Homologs in group_823

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04130 FBDBKF_04130 100.0 Morganella morganii S1 gcvP aminomethyl-transferring glycine dehydrogenase
EHELCC_05420 EHELCC_05420 100.0 Morganella morganii S2 gcvP aminomethyl-transferring glycine dehydrogenase
NLDBIP_05740 NLDBIP_05740 100.0 Morganella morganii S4 gcvP aminomethyl-transferring glycine dehydrogenase
LHKJJB_02620 LHKJJB_02620 100.0 Morganella morganii S3 gcvP aminomethyl-transferring glycine dehydrogenase
F4V73_RS08575 F4V73_RS08575 93.0 Morganella psychrotolerans gcvP aminomethyl-transferring glycine dehydrogenase
PMI_RS09955 PMI_RS09955 76.8 Proteus mirabilis HI4320 gcvP aminomethyl-transferring glycine dehydrogenase

Distribution of the homologs in the orthogroup group_823

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_823

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F0N7 0.0 1514 76 0 957 3 gcvP Glycine dehydrogenase (decarboxylating) Proteus mirabilis (strain HI4320)
Q7N199 0.0 1508 77 0 957 3 gcvP Glycine dehydrogenase (decarboxylating) Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JPN3 0.0 1498 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JNS8 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q666R7 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIA7 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pestis (strain Pestoides F)
Q1CEZ9 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4K8 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pestis bv. Antiqua (strain Angola)
Q8ZHI8 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pestis
B2K0Q3 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CB42 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pestis bv. Antiqua (strain Antiqua)
A7FF21 0.0 1492 75 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8APB1 0.0 1489 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1LDA3 0.0 1487 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain SMS-3-5 / SECEC)
Q1R7C8 0.0 1486 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain UTI89 / UPEC)
B7MM89 0.0 1486 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FE67 0.0 1486 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MZ55 0.0 1486 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O81 (strain ED1a)
B7UHV1 0.0 1486 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32BW5 0.0 1485 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella dysenteriae serotype 1 (strain Sd197)
A1AF92 0.0 1485 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O1:K1 / APEC
B5XUD5 0.0 1484 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Klebsiella pneumoniae (strain 342)
B7NHW4 0.0 1484 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YQ95 0.0 1484 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XD33 0.0 1484 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O157:H7
Q0TDU9 0.0 1483 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A6TDR5 0.0 1483 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MR85 0.0 1483 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Cronobacter sakazakii (strain ATCC BAA-894)
B7N7E6 0.0 1482 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4WE55 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Enterobacter sp. (strain 638)
P33195 0.0 1481 76 2 958 1 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain K12)
B1XEJ0 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain K12 / DH10B)
C5A0H5 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain K12 / MC4100 / BW2952)
B6I736 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain SE11)
B1IT99 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A444 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O9:H4 (strain HS)
B7LF89 0.0 1481 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli (strain 55989 / EAEC)
B7LPB7 0.0 1479 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C6D8X1 0.0 1479 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q3YXW7 0.0 1478 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella sonnei (strain Ss046)
B2U0S0 0.0 1478 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LYG7 0.0 1478 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O8 (strain IAI1)
A7ZR12 0.0 1478 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31WG4 0.0 1477 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella boydii serotype 4 (strain Sb227)
Q8ZM76 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PY26 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella paratyphi C (strain RKS4594)
B5RE14 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXI0 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella enteritidis PT4 (strain P125109)
B5FUG6 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella dublin (strain CT_02021853)
B4TGX3 0.0 1477 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella heidelberg (strain SL476)
Q6D974 0.0 1477 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9N3N1 0.0 1476 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T548 0.0 1476 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella newport (strain SL254)
B5F5H7 0.0 1476 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella agona (strain SL483)
Q83QA2 0.0 1476 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella flexneri
Q0T0Z5 0.0 1476 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Shigella flexneri serotype 5b (strain 8401)
Q8Z3X0 0.0 1471 77 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella typhi
A8GIR9 0.0 1469 76 1 958 3 gcvP Glycine dehydrogenase (decarboxylating) Serratia proteamaculans (strain 568)
A9MRH2 0.0 1458 76 2 958 3 gcvP Glycine dehydrogenase (decarboxylating) Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q2NRF0 0.0 1425 74 3 958 3 gcvP Glycine dehydrogenase (decarboxylating) Sodalis glossinidius (strain morsitans)
C5BAT0 0.0 1414 72 2 959 3 gcvP Glycine dehydrogenase (decarboxylating) Edwardsiella ictaluri (strain 93-146)
A1S965 0.0 1295 67 4 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8FZK4 0.0 1293 66 5 960 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella sediminis (strain HAW-EB3)
A1RFY8 0.0 1287 67 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella sp. (strain W3-18-1)
A4YAD8 0.0 1287 67 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A8H7S9 0.0 1282 66 4 960 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8EIQ6 0.0 1280 66 4 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3QHI0 0.0 1279 65 5 960 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A0L103 0.0 1278 66 4 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella sp. (strain ANA-3)
A9L330 0.0 1278 66 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella baltica (strain OS195)
B8EB45 0.0 1277 66 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella baltica (strain OS223)
B1KG87 0.0 1276 66 5 955 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella woodyi (strain ATCC 51908 / MS32)
Q0HEX2 0.0 1276 66 4 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella sp. (strain MR-4)
Q0HZ28 0.0 1275 66 4 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella sp. (strain MR-7)
A3D085 0.0 1275 66 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WSL1 0.0 1274 66 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella baltica (strain OS185)
B0TSG5 0.0 1271 66 5 964 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella halifaxensis (strain HAW-EB4)
