Homologs in group_452

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02965 FBDBKF_02965 100.0 Morganella morganii S1 bioD dethiobiotin synthase
EHELCC_03435 EHELCC_03435 100.0 Morganella morganii S2 bioD dethiobiotin synthase
NLDBIP_00025 NLDBIP_00025 100.0 Morganella morganii S4 bioD dethiobiotin synthase
LHKJJB_02010 LHKJJB_02010 100.0 Morganella morganii S3 bioD dethiobiotin synthase
F4V73_RS05405 F4V73_RS05405 91.3 Morganella psychrotolerans bioD dethiobiotin synthase
PMI_RS06230 PMI_RS06230 62.3 Proteus mirabilis HI4320 bioD dethiobiotin synthase

Distribution of the homologs in the orthogroup group_452

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_452

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P69954 4.66e-87 259 55 1 216 3 bioD ATP-dependent dethiobiotin synthetase BioD Yersinia pseudotuberculosis serotype I (strain IP32953)
P69953 4.66e-87 259 55 1 216 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Yersinia pestis
Q8ZPK6 6.11e-86 257 55 1 215 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z6X9 9.36e-86 256 55 1 215 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Salmonella typhi
P0A6E9 2.56e-84 253 53 1 215 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Escherichia coli (strain K12)
P0A6F0 2.56e-84 253 53 1 215 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Escherichia coli O157:H7
Q6LPR5 1.4e-68 213 48 1 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Photobacterium profundum (strain SS9)
Q87QN3 7.85e-68 211 45 1 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MX33 3.94e-67 209 44 1 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Vibrio campbellii (strain ATCC BAA-1116)
B6ESC4 5.74e-66 206 45 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Aliivibrio salmonicida (strain LFI1238)
Q7MLU7 6.47e-66 206 45 1 222 3 bioD ATP-dependent dethiobiotin synthetase BioD Vibrio vulnificus (strain YJ016)
Q8D8N2 6.47e-66 206 45 1 222 3 bioD ATP-dependent dethiobiotin synthetase BioD Vibrio vulnificus (strain CMCP6)
Q9KSZ1 4.06e-65 204 45 2 226 3 bioD ATP-dependent dethiobiotin synthetase BioD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5EUP7 5.02e-65 204 43 2 225 3 bioD ATP-dependent dethiobiotin synthetase BioD Aliivibrio fischeri (strain MJ11)
Q5DZI1 5.02e-65 204 43 2 225 3 bioD ATP-dependent dethiobiotin synthetase BioD Aliivibrio fischeri (strain ATCC 700601 / ES114)
A6VND6 1.67e-62 198 41 4 233 3 bioD ATP-dependent dethiobiotin synthetase BioD Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P45209 1.61e-60 193 44 2 227 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65TU7 3.75e-60 192 40 2 226 3 bioD ATP-dependent dethiobiotin synthetase BioD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CN08 7.56e-60 191 41 3 230 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Pasteurella multocida (strain Pm70)
A9R3D1 8.32e-60 191 44 3 226 3 bioD ATP-dependent dethiobiotin synthetase BioD Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGW9 8.32e-60 191 44 3 226 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Yersinia pestis
Q8X821 1.3e-58 187 42 2 221 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Escherichia coli O157:H7
P13000 4.94e-58 186 42 2 221 1 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Escherichia coli (strain K12)
Q8ZQQ5 7.42e-58 186 42 3 229 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z890 2.4e-57 184 42 3 226 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Salmonella typhi
Q7VLG6 1.3e-56 184 42 2 224 3 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4SPR4 1.01e-54 177 41 2 221 3 bioD ATP-dependent dethiobiotin synthetase BioD Aeromonas salmonicida (strain A449)
A0KIC9 2.9e-54 176 41 2 221 3 bioD ATP-dependent dethiobiotin synthetase BioD Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LDD0 3.87e-54 176 41 2 222 3 bioD ATP-dependent dethiobiotin synthetase BioD Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q1LTL5 4.43e-54 176 43 1 225 3 bioD ATP-dependent dethiobiotin synthetase BioD Baumannia cicadellinicola subsp. Homalodisca coagulata
P36572 1.33e-52 172 42 4 222 3 bioD ATP-dependent dethiobiotin synthetase BioD Serratia marcescens
O06899 1.29e-49 165 40 4 225 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudescherichia vulneris
