Homologs in group_7

Help

20 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00495 FBDBKF_00495 40.7 Morganella morganii S1 cycA D-serine/D-alanine/glycine transporter
FBDBKF_16420 FBDBKF_16420 100.0 Morganella morganii S1 ansP L-asparagine transporter or related permease
FBDBKF_19025 FBDBKF_19025 40.6 Morganella morganii S1 proY L-asparagine transporter or related permease
EHELCC_01050 EHELCC_01050 40.7 Morganella morganii S2 cycA D-serine/D-alanine/glycine transporter
EHELCC_08285 EHELCC_08285 100.0 Morganella morganii S2 ansP L-asparagine transporter or related permease
EHELCC_18770 EHELCC_18770 40.6 Morganella morganii S2 proY L-asparagine transporter or related permease
NLDBIP_02410 NLDBIP_02410 40.7 Morganella morganii S4 cycA D-serine/D-alanine/glycine transporter
NLDBIP_08610 NLDBIP_08610 100.0 Morganella morganii S4 ansP L-asparagine transporter or related permease
NLDBIP_18535 NLDBIP_18535 40.6 Morganella morganii S4 proY L-asparagine transporter or related permease
LHKJJB_03925 LHKJJB_03925 40.7 Morganella morganii S3 cycA D-serine/D-alanine/glycine transporter
LHKJJB_05655 LHKJJB_05655 100.0 Morganella morganii S3 ansP L-asparagine transporter or related permease
LHKJJB_18640 LHKJJB_18640 40.6 Morganella morganii S3 proY L-asparagine transporter or related permease
HKOGLL_03120 HKOGLL_03120 40.7 Morganella morganii S5 cycA D-serine/D-alanine/glycine transporter
HKOGLL_18375 HKOGLL_18375 40.6 Morganella morganii S5 proY L-asparagine transporter or related permease
F4V73_RS02940 F4V73_RS02940 92.7 Morganella psychrotolerans - amino acid permease
F4V73_RS06505 F4V73_RS06505 41.1 Morganella psychrotolerans cycA D-serine/D-alanine/glycine transporter
F4V73_RS13930 F4V73_RS13930 41.7 Morganella psychrotolerans - amino acid permease
PMI_RS07785 PMI_RS07785 71.2 Proteus mirabilis HI4320 - amino acid permease
PMI_RS07880 PMI_RS07880 38.9 Proteus mirabilis HI4320 cycA D-serine/D-alanine/glycine transporter
PMI_RS11100 PMI_RS11100 40.8 Proteus mirabilis HI4320 - amino acid permease