Q07YC9 0.0 1265 65 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Shewanella frigidimarina (strain NCIMB 400)
Q3IFW1 0.0 1264 63 5 961 3 gcvP Glycine dehydrogenase (decarboxylating) Pseudoalteromonas translucida (strain TAC 125)
Q5R192 0.0 1254 63 5 960 3 gcvP Glycine dehydrogenase (decarboxylating) Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q486J6 0.0 1231 61 3 959 3 gcvP1 Glycine dehydrogenase (decarboxylating) 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q4K416 0.0 1164 63 8 960 3 gcvP2 Glycine dehydrogenase (decarboxylating) 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q87I05 0.0 1162 61 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q47XG2 0.0 1160 59 7 955 3 gcvP2 Glycine dehydrogenase (decarboxylating) 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4VRT4 0.0 1157 63 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Stutzerimonas stutzeri (strain A1501)
Q3K4Z1 0.0 1155 63 8 960 3 gcvP2 Glycine dehydrogenase (decarboxylating) 2 Pseudomonas fluorescens (strain Pf0-1)
Q9RTF5 0.0 1154 61 9 959 3 gcvP Glycine dehydrogenase (decarboxylating) Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9HTX7 0.0 1154 62 6 958 3 gcvP2 Glycine dehydrogenase (decarboxylating) 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1SY74 0.0 1152 59 7 964 3 gcvP Glycine dehydrogenase (decarboxylating) Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q47D81 0.0 1150 60 9 962 3 gcvP Glycine dehydrogenase (decarboxylating) Dechloromonas aromatica (strain RCB)
B5EUH1 0.0 1148 61 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Aliivibrio fischeri (strain MJ11)
Q7MEH9 0.0 1147 61 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio vulnificus (strain YJ016)
Q88CI9 0.0 1147 62 6 958 3 gcvP2 Glycine dehydrogenase (decarboxylating) 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5DZM3 0.0 1146 61 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D7G7 0.0 1140 60 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio vulnificus (strain CMCP6)
Q6LHN5 0.0 1135 59 8 956 3 gcvP Glycine dehydrogenase (decarboxylating) Photobacterium profundum (strain SS9)
B6ES35 0.0 1134 61 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Aliivibrio salmonicida (strain LFI1238)
A7N5C4 0.0 1129 60 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio campbellii (strain ATCC BAA-1116)
C5BNY8 0.0 1123 59 5 959 3 gcvP Glycine dehydrogenase (decarboxylating) Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q4K7Q8 0.0 1118 60 3 953 3 gcvP1 Glycine dehydrogenase (decarboxylating) 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q21HU3 0.0 1116 59 4 957 3 gcvP Glycine dehydrogenase (decarboxylating) Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C3LUU7 0.0 1114 60 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio cholerae serotype O1 (strain M66-2)
A5EYY8 0.0 1114 60 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3JYR1 0.0 1104 60 3 952 3 gcvP Glycine dehydrogenase (decarboxylating) Pseudomonas fluorescens (strain SBW25)
Q7WP29 0.0 1104 59 7 953 3 gcvP Glycine dehydrogenase (decarboxylating) Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q4ZXH2 0.0 1102 59 6 957 3 gcvP Glycine dehydrogenase (decarboxylating) Pseudomonas syringae pv. syringae (strain B728a)
Q7W1C4 0.0 1102 59 7 953 3 gcvP Glycine dehydrogenase (decarboxylating) Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q88P65 0.0 1102 61 3 952 3 gcvP1 Glycine dehydrogenase (decarboxylating) 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48ME3 0.0 1101 59 6 957 3 gcvP Glycine dehydrogenase (decarboxylating) Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7W0E3 0.0 1099 59 6 953 3 gcvP Glycine dehydrogenase (decarboxylating) Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q887L5 0.0 1098 60 7 958 3 gcvP Glycine dehydrogenase (decarboxylating) Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2SFI6 0.0 1097 56 2 956 3 gcvP Glycine dehydrogenase (decarboxylating) Hahella chejuensis (strain KCTC 2396)
Q5F761 0.0 1097 58 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RN40 0.0 1096 58 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Neisseria gonorrhoeae (strain NCCP11945)
Q055P8 0.0 1094 57 4 946 3 gcvP Glycine dehydrogenase (decarboxylating) Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04PM7 0.0 1094 57 4 946 3 gcvP Glycine dehydrogenase (decarboxylating) Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q5NZ93 0.0 1093 59 6 966 3 gcvP Glycine dehydrogenase (decarboxylating) Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1KV85 0.0 1093 58 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q3K7X5 0.0 1092 59 4 958 3 gcvP1 Glycine dehydrogenase (decarboxylating) 1 Pseudomonas fluorescens (strain Pf0-1)
A9M1P7 0.0 1089 58 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Neisseria meningitidis serogroup C (strain 053442)
Q3M9G1 0.0 1088 58 8 954 3 gcvP Glycine dehydrogenase (decarboxylating) Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B2J427 0.0 1086 56 9 966 3 gcvP Glycine dehydrogenase (decarboxylating) Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q72VI8 0.0 1085 57 5 963 3 gcvP Glycine dehydrogenase (decarboxylating) Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8YNF9 0.0 1084 57 10 970 3 gcvP Glycine dehydrogenase (decarboxylating) Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5FRY0 0.0 1084 59 7 947 3 gcvP Glycine dehydrogenase (decarboxylating) Gluconobacter oxydans (strain 621H)
Q9JT86 0.0 1083 58 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8F937 0.0 1082 56 5 963 3 gcvP Glycine dehydrogenase (decarboxylating) Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A9I7K9 0.0 1082 58 8 958 3 gcvP Glycine dehydrogenase (decarboxylating) Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q6N344 0.0 1080 59 7 952 3 gcvP Glycine dehydrogenase (decarboxylating) Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9PDJ4 0.0 1080 58 8 964 3 gcvP Glycine dehydrogenase (decarboxylating) Xylella fastidiosa (strain 9a5c)
Q87DR1 0.0 1079 58 8 964 3 gcvP Glycine dehydrogenase (decarboxylating) Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B9JFK7 0.0 1076 59 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q1QMW0 0.0 1076 58 5 950 3 gcvP Glycine dehydrogenase (decarboxylating) Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q2KYL7 0.0 1075 58 6 954 3 gcvP Glycine dehydrogenase (decarboxylating) Bordetella avium (strain 197N)
B2T7I8 0.0 1074 58 9 965 3 gcvP Glycine dehydrogenase (decarboxylating) Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q1LHM2 0.0 1073 58 7 960 3 gcvP Glycine dehydrogenase (decarboxylating) Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1MG62 0.0 1073 58 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2STK2 0.0 1072 58 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9I137 0.0 1071 59 6 950 3 gcvP1 Glycine dehydrogenase (decarboxylating) 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5ZQP8 0.0 1069 58 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q46VZ5 0.0 1067 57 6 960 3 gcvP Glycine dehydrogenase (decarboxylating) Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9ACU3 0.0 1067 58 9 963 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia multivorans (strain ATCC 17616 / 249)
