha Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O08400 0.0 615 53 4 575 3 ureC Urease subunit alpha Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6A3P9 0.0 615 54 4 568 2 ure1 Urease Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1WIM3 0.0 615 53 6 593 3 ureC Urease subunit alpha Verminephrobacter eiseniae (strain EF01-2)
A1B1B9 0.0 614 54 6 568 3 ureC Urease subunit alpha Paracoccus denitrificans (strain Pd 1222)
Q0S4S7 0.0 614 55 4 575 3 ureC Urease subunit alpha Rhodococcus jostii (strain RHA1)
B1MB85 0.0 614 55 4 578 3 ureC Urease subunit alpha Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A0QYE0 0.0 613 54 4 578 3 ureC Urease subunit alpha Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7W417 0.0 613 53 4 575 3 ureC Urease subunit alpha Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P07374 0.0 610 54 2 568 1 None Urease Canavalia ensiformis
B2HSZ2 0.0 609 54 4 578 3 ureC Urease subunit alpha Mycobacterium marinum (strain ATCC BAA-535 / M)
C1AXZ2 0.0 608 55 4 575 3 ureC Urease subunit alpha Rhodococcus opacus (strain B4)
P9WFF1 0.0 608 54 4 578 1 ureC Urease subunit alpha Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFF0 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U3L7 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1APC7 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJR2 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A661 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0PSG2 0.0 608 54 4 578 3 ureC Urease subunit alpha Mycobacterium ulcerans (strain Agy99)
O00084 0.0 607 54 4 569 1 ure1 Urease Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CS22 0.0 605 51 2 568 3 CNH01900 Urease Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CS23 0.0 605 51 2 568 3 CNBL1900 Urease Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
O13465 0.0 600 51 2 568 1 URE1 Urease Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q21SZ2 0.0 600 53 6 584 3 ureC Urease subunit alpha Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q75ZQ5 0.0 597 53 4 570 3 ureC Urease subunit alpha Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q972W0 0.0 593 53 8 570 3 ureC Urease subunit alpha Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4ZUD2 0.0 592 51 3 573 3 ureC1 Urease subunit alpha 1 Pseudomonas syringae pv. syringae (strain B728a)
Q18EB9 0.0 583 53 3 569 3 ureC Urease subunit alpha Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q3IRZ5 0.0 573 52 3 570 3 ureC Urease subunit alpha Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q82JN9 8.69e-169 493 45 7 564 3 ureC1 Urease subunit alpha 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O86508 2.78e-164 482 44 6 564 3 ureC2 Urease subunit alpha 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P50045 7.85e-113 341 57 2 309 3 ureB Urease subunit beta (Fragment) Helicobacter mustelae
P50046 4.21e-47 165 52 1 156 3 ureC Urease subunit alpha (Fragment) Photobacterium damselae subsp. damselae
Q03284 6.5e-06 46 60 0 30 2 ureC Urease subunit alpha (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_07220
Feature type CDS
Gene ureC
Product urease subunit alpha
Location 43665 - 45383 (strand: 1)
Length 1719 (nucleotides) / 572 (amino acids)

Contig

Accession ZDB_684
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1160
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00449 Urease alpha-subunit, N-terminal domain
PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0804 Amino acid transport and metabolism (E) E Urease alpha subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MPQISRQEYCGLFGPTTGDKIRLGDTDLYIEIEKDLRGYGEESVYGGGKSLRDGMGANNTLTSDNGVLDLVITNVTILDAKLGVIKADVGVKDGKIVGIGKSGNPNLQDGITPGMVAGVATDAISGEHLILTAAGIDTHIHLISPQQAYAALSNGVTTFFGGGIGPTDGTNGTTVTAGPWNIRAMLRSLEGLPVNVGMLGKGNSFARDPLVEQIIAGVAGLKVHEDWGATSNALRHALRVADDYDIQVSVHTDSLNEGGYVEDTIEAFEGRTIHTYHTEGAGGGHAPDIIKVVSQPNVLPSSTNPTLPYGINSQAELFDMIMVCHNLNPNVPADVSFAESRVRPETIAAENVLHDMGAISMFSSDSQAMGRVGENWLRVIQTANAMKAARGKLPEDAAGNDNFRVLRYVAKITINPAIAQGISHVLGSVEVGKMADLVLWDPRFFGAKPKLVIKGGMINWAAMGDPNASLPTPQPVFYRPMFGAMGKTLQDTCVTFVSQAALEDGVKEKAGLEREVVAVQGMRTTTKRDLVRNGETPDIEVDPETFAVKVNGEHATCQPISVAAMNQRYFFG

