Homologs in group_1160

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06655 FBDBKF_06655 97.7 Morganella morganii S1 ureC urease subunit alpha
EHELCC_09700 EHELCC_09700 97.7 Morganella morganii S2 ureC urease subunit alpha
NLDBIP_10080 NLDBIP_10080 97.7 Morganella morganii S4 ureC urease subunit alpha
LHKJJB_07670 LHKJJB_07670 97.7 Morganella morganii S3 ureC urease subunit alpha
HKOGLL_07220 HKOGLL_07220 97.7 Morganella morganii S5 ureC urease subunit alpha
PMI_RS18335 PMI_RS18335 56.6 Proteus mirabilis HI4320 ureC urease subunit alpha

Distribution of the homologs in the orthogroup group_1160

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1160

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31494 0.0 1065 88 0 572 3 ureC Urease subunit alpha Yersinia enterocolitica
A1JKD9 0.0 1065 88 0 572 3 ureC Urease subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JR71 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P52313 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TL32 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pestis (strain Pestoides F)
Q1CKJ9 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3V0 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Angola)
Q9ZFR9 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pestis
B2KAA4 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5B3 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFN2 0.0 1062 88 0 572 3 ureC Urease subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BBR6 0.0 1011 83 0 572 3 ureC Urease subunit alpha Edwardsiella ictaluri (strain 93-146)
Q7N4Y7 0.0 999 83 1 571 3 ureC Urease subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C1D5Z8 0.0 868 71 0 571 3 ureC Urease subunit alpha Laribacter hongkongensis (strain HLHK9)
Q8YHZ8 0.0 839 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57CE8 0.0 838 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella abortus biovar 1 (strain 9-941)
Q2YQD8 0.0 838 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella abortus (strain 2308)
Q8FZW2 0.0 835 68 1 572 3 ureC2 Urease subunit alpha 2 Brucella suis biovar 1 (strain 1330)
Q2JQ88 0.0 729 60 1 569 3 ureC Urease subunit alpha Synechococcus sp. (strain JA-2-3B'a(2-13))
A5FAD1 0.0 729 60 2 570 3 ureC Urease subunit alpha Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B0BRU2 0.0 723 59 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2L3 0.0 723 59 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2R4 0.0 723 59 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae serotype 5b (strain L20)
O54420 0.0 717 58 2 569 3 ureC Urease subunit alpha Actinobacillus pleuropneumoniae
A3DGF8 0.0 716 59 1 569 3 ureC Urease subunit alpha Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A5U9V6 0.0 711 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain PittEE)
Q4QN09 0.0 711 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain 86-028NP)
P44391 0.0 709 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1R1C5 0.0 708 60 3 575 3 ureC Urease subunit alpha Paenarthrobacter aurescens (strain TC1)
A5UH45 0.0 707 59 2 569 3 ureC Urease subunit alpha Haemophilus influenzae (strain PittGG)
Q9KG59 0.0 707 60 2 570 3 ureC Urease subunit alpha Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8HA07 0.0 706 59 3 584 3 ureC Urease subunit alpha Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A0JRH4 0.0 704 58 3 575 3 ureC Urease subunit alpha Arthrobacter sp. (strain FB24)
P77837 0.0 701 57 2 569 1 ureC Urease subunit alpha Bacillus subtilis (strain 168)