Q39KU1 0.0 1066 59 11 965 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8XU98 0.0 1065 58 8 965 3 gcvP Glycine dehydrogenase (decarboxylating) Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2K813 0.0 1064 59 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3BW89 0.0 1064 59 7 961 3 gcvP Glycine dehydrogenase (decarboxylating) Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q13SR6 0.0 1063 57 8 964 3 gcvP Glycine dehydrogenase (decarboxylating) Paraburkholderia xenovorans (strain LB400)
Q3ST46 0.0 1063 59 4 946 3 gcvP Glycine dehydrogenase (decarboxylating) Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B1JSZ2 0.0 1061 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia orbicola (strain MC0-3)
Q7NSJ5 0.0 1061 59 7 960 3 gcvP Glycine dehydrogenase (decarboxylating) Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1BRE8 0.0 1061 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia orbicola (strain AU 1054)
A0K321 0.0 1061 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia cenocepacia (strain HI2424)
Q16AX0 0.0 1060 57 5 943 3 gcvP Glycine dehydrogenase (decarboxylating) Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B2UG82 0.0 1059 58 7 963 3 gcvP Glycine dehydrogenase (decarboxylating) Ralstonia pickettii (strain 12J)
A4JA69 0.0 1059 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia vietnamiensis (strain G4 / LMG 22486)
B4EF26 0.0 1059 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q8PN59 0.0 1058 58 8 980 3 gcvP Glycine dehydrogenase (decarboxylating) Xanthomonas axonopodis pv. citri (strain 306)
A8LIH2 0.0 1057 58 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q6MPZ6 0.0 1056 54 7 958 3 gcvP Glycine dehydrogenase (decarboxylating) Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B1YQQ1 0.0 1056 59 11 965 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia ambifaria (strain MC40-6)
B9JWI2 0.0 1056 59 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q2P021 0.0 1055 58 8 980 3 gcvP Glycine dehydrogenase (decarboxylating) Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q63PL2 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia pseudomallei (strain K96243)
A3NF00 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia pseudomallei (strain 668)
Q3JY08 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia pseudomallei (strain 1710b)
A1V8N7 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia mallei (strain SAVP1)
Q62FN1 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia mallei (strain ATCC 23344)
A2S6F6 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia mallei (strain NCTC 10229)
A3MQP3 0.0 1055 59 10 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia mallei (strain NCTC 10247)
Q8PBK7 0.0 1054 58 9 979 3 gcvP Glycine dehydrogenase (decarboxylating) Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URZ4 0.0 1054 58 9 979 3 gcvP Glycine dehydrogenase (decarboxylating) Xanthomonas campestris pv. campestris (strain 8004)
Q0BJI1 0.0 1053 59 11 965 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2FQE7 0.0 1053 59 7 957 3 gcvP Glycine dehydrogenase (decarboxylating) Stenotrophomonas maltophilia (strain K279a)
B4SS67 0.0 1052 59 8 961 3 gcvP Glycine dehydrogenase (decarboxylating) Stenotrophomonas maltophilia (strain R551-3)
P74416 0.0 1051 55 7 965 1 gcvP Glycine dehydrogenase (decarboxylating) Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6U8Q3 0.0 1049 59 5 943 3 gcvP Glycine dehydrogenase (decarboxylating) Sinorhizobium medicae (strain WSM419)
B3PP20 0.0 1049 58 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium etli (strain CIAT 652)
Q89I86 0.0 1048 58 6 946 3 gcvP Glycine dehydrogenase (decarboxylating) Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
C5CRW8 0.0 1047 57 7 960 3 gcvP Glycine dehydrogenase (decarboxylating) Variovorax paradoxus (strain S110)
Q827D7 0.0 1043 56 9 963 3 gcvP Glycine dehydrogenase (decarboxylating) Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q92Q11 0.0 1043 58 5 943 3 gcvP Glycine dehydrogenase (decarboxylating) Rhizobium meliloti (strain 1021)
A3P0U7 0.0 1042 58 11 964 3 gcvP Glycine dehydrogenase (decarboxylating) Burkholderia pseudomallei (strain 1106a)
A4YXQ9 0.0 1042 58 6 960 3 gcvP Glycine dehydrogenase (decarboxylating) Bradyrhizobium sp. (strain ORS 278)
Q8UFD6 0.0 1039 58 4 943 3 gcvP Glycine dehydrogenase (decarboxylating) Agrobacterium fabrum (strain C58 / ATCC 33970)
A5EMM2 0.0 1037 57 6 960 3 gcvP Glycine dehydrogenase (decarboxylating) Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q07R90 0.0 1037 57 6 950 3 gcvP Glycine dehydrogenase (decarboxylating) Rhodopseudomonas palustris (strain BisA53)
Q8DII3 0.0 1035 56 6 959 3 gcvP Glycine dehydrogenase (decarboxylating) Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1QCL7 0.0 1035 56 11 970 3 gcvP Glycine dehydrogenase (decarboxylating) Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FMV1 0.0 1033 53 6 948 3 gcvP Glycine dehydrogenase (decarboxylating) Pelagibacter ubique (strain HTCC1062)
Q4FTK9 0.0 1032 56 12 970 3 gcvP Glycine dehydrogenase (decarboxylating) Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B1W4G3 0.0 1031 55 8 963 3 gcvP Glycine dehydrogenase (decarboxylating) Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A4WUX2 0.0 1024 58 8 967 3 gcvP Glycine dehydrogenase (decarboxylating) Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A3PI15 0.0 1023 58 8 952 3 gcvP Glycine dehydrogenase (decarboxylating) Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q9AK84 0.0 1023 54 8 963 3 gcvP Glycine dehydrogenase (decarboxylating) Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B9KNU3 0.0 1021 58 8 952 3 gcvP Glycine dehydrogenase (decarboxylating) Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J4D4 0.0 1021 58 8 952 3 gcvP Glycine dehydrogenase (decarboxylating) Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O80988 0.0 1021 54 10 964 1 GLDP2 Glycine dehydrogenase (decarboxylating) 2, mitochondrial Arabidopsis thaliana
Q28L73 0.0 1020 57 11 950 3 gcvP Glycine dehydrogenase (decarboxylating) Jannaschia sp. (strain CCS1)
O49850 0.0 1016 53 10 970 3 GDCSP Glycine dehydrogenase (decarboxylating), mitochondrial Flaveria anomala
P49361 0.0 1016 53 10 970 2 GDCSPA Glycine dehydrogenase (decarboxylating) A, mitochondrial Flaveria pringlei
Q94B78 0.0 1016 54 10 954 1 GLDP1 Glycine dehydrogenase (decarboxylating) 1, mitochondrial Arabidopsis thaliana
O49852 0.0 1015 53 10 970 3 GDCSPA Glycine dehydrogenase (decarboxylating), mitochondrial Flaveria trinervia
P49362 0.0 1015 53 10 970 3 GDCSPB Glycine dehydrogenase (decarboxylating) B, mitochondrial Flaveria pringlei
P26969 0.0 1014 53 8 964 1 GDCSP Glycine dehydrogenase (decarboxylating), mitochondrial Pisum sativum
B2UNH4 0.0 1012 54 8 960 3 gcvP Glycine dehydrogenase (decarboxylating) Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
O49954 0.0 1009 53 10 967 2 GDCSP Glycine dehydrogenase (decarboxylating), mitochondrial Solanum tuberosum
P23378 0.0 1008 53 10 959 1 GLDC Glycine dehydrogenase (decarboxylating), mitochondrial Homo sapiens
A0M5D4 0.0 1005 52 7 952 3 gcvP Glycine dehydrogenase (decarboxylating) Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q54KM7 0.0 1002 52 11 967 3 gcvP Glycine dehydrogenase (decarboxylating), mitochondrial Dictyostelium discoideum
Q73ZQ6 0.0 999 54 10 965 3 gcvP Glycine dehydrogenase (decarboxylating) Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A5FMT0 0.0 998 52 6 949 3 gcvP Glycine dehydrogenase (decarboxylating) Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A4TA90 0.0 996 54 8 955 3 gcvP Glycine dehydrogenase (decarboxylating) Mycolicibacterium gilvum (strain PYR-GCK)