Distribution of the homologs in the orthogroup group_7

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_7

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FL49 0.0 612 65 4 468 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59737 0.0 612 65 4 470 3 aroP Aromatic amino acid transport protein AroP Shigella flexneri
P15993 0.0 611 64 4 470 1 aroP Aromatic amino acid transport protein AroP Escherichia coli (strain K12)
Q8X968 0.0 611 64 4 470 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O157:H7
P24207 0.0 605 64 4 463 1 pheP Phenylalanine-specific permease Escherichia coli (strain K12)
P0CK99 0.0 599 63 4 470 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W822 0.0 599 63 4 470 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain SL1344)
P0A188 0.0 599 63 4 470 3 None Aromatic amino acid transport protein AroP Salmonella typhi
O34618 2.43e-132 393 44 5 461 3 ytnA Uncharacterized amino acid permease YtnA Bacillus subtilis (strain 168)
P96704 4.81e-126 377 42 4 460 3 ydgF Uncharacterized transporter YdgF Bacillus subtilis (strain 168)
O06005 6.21e-125 374 43 4 460 3 aapA Amino-acid permease AapA Bacillus subtilis (strain 168)
P0A189 2.44e-118 357 42 5 468 3 yifK Probable transport protein YifK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A190 2.44e-118 357 42 5 468 3 yifK Probable transport protein YifK Salmonella typhi
P27837 4.32e-115 349 43 4 442 1 yifK Probable transport protein YifK Escherichia coli (strain K12)
P37460 1.87e-105 324 39 7 466 3 proY Proline-specific permease ProY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAE0 3.25e-105 324 37 6 476 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli (strain K12)
P0AAE1 3.25e-105 324 37 6 476 3 cycA D-serine/D-alanine/glycine transporter Escherichia coli O157:H7
A0A0H2VDI7 1.92e-101 314 37 6 476 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P54425 2.88e-101 313 40 3 463 3 ybxG Probable threonine/serine transporter YbxG Bacillus subtilis (strain 168)
P0AAE2 1.33e-98 306 40 8 469 1 proY Proline-specific permease ProY Escherichia coli (strain K12)
P0AAE3 1.33e-98 306 40 8 469 3 proY Proline-specific permease ProY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAE4 1.33e-98 306 40 8 469 3 proY Proline-specific permease ProY Escherichia coli O157:H7
P46349 2.46e-96 301 35 4 462 1 gabP Gamma-aminobutyric acid permease Bacillus subtilis (strain 168)
A2RI87 5.58e-88 279 37 9 418 1 serP1 Serine permease SerP1 Lactococcus lactis subsp. cremoris (strain MG1363)
P77610 1.53e-87 279 36 4 403 3 ansP L-asparagine permease Escherichia coli (strain K12)
P40812 1.74e-85 274 36 4 403 3 ansP L-asparagine permease Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A2RI86 1.1e-84 271 37 10 440 1 serP2 DL-alanine permease SerP2 Lactococcus lactis subsp. cremoris (strain MG1363)
P9WQM7 2.21e-84 271 35 6 439 1 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM6 2.21e-84 271 35 6 439 3 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W1 2.21e-84 271 35 6 439 3 ansP2 L-asparagine permease 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P25527 1.25e-83 268 36 6 444 1 gabP Gamma-aminobutyric acid permease Escherichia coli (strain K12)
P42087 9.41e-82 263 33 8 475 3 hutM Putative histidine permease Bacillus subtilis (strain 168)
O32257 3.46e-78 253 35 7 441 2 yvbW Uncharacterized amino acid permease YvbW Bacillus subtilis (strain 168)
P39636 5.25e-78 253 35 5 406 2 rocC Amino-acid permease RocC Bacillus subtilis (strain 168)
P39137 1.29e-77 253 34 9 471 2 rocE Amino-acid permease RocE Bacillus subtilis (strain 168)
Q9X7P0 1.38e-77 253 35 7 445 3 ansP L-asparagine permease Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A2RNZ6 1.52e-77 253 35 11 444 1 lysP Lysine-specific permease LysP Lactococcus lactis subsp. cremoris (strain MG1363)