Q8D298 5.51e-46 155 40 3 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Wigglesworthia glossinidia brevipalpis
B8D982 3.01e-45 153 36 1 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P59564 3.65e-45 153 41 1 201 3 bioD ATP-dependent dethiobiotin synthetase BioD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57377 3.81e-45 153 36 1 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q3IGS9 2.84e-44 150 37 2 206 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudoalteromonas translucida (strain TAC 125)
A1U4A9 9.15e-40 139 37 4 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5NZF8 4.67e-39 137 36 1 218 3 bioD ATP-dependent dethiobiotin synthetase BioD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B4S0P6 7.82e-39 137 39 7 217 3 bioD ATP-dependent dethiobiotin synthetase BioD Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B3PI90 1.33e-38 136 39 2 206 3 bioD ATP-dependent dethiobiotin synthetase BioD Cellvibrio japonicus (strain Ueda107)
Q02TR2 1.79e-36 130 39 2 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1QYD9 3.99e-36 130 36 3 211 3 bioD ATP-dependent dethiobiotin synthetase BioD Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B7V489 5.76e-36 129 39 2 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudomonas aeruginosa (strain LESB58)
A6UYW4 1.22e-35 129 39 2 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudomonas aeruginosa (strain PA7)
Q2Y9Y5 1.98e-35 128 35 2 226 3 bioD ATP-dependent dethiobiotin synthetase BioD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9I614 2.67e-35 128 39 2 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0U3W7 2.72e-32 120 38 3 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Xylella fastidiosa (strain M12)
Q9PAL9 3.13e-32 120 38 3 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Xylella fastidiosa (strain 9a5c)
Q87BG0 7.75e-32 119 38 3 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A9AE45 1.72e-31 118 36 4 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia multivorans (strain ATCC 17616 / 249)
B2JKH5 1.23e-27 108 37 4 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A6SU65 2.46e-27 107 34 4 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Janthinobacterium sp. (strain Marseille)
B2UBJ4 6.49e-27 106 32 1 215 3 bioD ATP-dependent dethiobiotin synthetase BioD Ralstonia pickettii (strain 12J)
Q39CE5 2.02e-26 105 37 4 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A4JIB6 3.18e-26 104 36 5 216 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q5QZ19 3.32e-26 104 32 2 218 3 bioD ATP-dependent dethiobiotin synthetase BioD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B2SQ77 1.42e-25 102 38 3 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7M5 1.42e-25 102 38 3 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4E9L5 2.02e-25 102 35 3 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B2UNC5 2.31e-25 101 33 5 205 3 bioD ATP-dependent dethiobiotin synthetase BioD Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q63Y24 2.52e-25 102 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia pseudomallei (strain K96243)
A3N521 2.98e-25 102 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia pseudomallei (strain 668)
Q3JWR7 2.98e-25 102 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia pseudomallei (strain 1710b)
A3NQS2 2.98e-25 102 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia pseudomallei (strain 1106a)
Q4UQI6 3.3e-25 101 38 2 218 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas campestris pv. campestris (strain 8004)
Q3BP46 4.04e-25 101 35 2 203 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PCW4 5.52e-24 98 36 1 219 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVN9 1.93e-23 97 37 1 215 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas campestris pv. campestris (strain B100)
B5YHS9 5.58e-23 96 33 4 214 3 bioD ATP-dependent dethiobiotin synthetase BioD Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8PGK0 1.17e-22 95 38 1 202 3 bioD ATP-dependent dethiobiotin synthetase BioD Xanthomonas axonopodis pv. citri (strain 306)
Q8XZC2 8.03e-22 92 33 1 215 3 bioD ATP-dependent dethiobiotin synthetase BioD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5X589 5.89e-20 87 32 7 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Legionella pneumophila (strain Paris)