A0QGN2 0.0 996 54 10 965 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium avium (strain 104)
Q91W43 0.0 994 53 9 958 1 Gldc Glycine dehydrogenase (decarboxylating), mitochondrial Mus musculus
Q98LT6 0.0 982 55 10 961 3 gcvP Glycine dehydrogenase (decarboxylating) Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q46IC1 0.0 980 52 8 954 3 gcvP Glycine dehydrogenase (decarboxylating) Prochlorococcus marinus (strain NATL2A)
P9WN53 0.0 976 54 11 962 1 gcvP Probable glycine dehydrogenase (decarboxylating) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN52 0.0 976 54 11 962 3 gcvP Probable glycine dehydrogenase (decarboxylating) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U3J9 0.0 976 54 11 962 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1APA9 0.0 974 54 11 962 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KJP4 0.0 974 54 11 962 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VET8 0.0 974 54 11 962 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A2C5D4 0.0 973 51 9 957 3 gcvP Glycine dehydrogenase (decarboxylating) Prochlorococcus marinus (strain NATL1A)
P15505 0.0 965 51 10 958 1 GLDC Glycine dehydrogenase (decarboxylating), mitochondrial Gallus gallus
Q6FYZ7 0.0 965 53 11 950 3 gcvP Glycine dehydrogenase (decarboxylating) Bartonella quintana (strain Toulouse)
P49095 0.0 963 52 16 970 1 GCV2 Glycine dehydrogenase (decarboxylating), mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O32915 0.0 962 53 10 958 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium leprae (strain TN)
B8ZSN5 0.0 962 53 10 958 3 gcvP Glycine dehydrogenase (decarboxylating) Mycobacterium leprae (strain Br4923)
Q09785 0.0 959 50 8 974 3 gcv2 Putative glycine dehydrogenase (decarboxylating), mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6G2F1 0.0 957 53 9 951 3 gcvP Glycine dehydrogenase (decarboxylating) Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8G9M2 0.0 956 53 6 952 3 gcvP Glycine dehydrogenase (decarboxylating) (Fragment) Rhodococcus fascians
Q7U3Q5 0.0 955 54 5 948 3 gcvP Glycine dehydrogenase (decarboxylating) Parasynechococcus marenigrum (strain WH8102)
Q5YWV4 0.0 953 54 10 956 3 gcvP Glycine dehydrogenase (decarboxylating) Nocardia farcinica (strain IFM 10152)
P62921 0.0 949 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RLN1 0.0 949 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella melitensis biotype 2 (strain ATCC 23457)
Q3AUM0 0.0 948 54 11 952 3 gcvP Glycine dehydrogenase (decarboxylating) Synechococcus sp. (strain CC9902)
P62920 0.0 947 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella abortus biovar 1 (strain 9-941)
Q2YKX9 0.0 947 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella abortus (strain 2308)
B2SAU5 0.0 947 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella abortus (strain S19)
A9WZ23 0.0 947 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8FVU9 0.0 946 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella suis biovar 1 (strain 1330)
A9MC11 0.0 945 53 10 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A5VV25 0.0 944 53 11 950 3 gcvP Glycine dehydrogenase (decarboxylating) Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7V411 0.0 941 52 7 947 3 gcvP Glycine dehydrogenase (decarboxylating) Prochlorococcus marinus (strain MIT 9313)
Q8A8M0 0.0 941 52 6 942 3 gcvP Glycine dehydrogenase (decarboxylating) Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5LDN2 0.0 937 52 6 946 3 gcvP Glycine dehydrogenase (decarboxylating) Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64UQ7 0.0 936 52 6 946 3 gcvP Glycine dehydrogenase (decarboxylating) Bacteroides fragilis (strain YCH46)
A5GWN4 0.0 936 54 8 947 3 gcvP Glycine dehydrogenase (decarboxylating) Synechococcus sp. (strain RCC307)
A2CDR0 0.0 934 52 7 950 3 gcvP Glycine dehydrogenase (decarboxylating) Prochlorococcus marinus (strain MIT 9303)
Q7V9K4 0.0 928 50 4 955 3 gcvP Glycine dehydrogenase (decarboxylating) Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q6A9R8 0.0 906 50 10 987 3 gcvP Glycine dehydrogenase (decarboxylating) Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q83GV1 0.0 851 47 14 975 3 gcvP Glycine dehydrogenase (decarboxylating) Tropheryma whipplei (strain Twist)
Q83IA7 0.0 851 47 14 975 3 gcvP Glycine dehydrogenase (decarboxylating) Tropheryma whipplei (strain TW08/27)
A7HLP1 3.34e-102 330 44 8 410 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q2YCK3 1.07e-99 325 42 6 410 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B1YLN8 2.26e-96 315 42 10 457 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9K936 1.39e-95 313 44 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5WF32 3.16e-94 310 45 6 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Shouchella clausii (strain KSM-K16)
B1HSN5 5.82e-93 306 40 10 467 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Lysinibacillus sphaericus (strain C3-41)
B6J2H6 2.07e-92 305 39 10 462 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Coxiella burnetii (strain CbuG_Q212)
Q8Y7D3 2.75e-92 304 43 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZX2 3.05e-92 304 43 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria monocytogenes serotype 4b (strain F2365)
C1L2Q6 3.28e-92 304 43 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DFX8 1.7e-91 302 42 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria monocytogenes serotype 4a (strain HCC23)
A0AIF1 2.01e-91 302 42 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q83B09 2.56e-91 302 39 10 462 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NA76 2.56e-91 302 39 10 462 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KC20 2.56e-91 302 39 10 462 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Coxiella burnetii (strain Dugway 5J108-111)
B3QS77 3.2e-91 301 38 13 523 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A7GSN6 6.43e-91 301 42 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B6J4T8 8.86e-91 300 39 10 462 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Coxiella burnetii (strain CbuK_Q154)
Q92C04 1.28e-90 300 42 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3SMC1 8.26e-90 298 41 8 433 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thiobacillus denitrificans (strain ATCC 25259)
B7IF24 1.1e-89 297 42 5 397 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermosipho africanus (strain TCF52B)
Q4L6N5 1.25e-89 297 41 9 431 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus haemolyticus (strain JCSC1435)
B7IXL2 1.83e-89 297 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain G9842)
C5CF44 2.5e-89 296 40 6 411 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q2YSZ4 3.02e-89 296 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q65HG1 3.8e-89 296 42 6 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P54377 5.03e-89 296 41 8 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus subtilis (strain 168)
A0RIK9 6.53e-89 295 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus thuringiensis (strain Al Hakam)
Q8NWD0 8.65e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain MW2)
A8Z474 8.65e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6G931 8.65e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain MSSA476)
Q2FY35 8.65e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGI7 8.65e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain USA300)