Q46065 1.96e-76 249 35 6 417 1 aroP Aromatic amino acid transport protein AroP Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q47689 2.32e-76 249 33 9 465 3 mmuP Probable S-methylmethionine permease Escherichia coli (strain K12)
P25737 3.04e-75 247 35 8 445 1 lysP Lysine-specific permease LysP Escherichia coli (strain K12)
A2RI97 1.09e-73 243 34 9 434 3 hisP Histidine permease HisP Lactococcus lactis subsp. cremoris (strain MG1363)
Q7VEQ4 6.69e-73 241 35 7 431 3 ansP1 L-asparagine permease 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQM9 9.1e-73 240 35 8 435 1 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM8 9.1e-73 240 35 8 435 3 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O31462 1.96e-72 239 32 9 474 3 ybgF Uncharacterized amino acid permease YbgF Bacillus subtilis (strain 168)
Q9I703 3.13e-70 233 34 5 447 2 bauD Probable GABA permease Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A1D8PN88 6.62e-67 228 33 7 445 2 HIP1 Amino-acid permease GAP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P04817 3.47e-66 226 33 9 451 1 CAN1 Arginine permease CAN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32487 4.24e-66 226 32 12 487 1 LYP1 Lysine-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FNY1 3.19e-65 223 34 8 446 3 CAN1 Arginine permease CAN1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A0A1D8PK89 5.02e-61 212 34 8 423 2 GAP2 General amino-acid permease GAP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5AG77 1.64e-60 211 34 9 441 2 GAP1 Amino-acid permease GAP1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P43059 6.03e-60 209 32 13 453 3 CAN1 Lysine/arginine permease Candida albicans (strain WO-1)
A0A1D8PPI5 6.56e-60 209 32 13 453 2 CAN1 Lysine/arginine permease CAN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2RMP5 1.57e-59 205 32 12 477 3 fywP Aromatic amino acid permease FywP Lactococcus lactis subsp. cremoris (strain MG1363)
Q9URZ3 2.06e-59 207 32 13 458 3 put4 Probable proline-specific permease put4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59WU0 2.38e-59 207 33 15 447 2 CAN2 Probable lysine/arginine permease CAN2 Candida albicans (strain SC5314 / ATCC MYA-2876)
O60170 3.75e-58 204 33 9 413 2 meu22 Probable amino-acid permease meu22 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N2 3.91e-56 199 33 16 503 3 aat1 Amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9URZ4 6.87e-56 198 31 14 502 1 cat1 Cationic amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P19145 1.71e-54 195 31 9 443 1 GAP1 General amino-acid permease GAP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1D8PPG4 2.42e-54 194 31 16 464 2 CAN3 Probable lysine/arginine permease CAN3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9P768 7.62e-54 192 31 9 420 3 SPAP7G5.06 Uncharacterized amino-acid permease P7G5.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B5BP45 1.76e-53 191 32 10 419 3 SPBC460.01c Uncharacterized amino-acid permease C460.01c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P15380 2.07e-53 192 30 14 491 2 PUT4 Proline-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38971 4.58e-52 187 32 9 458 1 ALP1 Basic amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1D8PMB1 1.21e-51 187 31 6 417 2 GAP5 Amino-acid permease GAP5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P06775 2.09e-51 186 30 13 461 1 HIP1 Histidine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43548 2.2e-51 186 30 10 445 1 AGP3 General amino acid permease AGP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53388 2.53e-51 186 31 10 457 1 DIP5 Dicarboxylic amino acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9P5N4 1.41e-50 184 30 15 492 3 SPBC359.01 Uncharacterized amino-acid permease C359.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P41815 2.39e-50 184 29 12 488 1 BAP3 Valine amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18696 9.56e-50 181 32 13 465 2 prnB Proline-specific permease Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9C0V0 3.25e-49 178 28 12 496 3 SPCPB1C11.02 Probable amino-acid permease PB1C11.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P48813 3.66e-49 181 28 9 451 1 GNP1 High-affinity glutamine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P34054 9.44e-48 176 31 11 443 2 inda1 Amino-acid permease inda1 Hypocrea atroviridis