Q733J6 0.0 700 57 2 569 3 ureC Urease subunit alpha Bacillus cereus (strain ATCC 10987 / NRS 248)
A7Z9N4 0.0 698 57 2 569 3 ureC Urease subunit alpha Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P41020 0.0 693 57 3 570 1 ureC Urease subunit alpha Sporosarcina pasteurii
Q07397 0.0 693 59 3 568 1 ureC Urease subunit alpha Bacillus sp. (strain TB-90)
B5YUX3 0.0 692 59 3 571 3 ureC Urease subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAG0 0.0 692 59 3 571 3 ureC1 Urease subunit alpha Escherichia coli O157:H7
Q87VP0 0.0 689 59 3 569 3 ureC Urease subunit alpha Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZN06 0.0 688 59 3 569 3 ureC2 Urease subunit alpha 2 Pseudomonas syringae pv. syringae (strain B728a)
B3PXB3 0.0 688 57 5 573 3 ureC Urease subunit alpha Rhizobium etli (strain CIAT 652)
Q48DE6 0.0 687 58 3 569 3 ureC Urease subunit alpha Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9RYJ4 0.0 687 60 4 570 3 ureC Urease subunit alpha Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B5ZMP0 0.0 687 57 5 573 3 ureC Urease subunit alpha Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q47G55 0.0 687 59 3 569 3 ureC Urease subunit alpha Dechloromonas aromatica (strain RCB)
Q11EW4 0.0 687 57 5 573 3 ureC Urease subunit alpha Chelativorans sp. (strain BNC1)
B4UFU2 0.0 686 58 2 568 3 ureC Urease subunit alpha Anaeromyxobacter sp. (strain K)
Q93T81 0.0 686 57 5 573 3 ureC1 Urease subunit alpha 1 Brucella abortus biovar 1 (strain 9-941)
Q2YPD5 0.0 686 57 5 573 1 ureC1 Urease subunit alpha 1 Brucella abortus (strain 2308)
Q2K517 0.0 686 57 5 573 3 ureC Urease subunit alpha Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
C5C8U3 0.0 685 58 3 570 3 ureC Urease subunit alpha Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A9KJR9 0.0 684 57 2 568 3 ureC Urease subunit alpha Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q1MCV9 0.0 683 57 5 573 3 ureC Urease subunit alpha Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A9AZE6 0.0 683 58 2 568 3 ureC Urease subunit alpha Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8G2P8 0.0 683 57 5 573 1 ureC1 Urease subunit alpha 1 Brucella suis biovar 1 (strain 1330)
Q0BHN5 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4ECC7 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8YF72 0.0 682 57 5 573 3 ureC1 Urease subunit alpha 1 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P17086 0.0 682 56 3 571 1 ureC Urease subunit alpha Proteus mirabilis (strain HI4320)
B2GI06 0.0 682 58 3 570 3 ureC Urease subunit alpha Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q39IW3 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B8EPU9 0.0 682 57 5 573 3 ureC Urease subunit alpha Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q1BYH2 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia orbicola (strain AU 1054)
B1JX29 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia orbicola (strain MC0-3)
A0K576 0.0 682 58 3 569 3 ureC Urease subunit alpha Burkholderia cenocepacia (strain HI2424)
Q8UCT2 0.0 682 58 6 573 3 ureC Urease subunit alpha Agrobacterium fabrum (strain C58 / ATCC 33970)
A4JC42 0.0 681 58 3 569 3 ureC Urease subunit alpha Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q98CY9 0.0 681 56 3 572 3 ureC Urease subunit alpha Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2SYF7 0.0 681 59 3 568 3 ureC Urease subunit alpha Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6UC35 0.0 681 57 4 570 3 ureC Urease subunit alpha Sinorhizobium medicae (strain WSM419)