Q9KER6 3.76e-19 85 31 9 219 3 bioD ATP-dependent dethiobiotin synthetase BioD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5IBW5 4.65e-19 85 31 6 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Legionella pneumophila (strain Corby)
Q0BBD5 6.05e-19 85 36 4 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5WWA0 1.16e-18 84 31 7 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Legionella pneumophila (strain Lens)
B1YNS1 2.03e-18 84 37 5 212 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia ambifaria (strain MC40-6)
B1JZE0 3.5e-18 83 34 2 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia orbicola (strain MC0-3)
A7Z5B3 3.68e-18 83 27 5 227 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5ZVG5 4.17e-18 82 30 6 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A1V818 4.2e-18 83 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia mallei (strain SAVP1)
Q62MX0 4.2e-18 83 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia mallei (strain ATCC 23344)
A2S7R2 4.2e-18 83 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia mallei (strain NCTC 10229)
A3MNG2 4.2e-18 83 34 2 220 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia mallei (strain NCTC 10247)
Q1BT35 9.03e-18 82 34 2 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia orbicola (strain AU 1054)
A0KB04 9.03e-18 82 34 2 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia cenocepacia (strain HI2424)
Q2T1Q3 2.05e-17 81 33 2 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1H0L0 3.22e-17 80 31 5 178 3 bioD ATP-dependent dethiobiotin synthetase BioD Endomicrobium trichonymphae
Q65ML0 2.38e-16 78 26 5 223 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B1HRT5 3.98e-16 77 27 6 223 3 bioD ATP-dependent dethiobiotin synthetase BioD Lysinibacillus sphaericus (strain C3-41)
Q8KZM8 3.56e-15 75 26 4 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus subtilis subsp. natto
B0U0S6 6.57e-15 74 26 5 194 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
P53558 1.01e-14 73 26 4 224 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus subtilis (strain 168)
A4IXP2 1.04e-14 73 26 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NGB5 1.04e-14 73 26 4 177 1 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SGE0 1.04e-14 73 26 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14HR7 1.04e-14 73 26 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q635 1.51e-14 73 27 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. novicida (strain U112)
A6QBZ9 1.52e-14 73 30 4 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Sulfurovum sp. (strain NBC37-1)
A1AV54 4.81e-14 71 28 6 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Ruthia magnifica subsp. Calyptogena magnifica
A9A5K8 5.4e-14 72 24 2 206 3 bioD ATP-dependent dethiobiotin synthetase BioD Nitrosopumilus maritimus (strain SCM1)
Q0BLD2 6.57e-14 71 25 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. holarctica (strain OSU18)
Q2A2V6 6.57e-14 71 25 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. holarctica (strain LVS)
A7NCX0 6.57e-14 71 25 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q97JC5 9.91e-14 71 28 8 214 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8FPS0 2.02e-13 70 28 4 205 3 bioD ATP-dependent dethiobiotin synthetase BioD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q58695 5.83e-13 68 29 4 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A1KSZ5 6.62e-13 68 27 4 185 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q5KVI4 1.08e-12 68 28 4 216 3 bioD ATP-dependent dethiobiotin synthetase BioD Geobacillus kaustophilus (strain HTA426)
Q9K085 1.19e-12 67 27 4 185 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5N6Q7 1.38e-12 68 27 4 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E076 1.38e-12 68 27 4 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium kluyveri (strain NBRC 12016)
Q9JV95 1.43e-12 67 26 4 202 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M388 2.01e-12 67 29 4 186 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria meningitidis serogroup C (strain 053442)
B7GHM4 2.59e-12 67 28 8 218 3 bioD ATP-dependent dethiobiotin synthetase BioD Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A5CY11 5.59e-12 66 31 6 183 3 bioD ATP-dependent dethiobiotin synthetase BioD Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B4RJZ8 6.8e-12 65 26 3 199 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria gonorrhoeae (strain NCCP11945)