Q59WB3 1.65e-47 176 32 9 437 2 GAP4 S-adenosylmethionine permease GAP4 Candida albicans (strain SC5314 / ATCC MYA-2876)
P38967 2.55e-47 175 31 9 409 1 TAT2 Tryptophan permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZTG5 9.89e-47 174 28 10 448 3 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain YJM789)
Q876K6 1.09e-46 174 28 11 447 3 AGP1 General amino acid permease AGP1 Saccharomyces uvarum (strain ATCC 76518 / CBS 7001 / CLIB 283 / NBRC 10550 / MCYC 623 / NCYC 2669 / NRRL Y-11845)
P38084 2.75e-46 172 27 14 487 1 BAP2 Leu/Val/Ile amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25376 3.06e-46 172 28 10 448 1 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40901 4.78e-46 171 29 9 446 2 isp5 Sexual differentiation process putative amino-acid permease isp5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59831 5.98e-46 170 28 18 494 3 SPCC965.11c Uncharacterized amino-acid permease C965.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38085 1.01e-45 171 27 5 444 1 TAT1 Valine/tyrosine/tryptophan amino-acid permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O74543 7.39e-45 167 29 15 458 3 SPCC777.04 Uncharacterized amino-acid permease C777.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A1D8PNP3 7.8e-45 168 32 8 414 2 GAP6 Amino-acid permease GAP6 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9HDV2 1.84e-43 164 29 7 444 3 SPBPB2B2.01 Uncharacterized amino-acid permease PB2B2.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P94383 4.68e-40 152 29 10 409 3 ycgH Uncharacterized transporter YcgH Bacillus subtilis (strain 168)
Q12372 5.55e-40 154 28 10 427 1 MMP1 S-methylmethionine permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38090 1.31e-39 154 28 8 408 1 AGP2 General amino acid permease AGP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92367 9.79e-38 148 28 9 406 3 aap1 Amino-acid permease 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08986 7.87e-37 145 29 10 425 1 SAM3 S-adenosylmethionine permease SAM3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45495 2.46e-34 129 43 1 166 3 None Uncharacterized transporter in pepV 3'region (Fragment) Lactobacillus delbrueckii subsp. lactis
Q03770 3.63e-26 115 27 15 457 1 SSY1 SPS-sensor component SSY1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8BLQ7 8.03e-19 92 26 9 422 1 Slc7a4 Cationic amino acid transporter 4 Mus musculus
Q8W4K3 4.51e-15 81 21 13 420 1 CAT4 Cationic amino acid transporter 4, vacuolar Arabidopsis thaliana
Q45577 4.89e-15 80 23 14 421 1 aimA Glutamate/serine transporter AimA Bacillus subtilis (strain 168)
Q797A7 9.11e-15 79 22 10 375 3 mtrA Methylthioribose transporter Bacillus subtilis (strain 168)
O43246 2.98e-14 78 26 10 368 1 SLC7A4 Cationic amino acid transporter 4 Homo sapiens
O07576 3.13e-14 78 23 5 356 1 bcaP Branched-chain amino acid permease BcaP Bacillus subtilis (strain 168)
Q6DCE8 8.17e-14 77 23 15 441 2 slc7a2 Cationic amino acid transporter 2 Xenopus laevis
A2RHI9 1.12e-13 76 21 11 435 1 bcaP Branched-chain amino acid permease BcaP Lactococcus lactis subsp. cremoris (strain MG1363)
Q8TBB6 2.78e-12 72 24 14 366 1 SLC7A14 Solute carrier family 7 member 14 Homo sapiens
Q9ASS7 3.44e-12 72 22 12 430 1 CAT2 Cationic amino acid transporter 2, vacuolar Arabidopsis thaliana
Q8GYB4 6.4e-12 71 21 12 383 2 CAT3 Cationic amino acid transporter 3, mitochondrial Arabidopsis thaliana
B5D5N9 9.03e-12 70 20 11 435 1 Slc7a2 Cationic amino acid transporter 2 Rattus norvegicus