B7HB98 9.67e-89 295 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain B4264)
P99168 9.79e-89 295 40 10 432 1 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain N315)
P64219 9.79e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IT63 9.79e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain JH9)
A6U206 9.79e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain JH1)
A7X2R9 9.79e-89 295 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GGG4 1.88e-88 294 41 8 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain MRSA252)
Q6HDT8 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634V8 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain ZK / E33L)
C1ERU8 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain 03BB102)
B7JMU9 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain AH820)
Q81M08 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus anthracis
C3LKQ2 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8D3 2.28e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus anthracis (strain A0248)
P62029 2.45e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B9IXL7 2.69e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain Q1)
B7HNY9 2.69e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain AH187)
A9VH10 3.2e-88 293 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus mycoides (strain KBAB4)
Q3AQ15 3.22e-88 293 38 11 498 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chlorobium chlorochromatii (strain CaD3)
A6QH79 3.67e-88 293 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain Newman)
Q5HFM4 3.67e-88 293 40 10 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus aureus (strain COL)
Q818M5 5.68e-88 294 41 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7Z6M2 7.01e-88 293 42 7 408 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q0AEQ0 7.08e-88 292 40 9 437 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q49XX9 1.34e-87 292 40 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O57709 1.34e-87 292 39 8 438 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A5IKK7 1.87e-87 291 39 9 428 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A4SCK8 2.02e-87 291 38 13 528 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q9WY57 2.94e-87 290 39 8 426 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1L9T8 4.45e-87 290 39 8 426 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermotoga sp. (strain RQ2)
Q8TZJ2 4.67e-87 291 39 7 430 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
B9K6R4 7.15e-87 290 39 8 429 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q60BW5 7.18e-87 290 41 8 419 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5X8W5 9.79e-87 289 39 8 453 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Legionella pneumophila (strain Paris)
Q8KAN3 1.22e-86 289 40 7 447 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8CMM1 1.72e-86 289 39 8 448 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HP14 2.21e-86 289 39 8 448 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8MEG7 2.56e-86 288 40 10 435 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Alkaliphilus oremlandii (strain OhILAs)
Q82WQ3 4.65e-86 288 40 9 436 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A6LP69 7.5e-86 287 40 8 431 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5I9T3 1.75e-85 286 38 8 456 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Legionella pneumophila (strain Corby)
Q9UXT1 1.99e-85 286 38 10 461 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Pyrococcus abyssi (strain GE5 / Orsay)
C0ZBW7 2.25e-85 286 42 7 447 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q5ZZ97 2.69e-85 285 38 8 456 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X0A8 7.69e-85 284 38 9 456 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Legionella pneumophila (strain Lens)
A4J2F9 1.23e-84 284 40 9 453 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B8GN14 1.25e-84 284 38 9 445 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q8RCW2 1.29e-84 284 39 12 473 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B6YT12 2.24e-83 281 38 8 437 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermococcus onnurineus (strain NA1)
Q5JGX6 2.75e-83 281 38 9 453 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
C5A7J0 5.69e-83 280 38 9 454 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
P62031 8.34e-83 279 40 5 407 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q3J846 8.68e-83 279 38 9 434 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q97C04 2.85e-82 277 40 9 403 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q8CXE1 8.37e-82 276 39 7 446 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A8F8M6 1.3e-81 275 38 5 410 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B3EEC8 1.45e-81 275 41 7 413 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q9A354 1.12e-80 274 42 6 403 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9HII2 1.38e-80 272 38 9 424 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B4S3N4 1.55e-80 273 41 6 411 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q0AVH9 2.7e-80 272 38 10 461 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B1GYV8 3.77e-80 271 39 8 427 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Endomicrobium trichonymphae
B4SB96 1.14e-78 268 38 9 479 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1BJA7 3.69e-78 266 42 8 413 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B0TZJ5 4.16e-76 260 38 8 431 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q588 7.5e-76 260 38 6 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Francisella tularensis subsp. novicida (strain U112)
Q7UNH1 1.4e-75 259 38 6 421 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A4IZK5 2.11e-75 258 38 6 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SFM4 2.11e-75 258 38 6 409 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Francisella tularensis subsp. mediasiatica (strain FSC147)
O67740 1.37e-74 256 37 9 434 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Aquifex aeolicus (strain VF5)
A3DNK0 8.03e-74 255 38 15 443 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q5SKW7 1.97e-73 253 40 10 407 1 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62030 2.12e-73 253 40 10 407 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C3NE26 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NHN7 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MUU9 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MPT6 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KH28 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3N5G2 5.19e-73 253 35 7 432 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfolobus islandicus (strain M.16.27)
Q9YA18 2.88e-70 246 38 9 424 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q972C0 1.95e-69 243 35 6 424 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q97ZI9 2.33e-68 240 35 7 428 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B1YLN7 1.88e-66 233 36 9 403 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B1YLN7 5.5e-08 60 27 11 287 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q92C05 7.3e-66 231 38 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92C05 8.29e-06 53 22 20 453 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0AVH8 2.64e-65 229 34 7 444 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B9DNN6 4.76e-65 229 37 11 409 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus carnosus (strain TM300)