B9J8M3 0.0 680 57 5 570 3 ureC Urease subunit alpha Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q1QCE0 0.0 680 58 5 570 3 ureC1 Urease subunit alpha 1 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A9AF72 0.0 679 58 3 569 3 ureC Urease subunit alpha Burkholderia multivorans (strain ATCC 17616 / 249)
Q5KYM1 0.0 679 58 3 568 3 ureC Urease subunit alpha Geobacillus kaustophilus (strain HTA426)
Q2JWP0 0.0 678 59 4 570 3 ureC Urease subunit alpha Synechococcus sp. (strain JA-3-3Ab)
B1YUF9 0.0 677 58 3 569 3 ureC Urease subunit alpha Burkholderia ambifaria (strain MC40-6)
P16122 0.0 677 55 3 571 3 ureC Urease subunit alpha Proteus hauseri
P42885 0.0 676 56 4 570 3 ureC Urease subunit alpha Rhizobium meliloti (strain 1021)
A6SZ07 0.0 676 58 4 571 3 ureC Urease subunit alpha Janthinobacterium sp. (strain Marseille)
Q210F9 0.0 676 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisB18)
P42823 0.0 676 56 3 569 3 ureB Urease subunit beta Helicobacter heilmannii
A9BUC4 0.0 676 59 3 571 3 ureC Urease subunit alpha Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8FQX2 0.0 676 57 3 573 3 ureC Urease subunit alpha Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A3NYC9 0.0 676 58 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 1106a)
Q63RL3 0.0 676 58 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain K96243)
A3NCL7 0.0 675 58 3 569 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 668)
Q3KIT2 0.0 674 57 3 569 3 ureC Urease subunit alpha Pseudomonas fluorescens (strain Pf0-1)
P08298 0.0 674 58 3 568 2 EU4 Urease Glycine max
Q07K73 0.0 674 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisA53)
A1V1G6 0.0 674 58 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain SAVP1)
Q62HS0 0.0 674 58 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain ATCC 23344)
A2S996 0.0 674 58 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain NCTC 10229)
A3MMV2 0.0 674 58 3 569 3 ureC Urease subunit alpha Burkholderia mallei (strain NCTC 10247)
B5FBC6 0.0 674 55 3 571 3 ureC Urease subunit alpha Aliivibrio fischeri (strain MJ11)
Q0KCP6 0.0 673 59 4 575 3 ureC Urease subunit alpha Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3JPJ6 0.0 673 58 3 568 3 ureC Urease subunit alpha Burkholderia pseudomallei (strain 1710b)
B5XU27 0.0 673 59 3 571 3 ureC Urease subunit alpha Klebsiella pneumoniae (strain 342)
Q5E728 0.0 673 55 3 571 3 ureC Urease subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4KJ10 0.0 672 58 3 569 3 ureC Urease subunit alpha Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q89UG0 0.0 672 57 5 571 3 ureC Urease subunit alpha Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
C5BUN9 0.0 672 58 3 571 3 ureC Urease subunit alpha Teredinibacter turnerae (strain ATCC 39867 / T7901)
B1ZP06 0.0 672 57 5 588 3 ureC Urease subunit alpha Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B9JR81 0.0 672 56 5 573 3 ureC Urease subunit alpha Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
C3MGI5 0.0 671 56 4 570 3 ureC Urease subunit alpha Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A6TE42 0.0 671 59 3 571 3 ureC Urease subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P18314 0.0 671 59 3 571 1 ureC Urease subunit alpha Klebsiella aerogenes
A0L6F2 0.0 671 57 3 568 3 ureC Urease subunit alpha Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q08716 0.0 670 56 2 569 1 ureB Urease subunit beta Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
B4RSX9 0.0 670 57 3 569 3 ureC Urease subunit alpha Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4XMA9 0.0 669 55 3 567 3 ureC Urease subunit alpha Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q3AGD0 0.0 669 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9605)