B0UYF2 1.12e-11 70 24 14 369 3 slc7a14a Probable cationic amino acid transporter Danio rerio
Q9LZ20 2.49e-11 69 21 6 382 2 CAT6 Cationic amino acid transporter 6, chloroplastic Arabidopsis thaliana
A8I499 3.75e-11 68 20 11 435 2 SLC7A2 Cationic amino acid transporter 2 Sus scrofa
Q8BXR1 6.29e-11 68 24 14 366 1 Slc7a14 Solute carrier family 7 member 14 Mus musculus
P18581 1.02e-10 67 20 11 435 1 Slc7a2 Cationic amino acid transporter 2 Mus musculus
Q9C5D6 1.02e-10 67 23 18 461 2 CAT9 Cationic amino acid transporter 9, chloroplastic Arabidopsis thaliana
B3TP03 4.31e-10 65 20 12 434 2 SLC7A2 Cationic amino acid transporter 2 Gallus gallus
P30825 7.84e-10 64 21 16 451 1 SLC7A1 High affinity cationic amino acid transporter 1 Homo sapiens
O07002 1.34e-09 63 22 16 432 1 yveA Aspartate-proton symporter Bacillus subtilis (strain 168)
O64759 1.81e-09 63 22 11 376 1 CAT5 Cationic amino acid transporter 5 Arabidopsis thaliana
Q84MA5 2.09e-09 63 21 11 372 1 CAT1 Cationic amino acid transporter 1 Arabidopsis thaliana
A0JNI9 5.08e-09 62 23 14 366 2 SLC7A14 Solute carrier family 7 member 14 Bos taurus
O53092 5.53e-09 62 21 14 419 3 arcD Arginine/ornithine antiporter Latilactobacillus sakei
Q9SHH0 5.59e-09 62 21 12 380 2 CAT8 Cationic amino acid transporter 8, vacuolar Arabidopsis thaliana
O34560 1.25e-08 60 21 8 332 3 yecA Uncharacterized amino acid permease YecA Bacillus subtilis (strain 168)
Q58026 2.59e-08 59 23 5 199 1 MJ0609 Uncharacterized protein MJ0609 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P52569 3.58e-07 56 19 14 429 1 SLC7A2 Cationic amino acid transporter 2 Homo sapiens
Q9SQZ0 7.85e-07 55 23 10 382 3 CAT7 Cationic amino acid transporter 7, chloroplastic Arabidopsis thaliana
O08812 1.15e-06 54 22 15 440 1 Slc7a3 Cationic amino acid transporter 3 Rattus norvegicus
P0AA47 1.18e-06 54 23 13 307 1 plaP Low-affinity putrescine importer PlaP Escherichia coli (strain K12)
P0AA48 1.18e-06 54 23 13 307 3 plaP Low-affinity putrescine importer PlaP Escherichia coli O157:H7
P70423 1.31e-05 51 24 7 217 1 Slc7a3 Cationic amino acid transporter 3 Mus musculus
P30823 3.02e-05 50 24 7 212 2 Slc7a1 High affinity cationic amino acid transporter 1 Rattus norvegicus
Q8WY07 3.52e-05 50 23 6 219 1 SLC7A3 Cationic amino acid transporter 3 Homo sapiens
P44768 4.04e-05 49 24 7 225 3 potE Putrescine transporter PotE Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P76037 4.47e-05 49 23 9 300 1 puuP Putrescine importer PuuP Escherichia coli (strain K12)
Q09143 9.55e-05 48 24 7 212 1 Slc7a1 High affinity cationic amino acid transporter 1 Mus musculus
O87394 0.000121 48 22 10 274 3 R00093 Uncharacterized transporter R00093 Rhizobium meliloti (strain 1021)
P39277 0.00014 47 26 4 149 1 yjeH L-methionine/branched-chain amino acid exporter YjeH Escherichia coli (strain K12)
Q9UM01 0.00023 47 23 13 350 1 SLC7A7 Y+L amino acid transporter 1 Homo sapiens
Q22397 0.000243 47 25 13 339 1 aat-6 Amino acid transporter protein 6 Caenorhabditis elegans
P63350 0.00036 46 22 8 339 3 BQ2027_MB2022C Uncharacterized transporter Mb2022c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQM3 0.00036 46 22 8 339 1 Rv1999c Uncharacterized transporter Rv1999c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM2 0.00036 46 22 8 339 3 MT2055 Uncharacterized transporter MT2055 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q92536 0.000409 46 24 15 350 1 SLC7A6 Y+L amino acid transporter 2 Homo sapiens
P60066 0.000424 46 19 9 380 1 adiC Arginine/agmatine antiporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60065 0.000424 46 19 9 380 3 adiC Arginine/agmatine antiporter Salmonella typhi
Q5PR34 0.000678 45 20 13 444 2 slc7a2 Cationic amino acid transporter 2 Danio rerio
P37034 0.000721 45 22 7 204 3 lpg1691 Uncharacterized transporter lpg1691 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9Z1K8 0.001 45 22 13 345 1 Slc7a7 Y+L amino acid transporter 1 Mus musculus