B9DNN6 0.000211 48 23 15 413 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus carnosus (strain TM300)
Q71ZX3 1.18e-64 228 37 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4b (strain F2365)
Q71ZX3 5.38e-06 53 22 20 478 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4b (strain F2365)
Q1INU0 1.28e-64 228 35 9 397 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Koribacter versatilis (strain Ellin345)
B8DFX9 1.34e-64 228 37 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4a (strain HCC23)
B8DFX9 9.12e-06 53 22 20 478 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4a (strain HCC23)
C1L2Q5 1.45e-64 228 37 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4b (strain CLIP80459)
C1L2Q5 6.73e-06 53 22 20 478 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serotype 4b (strain CLIP80459)
A4J2F8 1.94e-64 227 36 6 357 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C5D4A1 2.08e-64 227 36 7 362 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus sp. (strain WCH70)
C5D4A1 6.83e-07 56 24 11 300 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus sp. (strain WCH70)
Q8Y7D4 2.32e-64 227 37 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y7D4 2.71e-05 51 21 20 487 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AIF0 3.63e-64 226 37 10 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AIF0 1.02e-06 56 22 20 478 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q49XY0 3.71e-64 226 35 8 396 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49XY0 1.66e-05 52 26 11 276 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A4IQV4 3.9e-64 226 37 8 366 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus thermodenitrificans (strain NG80-2)
A4IQV4 2.26e-06 55 25 9 283 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus thermodenitrificans (strain NG80-2)
P54376 5.15e-64 226 37 7 361 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus subtilis (strain 168)
P54376 7.47e-06 53 24 18 435 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus subtilis (strain 168)
Q5KX77 1.46e-63 225 38 6 359 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus kaustophilus (strain HTA426)
Q5KX77 1.48e-08 62 23 17 438 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacillus kaustophilus (strain HTA426)
Q2RH48 3.36e-63 224 35 9 445 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RH48 1.23e-07 58 24 18 450 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5HFM3 7.23e-63 223 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain COL)
Q5HFM3 5.81e-05 50 22 14 419 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain COL)
Q3AET5 8.71e-63 223 31 9 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9WY56 1.31e-62 222 37 8 379 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5WF31 1.31e-62 222 36 7 380 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Shouchella clausii (strain KSM-K16)
Q5WF31 3.1e-07 57 23 16 378 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Shouchella clausii (strain KSM-K16)
P64218 1.35e-62 222 36 10 398 1 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain N315)
P64218 9.51e-05 49 22 14 419 1 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain N315)
P64217 1.35e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P64217 9.51e-05 49 22 14 419 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IT64 1.35e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain JH9)
A5IT64 9.51e-05 49 22 14 419 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain JH9)
A6U207 1.35e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain JH1)
A6U207 9.51e-05 49 22 14 419 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain JH1)
A7X2S0 1.35e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X2S0 9.51e-05 49 22 14 419 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6G930 1.66e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MSSA476)
Q6G930 5.26e-05 50 22 14 422 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MSSA476)
Q8NWC9 1.86e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MW2)
Q8NWC9 4.93e-05 50 22 14 422 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MW2)
Q2FY34 1.86e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FY34 4.93e-05 50 22 14 422 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGI6 1.86e-62 222 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain USA300)
Q2FGI6 4.93e-05 50 22 14 422 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain USA300)
Q818M4 1.92e-62 222 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q818M4 6.25e-07 56 22 18 447 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HB99 1.92e-62 222 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain B4264)
B7HB99 6.25e-07 56 22 18 447 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain B4264)
B7IXL3 1.92e-62 222 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain G9842)
B7IXL3 6.25e-07 56 22 18 447 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain G9842)
Q6HDT7 2e-62 222 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HDT7 1.41e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
B0TZJ6 2e-62 222 35 8 389 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B0TZJ6 0.000869 46 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q730W2 2.39e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q730W2 4.69e-07 57 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6GGG3 2.67e-62 221 36 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MRSA252)
Q6GGG3 2.52e-05 51 22 14 422 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus aureus (strain MRSA252)
A0Q587 3.46e-62 221 35 8 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. novicida (strain U112)
Q634V7 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ZK / E33L)
Q634V7 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain ZK / E33L)
C1ERU9 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain 03BB102)
C1ERU9 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain 03BB102)
B7JMV0 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain AH820)
B7JMV0 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain AH820)
Q81M07 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis
Q81M07 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis
A0RIL0 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus thuringiensis (strain Al Hakam)
A0RIL0 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus thuringiensis (strain Al Hakam)
C3LKQ3 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3LKQ3 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8D4 4.88e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis (strain A0248)
C3P8D4 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus anthracis (strain A0248)
B9IXL8 5.28e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain Q1)
B9IXL8 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain Q1)
B7HNZ0 5.28e-62 221 36 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain AH187)
B7HNZ0 1.2e-06 55 21 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cereus (strain AH187)
B7GHD3 5.47e-62 221 37 7 363 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7GHD3 9.84e-08 59 24 11 310 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A9VH11 6.43e-62 220 36 7 363 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus mycoides (strain KBAB4)
A9VH11 1.37e-07 58 22 18 446 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus mycoides (strain KBAB4)