Q2Y9M7 0.0 668 58 3 569 3 ureC Urease subunit alpha Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B8HW50 0.0 667 56 3 568 3 ureC Urease subunit alpha Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q473Q9 0.0 667 58 4 575 3 ureC Urease subunit alpha Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7U3I3 0.0 667 58 4 572 3 ureC Urease subunit alpha Parasynechococcus marenigrum (strain WH8102)
Q5FB23 0.0 667 55 3 571 3 ureB Urease subunit beta Campylobacter lari
A7HHN1 0.0 667 56 2 569 3 ureC Urease subunit alpha Anaeromyxobacter sp. (strain Fw109-5)
Q3J770 0.0 666 57 3 569 3 ureC Urease subunit alpha Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q3IH68 0.0 665 57 4 570 3 ureC Urease subunit alpha Pseudoalteromonas translucida (strain TAC 125)
Q0I656 0.0 665 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9311)
A4SY44 0.0 664 57 3 571 3 ureC Urease subunit alpha Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A4WEJ5 0.0 664 57 3 571 3 ureC Urease subunit alpha Enterobacter sp. (strain 638)
Q6FD83 0.0 664 57 3 569 3 ureC Urease subunit alpha Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q46IY3 0.0 663 57 4 572 3 ureC Urease subunit alpha Prochlorococcus marinus (strain NATL2A)
Q79VJ3 0.0 663 56 2 569 1 ureC Urease subunit alpha Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5LSQ2 0.0 663 56 4 572 3 ureC Urease subunit alpha Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B3QGK1 0.0 663 57 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain TIE-1)
A2C4S2 0.0 662 57 4 572 3 ureC Urease subunit alpha Prochlorococcus marinus (strain NATL1A)
B2UW70 0.0 661 57 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain Shi470)
O87402 0.0 661 58 4 572 1 ureC Urease subunit alpha Synechococcus sp. (strain WH7805)
Q492E9 0.0 661 57 4 569 3 ureC Urease subunit alpha Blochmanniella pennsylvanica (strain BPEN)
Q6N3N3 0.0 660 56 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B5Z674 0.0 660 57 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain G27)
B6JPH5 0.0 660 57 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain P12)
P69996 0.0 659 57 2 569 1 ureB Urease subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
P69997 0.0 659 57 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
A1KBB4 0.0 659 60 4 572 3 ureC Urease subunit alpha Azoarcus sp. (strain BH72)
Q3AVR1 0.0 659 58 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain CC9902)
Q3M712 0.0 658 57 5 572 3 ureC Urease subunit alpha Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A1SYY1 0.0 658 57 3 569 3 ureC Urease subunit alpha Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8YQZ0 0.0 658 57 5 572 3 ureC Urease subunit alpha Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P73061 0.0 658 57 3 569 3 ureC Urease subunit alpha Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q133L6 0.0 658 56 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain BisB5)
Q2SDQ1 0.0 658 57 3 571 3 ureC Urease subunit alpha Hahella chejuensis (strain KCTC 2396)
A8LRS0 0.0 658 56 4 572 3 ureC Urease subunit alpha Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q0VKY1 0.0 658 58 3 571 3 ureC Urease subunit alpha Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A8APV0 0.0 657 57 3 571 3 ureC Urease subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q161S8 0.0 657 56 4 572 3 ureC Urease subunit alpha Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B2IT66 0.0 656 57 6 576 3 ureC Urease subunit alpha Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1CV82 0.0 656 56 2 569 3 ureB Urease subunit beta Helicobacter pylori (strain HPAG1)