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_05260
Feature type CDS
Gene ansP
Product L-asparagine transporter or related permease
Location 109414 - 110820 (strand: 1)
Length 1407 (nucleotides) / 468 (amino acids)

Contig

Accession ZDB_682
Length 259781 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_7
Orthogroup size 21
N. genomes 7

Actions

Genomic region

Domains

PF00324 Amino acid permease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1113 Amino acid transport and metabolism (E) E L-asparagine transporter or related permease

Protein Sequence

MSEVQQEQEQTLKRGLKNRHIQLIALGGAVGTGLFLGTATTIQMAGPSVLLGYAVAGFIAFLIMRQLGEMVAEEPVTGSFSHFAHKYWCGFAGFLSGWNYWAMFVLVGMAELTAVGEYIKFWWDVPTWVSAAIFFVLINLVNLVNVKVYGETEFWFAMIKVVAILGMIAFGAYLLISGNGGPQASVSNLWEFGGFMPHGWGGLIFAMAIIMFSFGGLELVGLAAAEAENPRYSIPKAINQVVYRILIFYIGSITVILSLYPWTKIVENVSPFVLIFREIGHAFGAADSVQGNINLWIAHVLNVVVLTAALSVYNSGVYSNSRMLYSLARQGNAPAFLKRISPRGVPVNSIILSGLVTSVGILINYLLPKEAFSLLMSLVVTTLVINWIMICISNLKFRQAKMKEGVEPFFKALWYPWGNYICLVFLAFILVLIALMDGLRISVILLPFWIGFLWLTYRYYERRRAVKA

Flanking regions ( +/- flanking 50bp)

TGCAGTAATGCACGACGCAGAATAATAATATAGCCGTTACAGAGGATCTAATGTCAGAAGTACAGCAGGAGCAGGAGCAGACGCTCAAGCGCGGATTAAAAAACAGACACATACAGCTTATCGCATTGGGTGGTGCTGTGGGTACGGGGCTGTTTCTGGGAACAGCCACAACGATTCAGATGGCGGGGCCTTCTGTCCTGCTCGGTTATGCAGTCGCCGGGTTTATCGCGTTTCTGATCATGCGCCAGCTTGGCGAGATGGTGGCCGAAGAGCCGGTTACCGGGTCATTCAGCCATTTTGCCCATAAATACTGGTGTGGTTTTGCCGGTTTTTTATCCGGCTGGAACTACTGGGCAATGTTTGTTCTGGTGGGCATGGCGGAACTGACGGCAGTCGGCGAGTATATTAAATTCTGGTGGGATGTCCCGACCTGGGTCTCTGCGGCGATCTTTTTCGTGCTGATAAACCTGGTAAACCTGGTAAACGTTAAGGTTTACGGGGAAACTGAATTCTGGTTTGCCATGATCAAAGTGGTGGCCATTCTCGGCATGATTGCCTTTGGTGCTTATCTGCTTATCAGCGGTAACGGCGGCCCGCAGGCGTCTGTCAGTAACCTCTGGGAGTTCGGCGGATTTATGCCGCACGGCTGGGGCGGACTGATTTTCGCAATGGCGATCATTATGTTCTCTTTCGGCGGACTCGAACTGGTCGGTCTGGCGGCAGCGGAAGCGGAAAACCCGCGCTACAGCATTCCGAAAGCTATCAATCAGGTGGTTTACCGTATCCTGATTTTCTATATCGGTTCCATTACCGTTATCCTTTCTCTCTATCCGTGGACAAAAATTGTCGAGAATGTCAGTCCGTTTGTGCTGATCTTCCGTGAAATCGGCCATGCCTTTGGTGCTGCGGATTCTGTGCAGGGCAATATCAATCTGTGGATTGCTCATGTGCTGAACGTGGTGGTACTGACTGCCGCTCTCTCTGTTTACAACAGTGGTGTTTACAGCAACAGCCGCATGCTCTACAGCCTGGCACGTCAGGGTAATGCGCCGGCATTCCTGAAACGCATCAGTCCGCGTGGTGTACCGGTGAACTCGATTATTCTGTCCGGTCTGGTCACCTCAGTGGGGATCCTGATCAACTATCTGCTGCCGAAAGAAGCGTTCTCTCTGCTGATGTCGCTGGTGGTCACCACACTGGTGATTAACTGGATCATGATCTGTATCTCCAACCTGAAATTCCGTCAGGCGAAGATGAAAGAGGGTGTGGAGCCGTTCTTTAAGGCACTGTGGTATCCGTGGGGCAACTATATCTGTCTCGTGTTCCTGGCCTTTATCCTGGTACTGATTGCCCTGATGGATGGTCTGCGGATTTCAGTGATCCTGCTGCCGTTCTGGATTGGCTTCCTGTGGCTGACATACCGCTATTATGAACGCCGCCGTGCAGTGAAAGCATAATGTCAGGCAATAAAAAACCGGGGAAAAAGCCCCGGTTTTTTATGTTTAAA