Homologs in group_459

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00635 FBDBKF_00635 100.0 Morganella morganii S1 fliO flagellar biosynthetic protein FliO
EHELCC_00910 EHELCC_00910 100.0 Morganella morganii S2 fliO flagellar biosynthetic protein FliO
NLDBIP_02550 NLDBIP_02550 100.0 Morganella morganii S4 fliO flagellar biosynthetic protein FliO
LHKJJB_04065 LHKJJB_04065 100.0 Morganella morganii S3 fliO flagellar biosynthetic protein FliO
F4V73_RS06645 F4V73_RS06645 71.3 Morganella psychrotolerans fliO flagellar biosynthetic protein FliO
PMI_RS08005 PMI_RS08005 43.2 Proteus mirabilis HI4320 fliO flagellar biosynthetic protein FliO

Distribution of the homologs in the orthogroup group_459

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_459

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P34199 3.34e-21 86 38 3 129 3 mopB Protein MopB Pectobacterium carotovorum subsp. carotovorum
P0A1L1 7.64e-18 77 43 2 100 1 fliO Flagellar protein FliO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1L2 7.64e-18 77 43 2 100 3 fliO Flagellar protein FliO Salmonella typhi
P22586 1.46e-07 50 45 3 109 3 fliO Flagellar protein FliO Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_02980
Feature type CDS
Gene fliO
Product flagellar biosynthetic protein FliO
Location 202779 - 203246 (strand: -1)
Length 468 (nucleotides) / 155 (amino acids)

Contig

Accession ZDB_680
Length 282413 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_459
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04347 Flagellar biosynthesis protein, FliO

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3190 Cell motility (N) N Flagellar biogenesis protein FliO

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02418 flagellar protein FliO/FliZ Flagellar assembly -

Protein Sequence

MTPTASGTPVLPAAEKTADNAVFSSVALPPPAVGSQAINSTDSLIQVSGALSGIILLILGLTWFVRKFGFTAKLAGKNPLLNIRSTCSLGNKERLVVAEIQGEWLVLGVTAQSVNLLHRCPADPAAVTDAPSAFQALLKTKRTANKDAVPADEPR

Flanking regions ( +/- flanking 50bp)

CACGGATATTATCACCCCGTCTGAACGTATGCGCCGCCTGAGCCGCTGATATGACACCGACCGCATCCGGCACCCCTGTTTTACCGGCCGCAGAGAAAACGGCAGATAATGCCGTTTTTTCTTCCGTCGCCCTGCCGCCGCCCGCAGTGGGTTCTCAGGCGATTAACAGCACGGACAGCCTGATTCAGGTGTCCGGCGCACTCAGCGGCATTATTCTGCTGATCCTGGGACTGACCTGGTTTGTCCGCAAATTCGGCTTTACCGCAAAACTGGCCGGCAAAAATCCGCTGCTGAATATCAGAAGCACCTGTTCTCTGGGAAACAAAGAACGGCTGGTGGTGGCGGAGATTCAGGGTGAATGGCTGGTTCTGGGTGTGACCGCACAGTCGGTTAATCTGCTGCACCGCTGTCCGGCTGACCCGGCGGCGGTAACTGATGCCCCTTCCGCCTTTCAGGCACTGCTGAAAACCAAACGTACCGCAAATAAAGATGCGGTACCGGCTGACGAACCACGCTGAGATTTTTCATGATGTCATTGCTCAAACGCGCCATTCCCGCACTCGCTCTG