Q8DMV6 0.0 654 57 4 572 3 ureC Urease subunit alpha Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9SR52 0.0 654 56 2 568 1 URE Urease Arabidopsis thaliana
Q21P94 0.0 654 57 5 572 3 ureC Urease subunit alpha Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C4LF63 0.0 653 57 3 571 3 ureC Urease subunit alpha Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A1U4Z8 0.0 653 58 4 570 3 ureC Urease subunit alpha Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2IZ49 0.0 653 55 4 570 3 ureC Urease subunit alpha Rhodopseudomonas palustris (strain HaA2)
A6VTV8 0.0 653 57 4 570 3 ureC Urease subunit alpha Marinomonas sp. (strain MWYL1)
B2IIJ1 0.0 652 57 4 569 3 ureC Urease subunit alpha Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B0JKA1 0.0 651 55 3 569 3 ureC Urease subunit alpha Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q1H0F2 0.0 651 56 4 569 3 ureC Urease subunit alpha Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q93PJ4 0.0 649 56 2 569 2 ureB Urease subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A4WR75 0.0 649 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q3J154 0.0 648 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q826R9 0.0 648 55 4 575 3 ureC2 Urease subunit alpha 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8XXT1 0.0 648 57 5 573 3 ureC Urease subunit alpha Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1J815 0.0 648 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain W619)
Q31B49 0.0 648 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9312)
P50047 0.0 647 54 4 571 1 ureC Urease subunit alpha Streptococcus salivarius (strain 57.I)
A9GP84 0.0 647 55 2 566 3 ureC Urease subunit alpha Sorangium cellulosum (strain So ce56)
Q9HUU5 0.0 647 56 3 569 3 ureC Urease subunit alpha Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A3PL38 0.0 647 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q11VN3 0.0 646 57 4 567 3 ureC Urease subunit alpha Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q03ME3 0.0 646 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M607 0.0 646 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1G6 0.0 646 54 4 571 3 ureC Urease subunit alpha Streptococcus thermophilus (strain CNRZ 1066)
B9KK46 0.0 646 56 5 572 3 ureC Urease subunit alpha Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q7V3V2 0.0 645 56 4 574 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9313)
Q28RJ3 0.0 645 54 4 572 3 ureC Urease subunit alpha Jannaschia sp. (strain CCS1)
C5CY00 0.0 645 57 5 575 3 ureC Urease subunit alpha Variovorax paradoxus (strain S110)
Q1IBP0 0.0 645 56 3 571 3 ureC Urease subunit alpha Pseudomonas entomophila (strain L48)
Q1GJP8 0.0 644 55 5 573 3 ureC Urease subunit alpha Ruegeria sp. (strain TM1040)
Q9FCD3 0.0 644 54 4 575 3 ureC1 Urease subunit alpha 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A2CE01 0.0 644 56 4 574 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9303)
A3PCP1 0.0 642 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9301)
Q1QC36 0.0 642 53 5 600 3 ureC2 Urease subunit alpha 2 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A2BQW8 0.0 642 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain AS9601)
Q117Z3 0.0 641 56 4 570 3 ureC Urease subunit alpha Trichodesmium erythraeum (strain IMS101)
E6Y5X0 0.0 639 55 2 568 1 JBURE-II Urease 2 Canavalia ensiformis