Q5F9T1 6.8e-12 65 26 3 199 3 bioD ATP-dependent dethiobiotin synthetase BioD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q818W9 9.68e-12 65 26 3 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7IWN2 1.25e-11 65 26 3 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain G9842)
C5D7L1 1.27e-11 65 28 8 214 3 bioD ATP-dependent dethiobiotin synthetase BioD Geobacillus sp. (strain WCH70)
Q635G3 1.67e-11 65 28 6 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain ZK / E33L)
A6UQL8 1.9e-11 64 25 2 174 3 bioD ATP-dependent dethiobiotin synthetase BioD Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q6NHE6 2.49e-11 64 29 3 185 3 bioD ATP-dependent dethiobiotin synthetase BioD Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A4XGB6 3.22e-11 64 25 6 217 3 bioD ATP-dependent dethiobiotin synthetase BioD Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B7HAZ1 3.31e-11 64 26 3 204 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain B4264)
B9MP52 5.6e-11 63 28 5 186 3 bioD ATP-dependent dethiobiotin synthetase BioD Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
P45248 6.41e-11 62 25 5 182 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C1EQZ2 1.07e-10 62 27 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain 03BB102)
A0RIC0 1.07e-10 62 27 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus thuringiensis (strain Al Hakam)
A6UVE3 1.08e-10 62 26 4 191 3 bioD ATP-dependent dethiobiotin synthetase BioD Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q0TQ60 1.31e-10 62 24 2 182 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A7H6E5 1.43e-10 62 29 2 176 3 bioD ATP-dependent dethiobiotin synthetase BioD Anaeromyxobacter sp. (strain Fw109-5)
O66832 1.82e-10 62 31 4 173 3 bioD ATP-dependent dethiobiotin synthetase BioD Aquifex aeolicus (strain VF5)
Q2IM14 2.83e-10 61 31 3 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Anaeromyxobacter dehalogenans (strain 2CP-C)
Q81MA9 6.56e-10 60 26 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis
C3LJP5 6.56e-10 60 26 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P7Q4 6.56e-10 60 26 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus anthracis (strain A0248)
B8J7V5 7.47e-10 60 30 3 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q8RET9 7.94e-10 60 26 7 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1MR97 8.13e-10 60 30 4 175 3 bioD ATP-dependent dethiobiotin synthetase BioD Lawsonia intracellularis (strain PHE/MN1-00)
Q6HE47 8.97e-10 60 26 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus thuringiensis subsp. konkukian (strain 97-27)
O24872 1.36e-09 59 28 3 170 1 bioD ATP-dependent dethiobiotin synthetase BioD Helicobacter pylori (strain ATCC 700392 / 26695)
B8HNL6 1.52e-09 59 28 8 212 3 bioD ATP-dependent dethiobiotin synthetase BioD Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B7JLX3 1.64e-09 59 26 5 209 3 bioD ATP-dependent dethiobiotin synthetase BioD Bacillus cereus (strain AH820)
Q7VL12 1.79e-09 58 25 4 182 3 bioD2 ATP-dependent dethiobiotin synthetase BioD 2 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8YBV9 1.96e-09 58 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RL24 1.96e-09 58 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella melitensis biotype 2 (strain ATCC 23457)
Q577P6 2.08e-09 58 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella abortus biovar 1 (strain 9-941)
Q2YKB6 2.08e-09 58 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella abortus (strain 2308)
B2SBF2 2.08e-09 58 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella abortus (strain S19)
A5FZN7 2.1e-09 58 24 5 208 3 bioD ATP-dependent dethiobiotin synthetase BioD Acidiphilium cryptum (strain JF-5)
B4UKM8 2.71e-09 58 30 3 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Anaeromyxobacter sp. (strain K)
Q216N4 3.12e-09 58 29 6 174 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain BisB18)
C0QVL9 3.85e-09 58 25 4 181 3 bioD ATP-dependent dethiobiotin synthetase BioD Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q8XK60 5.41e-09 57 24 2 182 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium perfringens (strain 13 / Type A)