Q24TH5 6.93e-62 220 37 7 351 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Desulfitobacterium hafniense (strain Y51)
A7HDC9 7.53e-62 220 36 10 411 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anaeromyxobacter sp. (strain Fw109-5)
B1L9T9 9.99e-62 219 34 12 442 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermotoga sp. (strain RQ2)
B2SFM3 1.44e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. mediasiatica (strain FSC147)
B2SFM3 0.00056 47 21 14 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. mediasiatica (strain FSC147)
B8FT31 1.51e-61 219 37 7 351 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A4IZK6 1.65e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
A4IZK6 0.000518 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHN8 1.65e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NHN8 0.000518 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14J40 1.65e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain FSC 198)
Q14J40 0.000518 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BN71 2.31e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain OSU18)
Q0BN71 0.000531 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A4V1 2.31e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain LVS)
Q2A4V1 0.000531 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain LVS)
A7NAH8 2.36e-61 219 35 7 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A7NAH8 0.000626 47 22 15 393 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q4L6N6 2.83e-61 219 34 11 412 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus haemolyticus (strain JCSC1435)
Q4L6N6 0.000649 47 22 15 421 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus haemolyticus (strain JCSC1435)
A7GSN7 5.45e-61 218 35 7 364 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GSN7 4.19e-08 60 22 17 439 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9HPK0 5.77e-61 218 34 10 456 3 gcvPB Probable glycine dehydrogenase (decarboxylating) subunit 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q0AMJ2 8.5e-61 217 37 12 394 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Maricaulis maris (strain MCS10)
Q65HG0 1.14e-60 217 35 7 361 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65HG0 3.55e-06 54 25 11 290 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A5IKK8 1.79e-60 216 36 8 379 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q2IQD6 3.07e-60 216 36 8 397 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
B5YFB8 3.46e-60 216 31 15 448 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B5YFB8 3.25e-08 60 20 13 384 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A8HT29 5.33e-60 215 35 11 412 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A7HQY0 5.68e-60 215 35 10 396 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q2N886 7.6e-60 214 35 14 457 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Erythrobacter litoralis (strain HTCC2594)
C0ZBW6 1.16e-59 214 32 8 443 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C0ZBW6 0.000532 47 23 9 291 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A7Z6M3 2.07e-59 213 35 7 382 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8D1D5 2.6e-59 213 34 8 387 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9K935 2.9e-59 213 33 13 454 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K935 3.67e-05 51 25 12 288 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B4UGZ3 3.05e-59 213 36 8 396 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anaeromyxobacter sp. (strain K)
A5I9T5 6.03e-59 212 35 5 373 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Legionella pneumophila (strain Corby)
Q5X8W3 7.13e-59 212 35 5 373 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Legionella pneumophila (strain Paris)
B8JDY8 1.27e-58 211 36 7 396 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B8E2E7 1.38e-58 211 32 10 411 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B8E2E7 7.88e-08 59 19 15 440 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q5ZZ95 1.45e-58 211 35 5 373 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X0A6 1.59e-58 211 35 5 373 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Legionella pneumophila (strain Lens)
B6YT11 1.73e-58 211 33 17 452 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus onnurineus (strain NA1)
B6YT11 6.82e-09 63 24 9 278 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus onnurineus (strain NA1)
Q8CXE0 2.55e-58 210 34 13 401 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8CXE0 2.96e-06 54 22 16 469 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A7IHE9 2.91e-58 210 34 10 443 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A5GCZ8 3.28e-58 210 34 10 441 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geotalea uraniireducens (strain Rf4)
Q6ARJ7 4.89e-58 209 32 12 464 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B3QUT6 6.94e-58 209 35 10 390 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q9UXT0 7.57e-58 209 37 10 383 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus abyssi (strain GE5 / Orsay)
Q9UXT0 1.83e-09 64 24 11 320 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus abyssi (strain GE5 / Orsay)
Q5JGX5 7.95e-58 209 35 10 382 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JGX5 3.43e-10 67 23 8 290 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B1HSN6 9.08e-58 209 36 6 361 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Lysinibacillus sphaericus (strain C3-41)
B1HSN6 1.3e-05 52 24 12 316 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Lysinibacillus sphaericus (strain C3-41)
A8FF40 2.57e-57 207 35 8 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus pumilus (strain SAFR-032)
A8FF40 1.19e-05 52 24 11 318 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Bacillus pumilus (strain SAFR-032)
O57708 7.14e-57 206 33 13 444 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57708 6.88e-09 63 24 11 320 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
C1F935 8.63e-57 206 33 9 401 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
C1F935 0.000368 47 23 7 209 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B9E6R9 1.66e-56 205 32 7 394 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Macrococcus caseolyticus (strain JCSC5402)
B9E6R9 9.77e-09 62 22 20 496 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Macrococcus caseolyticus (strain JCSC5402)
Q8CMM0 2.02e-56 205 33 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HP13 2.02e-56 205 33 10 398 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B5EAW7 2.38e-56 204 31 12 449 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B3EH28 3.01e-56 204 34 8 397 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q8RCW1 1.76e-55 202 34 7 374 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C6DYX1 1.76e-55 202 32 12 447 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geobacter sp. (strain M21)
Q02BS4 3.65e-55 201 35 10 362 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Solibacter usitatus (strain Ellin6076)
Q02BS4 3.26e-05 51 26 13 286 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Solibacter usitatus (strain Ellin6076)
Q2W9A3 8.69e-55 200 34 8 392 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B4S5J4 1.02e-54 200 34 6 379 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B4RF16 1.07e-54 200 33 10 405 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Phenylobacterium zucineum (strain HLK1)