Q88J04 0.0 639 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KUZ7 0.0 639 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain GB-1)
P94669 0.0 639 56 4 571 3 ureC Urease subunit alpha Clostridium perfringens
A1VKW3 0.0 638 55 5 575 3 ureC Urease subunit alpha Polaromonas naphthalenivorans (strain CJ2)
A5GWV7 0.0 638 56 4 572 3 ureC Urease subunit alpha Synechococcus sp. (strain RCC307)
B1Y3V1 0.0 637 55 4 577 3 ureC Urease subunit alpha Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A8G4K9 0.0 636 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus (strain MIT 9215)
Q4A0J5 0.0 635 52 3 570 1 ureC Urease subunit alpha Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9DLY0 0.0 635 54 3 570 3 ureC Urease subunit alpha Staphylococcus carnosus (strain TM300)
A5W4B6 0.0 635 56 3 571 3 ureC Urease subunit alpha Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
E0ZS48 0.0 634 54 4 575 1 None Urease Oryza sativa subsp. indica
B9GCH9 0.0 634 54 4 576 3 Os12g0234800 Urease Oryza sativa subsp. japonica
A1TSZ6 0.0 633 55 4 575 3 ureC Urease subunit alpha Paracidovorax citrulli (strain AAC00-1)
Q0RQS0 0.0 632 54 4 577 3 ureC Urease subunit alpha Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
B1VHT2 0.0 632 56 3 570 3 ureC Urease subunit alpha Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q7VRS6 0.0 631 55 3 571 3 ureC Urease subunit alpha Blochmanniella floridana
Q6GEE4 0.0 630 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MRSA252)
B7K912 0.0 630 56 5 584 3 ureC Urease subunit alpha Gloeothece citriformis (strain PCC 7424)
Q1B872 0.0 629 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain MCS)
A1UGT5 0.0 629 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain KMS)
A3Q0D5 0.0 629 54 4 575 3 ureC Urease subunit alpha Mycobacterium sp. (strain JLS)
P0CB00 0.0 629 52 6 601 1 ureC Urease subunit alpha Ureaplasma urealyticum
B5ZBS9 0.0 629 52 6 601 3 ureC Urease subunit alpha Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A5IV71 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain JH9)
A6U414 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain JH1)
P67405 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MW2)
A8Z387 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain USA300 / TCH1516)
Q6G732 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain MSSA476)
P67404 0.0 627 53 3 570 1 ureC Urease subunit alpha Staphylococcus aureus (strain N315)
P67403 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJD0 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Newman)
Q5HDR8 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain COL)
Q2G2K5 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEK3 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain USA300)
A7X5M3 0.0 627 53 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8L7B0 0.0 627 54 5 577 3 ureC Urease subunit alpha Parafrankia sp. (strain EAN1pec)
P26929 0.0 626 53 4 571 3 ureC Urease subunit alpha Limosilactobacillus fermentum
Q8CNC9 0.0 626 52 3 570 3 ureC Urease subunit alpha Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLW1 0.0 626 52 3 570 3 ureC Urease subunit alpha Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9L644 0.0 626 55 3 569 1 ureC Urease subunit alpha Prochlorococcus marinus subsp. pastoris (strain PCC 9511)
Q7V1B6 0.0 626 55 3 569 3 ureC Urease subunit alpha Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P42873 0.0 625 51 3 570 1 ureC Urease subunit alpha Staphylococcus xylosus