Q1GT35 6.43e-09 57 26 6 201 3 bioD ATP-dependent dethiobiotin synthetase BioD Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8FWG5 6.59e-09 57 29 6 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella suis biovar 1 (strain 1330)
A9WYH0 6.59e-09 57 29 6 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUF9 6.59e-09 57 29 6 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MBD4 6.59e-09 57 29 6 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A5EFG7 7.1e-09 57 26 6 216 3 bioD ATP-dependent dethiobiotin synthetase BioD Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A0PYU7 8.72e-09 57 27 6 187 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium novyi (strain NT)
Q9ZN34 8.84e-09 57 28 3 170 3 bioD ATP-dependent dethiobiotin synthetase BioD Helicobacter pylori (strain J99 / ATCC 700824)
A0M7A5 2.71e-08 55 27 7 179 3 bioD ATP-dependent dethiobiotin synthetase BioD Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
C4LIG1 5.03e-08 55 25 4 174 3 bioD ATP-dependent dethiobiotin synthetase BioD Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
B2UW31 5.23e-08 55 28 4 185 3 bioD ATP-dependent dethiobiotin synthetase BioD Helicobacter pylori (strain Shi470)
P22818 6.32e-08 55 28 7 243 3 bioD ATP-dependent dethiobiotin synthetase BioD Lysinibacillus sphaericus
Q7MAC6 1.04e-07 54 25 2 167 3 bioD ATP-dependent dethiobiotin synthetase BioD Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8KGC0 1.47e-07 53 26 4 177 3 bioD ATP-dependent dethiobiotin synthetase BioD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A6X2S6 1.72e-07 53 26 2 166 3 bioD ATP-dependent dethiobiotin synthetase BioD Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9AMS4 1.86e-07 53 27 4 166 3 bioD ATP-dependent dethiobiotin synthetase BioD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A8L2N1 2.06e-07 53 31 9 206 3 bioD ATP-dependent dethiobiotin synthetase BioD Parafrankia sp. (strain EAN1pec)
Q07L51 2.4e-07 53 29 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain BisA53)
B0SZT0 4.04e-07 52 30 5 156 3 bioD ATP-dependent dethiobiotin synthetase BioD Caulobacter sp. (strain K31)
B3EJS3 4.1e-07 53 28 8 227 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain BS1)
Q8EI15 6.97e-07 52 22 5 227 3 cobQ Cobyric acid synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3SPW7 7.44e-07 51 27 5 170 3 bioD ATP-dependent dethiobiotin synthetase BioD Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2W3K9 1.13e-06 51 26 5 173 3 bioD ATP-dependent dethiobiotin synthetase BioD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2GDE9 1.51e-06 51 25 8 222 3 bioD ATP-dependent dethiobiotin synthetase BioD Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q02JB8 1.52e-06 51 26 7 225 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9I467 1.73e-06 51 26 7 225 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CQD8 1.84e-06 50 25 5 167 3 bioD ATP-dependent dethiobiotin synthetase BioD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKF0 1.84e-06 50 25 5 167 3 bioD ATP-dependent dethiobiotin synthetase BioD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B7UWH3 1.85e-06 51 26 7 225 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain LESB58)
Q2SNC4 2.59e-06 51 23 5 225 3 cobQ Cobyric acid synthase Hahella chejuensis (strain KCTC 2396)
Q6N5K3 2.95e-06 50 27 4 173 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A6V8T2 4.09e-06 50 26 7 225 3 cobQ Cobyric acid synthase Pseudomonas aeruginosa (strain PA7)
B3Q7Q5 4.33e-06 49 28 4 167 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain TIE-1)
B6JGN8 5.51e-06 49 25 5 178 3 bioD ATP-dependent dethiobiotin synthetase BioD Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
C1DPP2 6.18e-06 50 25 6 223 3 cobQ Cobyric acid synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q885W8 6.36e-06 50 23 6 224 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B5ZT17 6.9e-06 49 25 6 227 3 cobQ Cobyric acid synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B7K5E6 7.29e-06 48 25 5 210 3 bioD ATP-dependent dethiobiotin synthetase BioD Rippkaea orientalis (strain PCC 8801 / RF-1)
A1S3L6 7.56e-06 49 24 5 227 3 cobQ Cobyric acid synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1WZW5 7.66e-06 48 26 6 240 3 bioD ATP-dependent dethiobiotin synthetase BioD Crocosphaera subtropica (strain ATCC 51142 / BH68)