A5V9T6 1.29e-54 200 32 9 466 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B6IXI3 1.59e-54 199 34 10 409 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Rhodospirillum centenum (strain ATCC 51521 / SW)
C5A7J1 1.74e-54 199 32 14 444 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
C5A7J1 1.6e-09 65 24 11 324 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
B8H4V4 2.5e-54 199 32 10 436 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A353 2.5e-54 199 32 10 436 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O67193 2.84e-54 198 33 4 355 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Aquifex aeolicus (strain VF5)
Q0BYP2 6.71e-54 197 34 12 406 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Hyphomonas neptunium (strain ATCC 15444)
B9KZ42 1.55e-53 197 35 7 367 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A1BE03 1.62e-53 196 34 8 383 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B9M3X6 1.66e-53 196 34 9 397 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A9FQM4 2.12e-53 196 34 10 369 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sorangium cellulosum (strain So ce56)
A9FQM4 7.54e-07 56 22 15 458 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sorangium cellulosum (strain So ce56)
Q9YA15 2.83e-53 196 34 10 375 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q3B2G3 3.26e-53 196 33 8 387 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8TZJ3 3.79e-53 196 32 9 379 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8TZJ3 3.65e-08 60 23 12 330 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q4J915 6.82e-53 195 33 11 375 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q3SMB8 8.6e-53 195 35 9 377 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Thiobacillus denitrificans (strain ATCC 25259)
A0L7X6 1.05e-52 194 35 9 388 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B4SE02 1.14e-52 194 35 7 354 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q1GRZ2 1.54e-52 194 34 12 400 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B2IGK3 1.96e-52 193 34 14 427 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
C3N5G1 2.2e-52 193 33 9 369 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sulfolobus islandicus (strain M.16.27)
B5Y9D4 2.25e-52 193 32 7 396 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q0VLA8 6.55e-52 192 33 8 377 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2YCK1 8.34e-52 192 32 13 444 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YCK1 0.000453 47 23 20 469 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
C3NHN8 1.02e-51 192 33 9 369 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MUU8 1.02e-51 192 33 9 369 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MPT5 1.02e-51 192 33 9 369 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_06095
Feature type CDS
Gene gcvP
Product aminomethyl-transferring glycine dehydrogenase
Location 10114 - 12990 (strand: -1)
Length 2877 (nucleotides) / 958 (amino acids)

Contig

Accession ZDB_683
Length 224720 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_823
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02347 Glycine cleavage system P-protein
PF21478 Glycine dehydrogenase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1003 Amino acid transport and metabolism (E) E Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain

Kegg Ortholog Annotation(s)

Protein Sequence

MTQTLTQLENRGEFVRRHIGASPEQQQHMLKTVGAASLEDLTRHIVPDDIQLDIPPAVGEGATEQDALAELKTIAGLNQQFTSYIGQGYAPTILPPVILRNLLENPGWYTAYTPYQPEISQGRLEALLNFQQVTIDLTGLELASASLLDEATAAAEAMAMAKRVSKKKNANRFFIADDVHPQTLDVIRTRAEYFGFELIIDSAEKALDYDDVFGVLLQQTGTGGQIHDYRELLAQLHQRQVITSVAADIMALVLLEAPGKQGADIVFGSAQRFGVPMGYGGPHAAFFACRDAYKRAMPGRLIGVSIDAAGNRALRLALQTREQHIRREKANSNICTSQVLLANIAGMYAVYHGPEGLKRIAGRIHRLTDILAKALTDAGLRLRNTTWFDTLTIEVQDKQAVLARAKAARINLRTDLPGAVAVTLSETTQRECLENLYAVLTGQEAQWDIDALDAQVAASSESIPAALRREGEILKHPNFRRYHSETDMMRYLHSLARKDLALDQAMIPLGSCTMKLNAAAEMIPITWPEFGNMHPFCPPEQAQGYHVMIEQLSRWLVLLTGYDAMCMQPNSGAQGEYAGLVTIRRYQESKGEGHRTICLIPQSAHGTNPASANMAGMEVVVVACDEDGNIDLADLRAKAEQHSENLSCVMITYPSTHGVYEEGVREVCDIIHEFGGQVYLDGANMNAQVGVTTPGFIGADVSHLNLHKTFSIPHGGGGPGMGPIGVKKHLAPFVPGHTIVTSELLTSQGAVSAAPFGSASILPISWMYIRMMGAQGLRQASQVAILNANYIAARLKSAYDVLYTGRNGYVAHECILDIRPLKAKFGITEMDIAKRLIDYGFHAPTMSFPVGGTLMVEPTESESQTELDRFIDAMLGIRAEMERVGSGEWTAEDNPLVNAPHIQTELAAEWSHPYSREVAVFPTQATRDNKYWPTVKRLDDVYGDRHLQCSCAPMSDYG

Flanking regions ( +/- flanking 50bp)

TTTTTTTTCGGGTTTTTATTGAATCAGACAATGTCAGGAACCGGAGAACAATGACTCAAACTTTAACGCAGCTTGAAAACCGGGGTGAATTTGTCCGCCGTCATATCGGCGCGTCCCCTGAACAACAGCAGCATATGCTGAAAACGGTCGGTGCGGCATCACTTGAAGATCTCACCCGCCATATTGTCCCTGATGATATTCAGCTGGATATCCCGCCTGCCGTGGGCGAAGGGGCAACCGAACAGGATGCGCTGGCAGAACTGAAAACCATTGCCGGGCTGAATCAGCAATTTACCTCTTACATCGGCCAGGGCTATGCACCGACTATTCTGCCGCCGGTAATTTTACGCAATCTGCTGGAAAATCCGGGCTGGTATACCGCGTACACGCCGTATCAGCCGGAAATCTCCCAGGGCCGCCTGGAAGCACTGCTGAATTTCCAGCAGGTGACTATCGACCTGACCGGTCTGGAGCTGGCATCTGCCTCACTGCTGGATGAAGCAACCGCTGCGGCGGAAGCGATGGCGATGGCAAAACGCGTCAGCAAAAAGAAAAATGCCAACCGCTTTTTCATTGCGGATGATGTGCATCCGCAAACCCTGGATGTGATCCGCACCCGCGCTGAATATTTCGGTTTTGAACTGATAATCGATAGTGCGGAAAAAGCCCTTGATTACGATGATGTGTTTGGTGTGCTGTTGCAGCAGACCGGCACCGGCGGACAGATCCATGATTACCGTGAATTACTGGCACAGTTACATCAGCGTCAGGTGATCACCAGTGTGGCAGCCGATATTATGGCGCTGGTTCTGCTGGAAGCACCGGGTAAACAGGGCGCGGATATCGTCTTCGGCTCAGCCCAGCGTTTTGGTGTGCCGATGGGCTACGGCGGCCCTCATGCTGCCTTCTTTGCCTGCCGTGATGCTTACAAACGTGCGATGCCGGGCCGCCTTATCGGAGTATCCATTGATGCCGCCGGTAACCGTGCTCTGCGTCTGGCGCTGCAAACCCGCGAACAGCATATCCGCCGTGAAAAAGCGAACTCCAACATCTGTACTTCTCAGGTTCTGCTGGCAAATATCGCCGGGATGTATGCGGTCTACCACGGGCCGGAAGGTCTGAAACGGATTGCCGGCCGCATTCACCGCCTGACCGATATTCTGGCGAAAGCGCTGACAGATGCGGGTCTGCGTCTGCGTAACACCACCTGGTTTGATACCCTGACGATTGAAGTACAGGACAAACAGGCCGTTCTGGCCCGGGCCAAAGCAGCGCGTATCAACCTGCGTACCGATCTGCCGGGTGCCGTTGCGGTCACCCTGAGCGAAACCACGCAGCGTGAATGCCTGGAAAATCTGTACGCGGTACTGACCGGACAGGAAGCACAGTGGGATATCGATGCACTCGATGCACAGGTTGCCGCTTCTTCTGAATCCATTCCTGCCGCGCTGCGCCGCGAAGGGGAGATTCTGAAGCATCCGAACTTCCGCCGCTATCACAGCGAAACGGATATGATGCGCTATCTGCACAGTCTGGCCCGCAAAGACCTGGCGCTGGATCAGGCGATGATCCCGCTCGGCTCCTGCACCATGAAACTGAATGCGGCTGCGGAGATGATCCCGATAACCTGGCCGGAATTCGGTAATATGCATCCGTTCTGCCCGCCGGAGCAGGCTCAGGGCTATCATGTGATGATAGAACAGCTCTCCCGCTGGCTGGTGTTGCTGACCGGTTATGACGCCATGTGTATGCAGCCGAACTCCGGCGCACAGGGGGAATACGCCGGGCTGGTGACTATCCGCCGCTATCAGGAAAGCAAAGGTGAAGGGCACCGCACTATCTGTCTGATCCCGCAGTCTGCTCACGGCACTAACCCGGCCTCAGCCAATATGGCGGGGATGGAAGTCGTGGTGGTGGCCTGTGATGAAGACGGTAACATTGATCTGGCGGATTTACGGGCGAAAGCAGAACAGCACAGTGAAAATCTGTCCTGTGTGATGATCACTTATCCGTCCACCCACGGGGTGTATGAAGAGGGTGTGCGCGAAGTCTGTGATATCATTCATGAATTCGGCGGCCAGGTGTATCTGGACGGCGCGAACATGAACGCACAGGTCGGCGTGACCACGCCGGGCTTTATCGGCGCGGATGTTTCTCACCTTAACCTGCACAAGACCTTCAGTATTCCGCACGGCGGCGGCGGACCGGGCATGGGGCCGATTGGTGTGAAAAAACACCTCGCACCGTTTGTGCCGGGACACACCATTGTTACTTCTGAGCTGCTGACCTCTCAGGGCGCGGTATCTGCCGCACCGTTCGGCAGTGCTTCCATTCTGCCGATCAGCTGGATGTATATCCGCATGATGGGTGCTCAGGGACTACGTCAGGCCAGCCAGGTGGCGATCCTTAATGCCAACTATATCGCAGCACGGCTGAAATCCGCTTACGATGTGCTTTATACCGGTCGTAACGGCTATGTGGCGCATGAATGTATTCTGGATATCCGTCCGCTGAAAGCGAAGTTTGGTATTACGGAGATGGATATTGCCAAGCGTCTGATTGACTACGGTTTCCATGCACCGACTATGTCTTTCCCGGTCGGCGGCACACTGATGGTTGAGCCGACAGAGTCCGAAAGCCAGACGGAGCTGGATCGCTTTATTGATGCGATGCTGGGTATCCGTGCGGAAATGGAGCGGGTCGGCAGTGGTGAGTGGACAGCGGAAGATAACCCTCTGGTGAATGCCCCGCATATCCAGACTGAACTGGCAGCGGAGTGGTCACACCCGTACAGCCGTGAAGTGGCGGTATTCCCGACTCAGGCAACGCGTGACAACAAATACTGGCCGACGGTTAAACGGCTGGATGATGTCTACGGTGACCGTCACCTTCAGTGCTCCTGTGCACCGATGAGTGATTACGGGTAAACGGTAAACGATAAAAAAAAGGCCGGTTGTGGTAACACAACCGGCCTTTT