Q2YYQ6 0.0 625 52 3 570 3 ureC Urease subunit alpha Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7VUD3 0.0 625 54 4 575 3 ureC Urease subunit alpha Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A8ESZ8 0.0 625 56 3 569 3 ureB Urease subunit beta Aliarcobacter butzleri (strain RM4018)
A1T9N4 0.0 624 53 4 575 3 ureC Urease subunit alpha Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q2JES6 0.0 624 54 4 577 3 ureC Urease subunit alpha Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
O08400 0.0 624 54 4 575 3 ureC Urease subunit alpha Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B0TT71 0.0 623 53 3 571 3 ureC Urease subunit alpha Shewanella halifaxensis (strain HAW-EB4)
Q6A3P9 0.0 623 54 4 568 2 ure1 Urease Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7W417 0.0 622 54 4 575 3 ureC Urease subunit alpha Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B6YQL8 0.0 621 54 5 570 3 ureC Urease subunit alpha Azobacteroides pseudotrichonymphae genomovar. CFP2
Q12DU3 0.0 620 54 5 575 3 ureC Urease subunit alpha Polaromonas sp. (strain JS666 / ATCC BAA-500)
A2SDJ0 0.0 620 55 5 577 3 ureC Urease subunit alpha Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P0C7K7 0.0 620 50 6 601 3 ureC Urease subunit alpha Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ73 0.0 620 50 6 601 3 ureC Urease subunit alpha Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q5YWR8 0.0 619 54 4 575 3 ureC Urease subunit alpha Nocardia farcinica (strain IFM 10152)
B1MB85 0.0 615 55 4 578 3 ureC Urease subunit alpha Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
P0CS22 0.0 614 52 2 568 3 CNH01900 Urease Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CS23 0.0 614 52 2 568 3 CNBL1900 Urease Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A1B1B9 0.0 613 54 6 568 3 ureC Urease subunit alpha Paracoccus denitrificans (strain Pd 1222)
A1WIM3 0.0 613 53 6 593 3 ureC Urease subunit alpha Verminephrobacter eiseniae (strain EF01-2)
Q0S4S7 0.0 613 55 4 575 3 ureC Urease subunit alpha Rhodococcus jostii (strain RHA1)
P07374 0.0 612 54 2 568 1 None Urease Canavalia ensiformis
P9WFF1 0.0 611 55 4 578 1 ureC Urease subunit alpha Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFF0 0.0 611 55 4 578 3 ureC Urease subunit alpha Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U3L7 0.0 611 55 4 578 3 ureC Urease subunit alpha Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A0QYE0 0.0 611 54 4 578 3 ureC Urease subunit alpha Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
C1APC7 0.0 611 55 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJR2 0.0 611 55 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A661 0.0 611 55 4 578 3 ureC Urease subunit alpha Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O13465 0.0 610 52 2 568 1 URE1 Urease Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
O00084 0.0 609 54 4 569 1 ure1 Urease Schizosaccharomyces pombe (strain 972 / ATCC 24843)
C1AXZ2 0.0 608 55 4 575 3 ureC Urease subunit alpha Rhodococcus opacus (strain B4)
B2HSZ2 0.0 607 53 4 578 3 ureC Urease subunit alpha Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PSG2 0.0 606 53 4 578 3 ureC Urease subunit alpha Mycobacterium ulcerans (strain Agy99)
Q21SZ2 0.0 602 53 6 584 3 ureC Urease subunit alpha Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q75ZQ5 0.0 598 53 4 570 3 ureC Urease subunit alpha Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q972W0 0.0 594 53 8 570 3 ureC Urease subunit alpha Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4ZUD2 0.0 591 51 3 573 3 ureC1 Urease subunit alpha 1 Pseudomonas syringae pv. syringae (strain B728a)