B4SH62 8.18e-06 49 25 6 225 3 cobQ Cobyric acid synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q2GAF9 8.76e-06 48 29 6 167 3 bioD ATP-dependent dethiobiotin synthetase BioD Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q9FCC1 9.21e-06 48 30 7 202 3 bioD ATP-dependent dethiobiotin synthetase BioD Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q97JB2 9.23e-06 49 24 6 240 3 cobQ Cobyric acid synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B6ES52 1.03e-05 49 25 6 228 3 cobQ Cobyric acid synthase Aliivibrio salmonicida (strain LFI1238)
Q2KXN6 1.04e-05 49 23 5 205 3 bioCD Biotin biosynthesis bifunctional protein BioCD Bordetella avium (strain 197N)
Q55849 1.34e-05 48 24 6 221 1 bioD ATP-dependent dethiobiotin synthetase BioD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1MFE8 1.94e-05 48 25 6 227 3 cobQ Cobyric acid synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q11QU6 2.15e-05 47 25 6 176 3 bioD ATP-dependent dethiobiotin synthetase BioD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B2JER3 2.16e-05 48 24 5 222 3 cobQ Cobyric acid synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q4ZQ64 2.46e-05 48 23 6 224 3 cobQ Cobyric acid synthase Pseudomonas syringae pv. syringae (strain B728a)
Q21P75 2.91e-05 47 24 9 236 3 cobQ Cobyric acid synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1KBC7 2.92e-05 47 22 6 223 3 cobQ Cobyric acid synthase Azoarcus sp. (strain BH72)
Q051U4 2.95e-05 47 24 3 166 3 bioD ATP-dependent dethiobiotin synthetase BioD Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04RS7 2.95e-05 47 24 3 166 3 bioD ATP-dependent dethiobiotin synthetase BioD Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q474Y6 3.08e-05 47 23 7 223 3 cobQ Cobyric acid synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1GXH3 3.18e-05 47 22 5 222 3 cobQ Cobyric acid synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
C3KZ35 3.86e-05 47 23 6 207 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain 657 / Type Ba4)
Q2K7B5 3.9e-05 47 24 6 227 3 cobQ Cobyric acid synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q48FJ7 3.98e-05 47 23 6 224 3 cobQ Cobyric acid synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2IRY0 4.03e-05 46 26 5 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain HaA2)
Q8UBP3 4.28e-05 47 27 7 200 3 cobQ Cobyric acid synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
B5ET63 4.39e-05 47 25 6 228 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain MJ11)
Q5E0T7 5.37e-05 47 25 6 228 3 cobQ Cobyric acid synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8F4A0 9.02e-05 45 24 5 168 3 bioD ATP-dependent dethiobiotin synthetase BioD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RG6 9.02e-05 45 24 5 168 3 bioD ATP-dependent dethiobiotin synthetase BioD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A5V5Q4 9.19e-05 45 23 3 166 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
C5DAP4 9.45e-05 46 22 6 224 3 cobQ Cobyric acid synthase Geobacillus sp. (strain WCH70)
Q1IDJ9 9.87e-05 46 24 6 223 3 cobQ Cobyric acid synthase Pseudomonas entomophila (strain L48)
A3CX25 0.000103 46 24 8 236 3 cobQ Probable cobyric acid synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q8PHR1 0.000117 46 25 5 225 3 cobQ Cobyric acid synthase Xanthomonas axonopodis pv. citri (strain 306)
B2T167 0.000135 45 23 5 222 3 cobQ Cobyric acid synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B0KT65 0.000141 45 25 8 249 3 cobQ Cobyric acid synthase Pseudomonas putida (strain GB-1)
B4S8A8 0.000147 45 22 6 228 3 cobQ Cobyric acid synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A6UAC0 0.000153 45 24 6 227 3 cobQ Cobyric acid synthase Sinorhizobium medicae (strain WSM419)
Q89Q71 0.000154 45 24 8 200 3 cobQ Cobyric acid synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1J1N6 0.000182 45 24 6 223 3 cobQ Cobyric acid synthase Pseudomonas putida (strain W619)
Q43989 0.000183 45 23 8 240 3 cobQ Cobyric acid synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1BFI0 0.000193 45 25 6 223 3 cobQ Cobyric acid synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A7GFJ8 0.00021 44 25 7 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q9KLL6 0.000213 45 21 5 228 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5EZT5 0.000213 45 21 5 228 3 cobQ Cobyric acid synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q0VLY5 0.000214 45 23 6 223 3 cobQ Cobyric acid synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q130N3 0.000224 44 24 4 170 3 bioD ATP-dependent dethiobiotin synthetase BioD Rhodopseudomonas palustris (strain BisB5)