Flanking regions ( +/- flanking 50bp)

ATTTTCCGGCAGTGATGCACAGGCATCCTGAACGAAATAAGGAACACGTTATGCCACAGATTTCCAGACAAGAATATTGCGGCCTGTTCGGGCCGACCACCGGAGACAAAATCCGTCTTGGTGATACCGATCTCTATATCGAAATTGAAAAAGACTTACGCGGTTACGGCGAAGAATCTGTTTACGGCGGCGGGAAATCCCTCCGTGACGGGATGGGCGCGAACAACACGCTGACCAGCGACAACGGCGTGCTCGACCTGGTTATCACCAACGTCACTATCCTGGATGCCAAATTAGGCGTCATCAAAGCGGACGTGGGTGTGAAGGACGGTAAAATTGTCGGTATCGGCAAGAGCGGTAACCCGAACCTGCAGGACGGTATCACCCCGGGAATGGTCGCCGGTGTGGCCACCGATGCTATCTCCGGTGAGCATCTGATCCTGACAGCGGCGGGTATCGATACCCACATTCACCTGATCTCACCACAGCAGGCTTATGCGGCGCTGTCCAACGGTGTCACCACCTTCTTCGGCGGCGGTATCGGGCCGACAGACGGCACCAACGGGACAACGGTTACCGCCGGTCCGTGGAACATCCGCGCGATGCTGCGTTCACTGGAAGGTTTACCGGTTAACGTCGGTATGCTCGGGAAAGGTAACTCTTTTGCCCGCGATCCGCTGGTTGAACAGATCATTGCCGGTGTTGCCGGTCTGAAAGTTCACGAAGACTGGGGTGCAACCTCCAACGCCCTGCGTCATGCGCTGCGTGTGGCGGATGATTATGATATTCAGGTTTCTGTCCATACCGACAGCCTGAACGAAGGCGGTTATGTGGAAGATACCATCGAAGCCTTTGAAGGCCGTACTATCCACACTTACCACACCGAGGGTGCGGGCGGCGGTCACGCGCCGGACATCATCAAAGTGGTCAGCCAGCCGAACGTGCTGCCGAGCTCCACTAACCCGACACTGCCGTACGGTATCAACAGCCAGGCAGAACTGTTCGACATGATCATGGTGTGTCACAACCTGAACCCGAATGTCCCGGCTGACGTTTCCTTCGCGGAAAGCCGCGTGCGTCCGGAAACCATCGCAGCGGAAAACGTGCTGCATGATATGGGTGCTATCTCCATGTTCTCCAGTGACTCCCAGGCGATGGGCCGTGTCGGTGAGAACTGGCTGCGTGTGATCCAGACTGCTAACGCCATGAAAGCGGCGCGCGGCAAACTGCCGGAAGATGCGGCGGGTAACGATAACTTCCGTGTTCTGCGTTACGTGGCAAAAATCACCATCAACCCGGCGATTGCCCAGGGTATCAGCCATGTGCTCGGCTCAGTCGAAGTCGGCAAAATGGCGGACCTGGTCCTGTGGGATCCGCGTTTCTTCGGCGCGAAACCAAAACTGGTTATCAAAGGCGGCATGATCAACTGGGCAGCGATGGGTGACCCTAACGCCTCCCTGCCGACTCCGCAGCCGGTCTTCTATCGTCCGATGTTTGGTGCGATGGGTAAAACCCTGCAGGATACCTGTGTGACTTTCGTTTCCCAGGCAGCACTGGAAGATGGTGTGAAAGAGAAAGCCGGTCTGGAGCGCGAAGTTGTCGCGGTTCAGGGCATGCGCACCACCACCAAACGCGACCTGGTCCGTAACGGCGAAACCCCGGATATCGAAGTGGATCCGGAAACCTTCGCGGTGAAAGTTAACGGGGAACACGCGACCTGCCAGCCAATCTCGGTGGCGGCGATGAACCAGCGTTATTTCTTCGGCTGATTGACTTCCCCGGCGGGTGTTGTTCTGCCCGCCGGGCATAACAAAAAGGT