Q18EB9 0.0 584 53 3 569 3 ureC Urease subunit alpha Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q3IRZ5 0.0 574 52 3 570 3 ureC Urease subunit alpha Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q82JN9 2.12e-168 492 45 7 564 3 ureC1 Urease subunit alpha 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O86508 1.01e-163 481 44 6 564 3 ureC2 Urease subunit alpha 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P50045 3.53e-113 342 57 2 309 3 ureB Urease subunit beta (Fragment) Helicobacter mustelae
P50046 1.19e-46 164 51 1 156 3 ureC Urease subunit alpha (Fragment) Photobacterium damselae subsp. damselae
Q03284 6.07e-06 46 60 0 30 2 ureC Urease subunit alpha (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15280
Feature type CDS
Gene -
Product urease subunit alpha
Location 41279 - 42997 (strand: 1)
Length 1719 (nucleotides) / 572 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1160
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00449 Urease alpha-subunit, N-terminal domain
PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0804 Amino acid transport and metabolism (E) E Urease alpha subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MPQISRQEYCGLFGPTTGDKIRLGDTDLYIEIEKDLRGYGEESVYGGGKSLRDGMGANNTLTSDNGVLDLVITNVTIVDAKLGVIKADVGVKDGKIVGIGKSGNPNLQDGITPGMVAGVSTDAISGEHLILTAAGIDTHIHLISPQQAYAALSNGVTTFFGGGIGPTDGTNGTTVTAGPWNIRAMLRSLEGLPVNVGMLGKGNSFARDPLVEQIIAGVAGLKVHEDWGATSNSLRHALRVADDYDIQVSVHTDSLNEGGYVEDTIEAFEGRTIHTYHTEGAGGGHAPDIIKVVSQPNVLPSSTNPTLPYGVNSQAELFDMIMVCHNLNPNVPADVSFAESRVRPETIAAENVLHDMGAISMFSSDSQAMGRVGENWLRIVQTANAMKASRGKLPEDAAGNDNFRVLRYVAKITINPAIAQGISHVLGSIEVGKMADLVLWDPRFFGAKPKLVIKGGMINWAAMGDPNASLPTPQPVFYRPMFGAMGKTLQDTCVTFVSQAALDDGVKEKAGLERQVMAVQGCRTTTKRDLVRNGEMPDIEVDPETFAVKVNGEHATCQPISVAAMNQRYFFG

Flanking regions ( +/- flanking 50bp)

GATTTCCCGGCTGTGATGCGAAGGCATCCTGAATAGAAAAGGAACATGTTATGCCACAGATCTCCAGACAAGAATATTGCGGTCTGTTCGGACCGACCACAGGGGATAAAATCCGCCTGGGTGATACCGATCTCTATATCGAAATTGAAAAAGACTTACGCGGCTACGGCGAAGAATCTGTCTATGGCGGGGGAAAATCCCTGCGTGACGGGATGGGCGCAAACAACACCCTGACCAGTGACAATGGTGTACTCGATCTGGTTATCACTAACGTGACAATTGTTGATGCCAAATTAGGTGTTATCAAAGCAGACGTTGGTGTGAAAGACGGCAAAATCGTCGGTATCGGCAAGAGCGGAAACCCGAATCTCCAGGACGGTATTACCCCGGGCATGGTTGCCGGTGTATCGACAGATGCCATCTCCGGTGAGCATTTGATCCTGACGGCGGCGGGTATTGATACGCACATCCACCTGATTTCACCACAGCAGGCGTATGCAGCACTGTCCAACGGCGTCACCACCTTCTTCGGCGGTGGTATCGGGCCGACAGACGGCACCAACGGGACAACCGTTACCGCCGGGCCGTGGAATATCCGCGCCATGCTGCGTTCACTGGAAGGTCTGCCGGTCAACGTCGGGATGCTTGGTAAAGGTAACTCTTTTGCCCGTGATCCGCTGGTTGAGCAGATTATTGCCGGTGTTGCCGGTCTGAAAGTTCACGAAGACTGGGGTGCGACATCCAACTCGCTGCGCCATGCCCTGCGTGTAGCTGATGACTATGATATCCAGGTCTCCGTCCACACTGACAGCCTGAACGAAGGCGGCTATGTGGAAGATACCATTGAAGCCTTTGAAGGCCGTACTATCCACACTTACCACACTGAAGGCGCAGGCGGCGGTCACGCACCTGACATCATCAAAGTGGTCAGCCAGCCGAACGTGCTGCCGAGCTCAACGAACCCGACACTGCCGTACGGGGTCAACAGCCAGGCAGAATTGTTCGACATGATTATGGTCTGTCATAACCTGAACCCGAACGTGCCTGCGGATGTCTCTTTTGCCGAAAGCCGTGTGCGCCCGGAAACTATCGCTGCAGAAAACGTCCTGCACGATATGGGGGCAATCTCCATGTTCTCCAGTGACTCTCAGGCGATGGGGCGCGTTGGCGAAAACTGGCTGCGTATTGTCCAGACGGCAAATGCGATGAAAGCATCGCGCGGCAAACTGCCGGAAGATGCAGCGGGGAATGATAACTTCCGCGTACTGCGCTATGTGGCAAAAATTACTATCAACCCGGCGATCGCGCAGGGGATCAGTCATGTGCTCGGATCAATTGAAGTGGGCAAAATGGCGGATCTGGTGCTGTGGGATCCGCGTTTCTTTGGCGCCAAACCAAAACTGGTTATCAAAGGCGGCATGATCAACTGGGCGGCAATGGGTGATCCGAATGCGTCTCTGCCGACACCACAGCCGGTCTTCTATCGTCCGATGTTTGGTGCGATGGGTAAAACATTACAGGATACCTGTGTGACCTTTGTATCTCAGGCGGCGCTGGATGATGGTGTGAAAGAGAAAGCGGGTCTGGAGCGTCAGGTTATGGCGGTTCAGGGATGCCGGACAACCACTAAACGTGACCTGGTCCGTAACGGTGAAATGCCGGATATTGAAGTGGATCCGGAAACCTTCGCCGTGAAAGTGAACGGGGAGCATGCAACCTGTCAGCCGATTTCGGTGGCAGCGATGAACCAGCGTTATTTCTTTGGTTAACAACGTCCGGGTTAATAACGTCCGGGCTGATTGACACCCCGGCGGGCAGA