A4VJ40 0.000238 45 24 5 224 3 cobQ Cobyric acid synthase Stutzerimonas stutzeri (strain A1501)
B1IHH8 0.000251 44 25 7 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain Okra / Type B1)
A5W7Q6 0.000278 45 25 7 223 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q605I0 0.000303 45 25 6 223 3 cobQ Cobyric acid synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1KW07 0.000327 44 24 7 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain Loch Maree / Type A3)
B1MBZ5 0.000335 43 29 8 221 3 bioD ATP-dependent dethiobiotin synthetase BioD Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q9Z6L7 0.000376 43 22 4 172 3 bioD ATP-dependent dethiobiotin synthetase BioD Chlamydia pneumoniae
Q3AE11 0.000382 44 25 9 246 3 cobQ Cobyric acid synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A8I5C0 0.00039 44 23 6 228 3 cobQ Cobyric acid synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5I426 0.000409 43 25 7 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVS5 0.000409 43 25 7 192 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain ATCC 19397 / Type A)
Q0BCS3 0.000436 44 22 6 223 3 cobQ Cobyric acid synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2IE16 0.000452 44 25 8 236 3 cobQ Cobyric acid synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q88M97 0.000536 44 25 7 223 3 cobQ Cobyric acid synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B3PQX7 0.000615 43 24 6 227 3 cobQ Cobyric acid synthase Rhizobium etli (strain CIAT 652)
A4JGX5 0.000617 43 23 6 223 3 cobQ Cobyric acid synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A6SWZ4 0.000617 43 22 5 222 3 cobQ Cobyric acid synthase Janthinobacterium sp. (strain Marseille)
A4G3R6 0.000656 43 23 5 223 3 cobQ Cobyric acid synthase Herminiimonas arsenicoxydans
Q4K8B9 0.000667 43 25 6 224 3 cobQ Cobyric acid synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q47JS8 0.000669 43 24 7 223 3 cobQ Cobyric acid synthase Dechloromonas aromatica (strain RCB)
Q167R8 0.000672 43 22 6 228 3 cobQ Cobyric acid synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A0PP03 0.000706 43 28 8 187 3 bioD ATP-dependent dethiobiotin synthetase BioD Mycobacterium ulcerans (strain Agy99)
Q1GPG1 0.000766 43 22 7 227 3 cobQ Cobyric acid synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
C1FR34 0.000802 43 24 6 186 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium botulinum (strain Kyoto / Type A2)
A4XT53 0.001 43 25 7 223 3 cobQ Cobyric acid synthase Pseudomonas mendocina (strain ymp)
Q893G4 0.001 42 23 4 184 3 bioD ATP-dependent dethiobiotin synthetase BioD Clostridium tetani (strain Massachusetts / E88)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_02050
Feature type CDS
Gene bioD
Product dethiobiotin synthase
Location 392293 - 392982 (strand: -1)
Length 690 (nucleotides) / 229 (amino acids)
In genomic island -

Contig

Accession ZDB_679
Length 398279 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_452
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13500 AAA domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0132 Coenzyme transport and metabolism (H) H Dethiobiotin synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MLRRLFITGTDTNIGKTVATRALMQAINRLGKSVVGYKPIATEYHDTLNGKRNRDAMILHDSSSVDVSYQDINPVMLESNYGQTTTDVQFPALSQGLEKLSHLADQVVVEGNGGWRYLLNNETFLSDWVKKEKLPVILVVGIQSGCVNHALLTAEAIKNDGLEIIGWIANRINPGLSHYAQVMDRLLTHLPAPLLGEIPYLLRPEERELSHYLNEEQIEMLWGEALAAS

Flanking regions ( +/- flanking 50bp)

TTCCGTTATCAATTTTGATACGCACCTCTTGATATAACGGAAAAACATCTATGTTAAGGCGCTTGTTTATAACCGGCACAGATACGAATATCGGCAAAACTGTTGCGACGCGGGCTTTAATGCAAGCCATCAACCGCCTGGGTAAATCTGTCGTTGGCTATAAACCAATCGCGACAGAATACCACGACACACTTAACGGCAAACGTAACCGTGACGCGATGATCCTGCATGATTCATCATCAGTTGATGTTTCTTATCAGGATATCAACCCGGTCATGCTGGAAAGTAATTACGGTCAGACGACGACCGACGTTCAGTTTCCTGCATTATCGCAGGGTCTGGAAAAATTAAGTCATCTGGCGGATCAGGTCGTGGTGGAAGGGAACGGCGGATGGCGTTATTTACTGAATAACGAGACTTTTTTATCCGACTGGGTGAAAAAGGAAAAACTGCCGGTGATCCTGGTGGTCGGGATCCAGTCCGGTTGTGTGAACCATGCATTATTAACCGCCGAAGCCATTAAAAATGATGGTCTGGAAATTATCGGCTGGATTGCGAACCGGATAAACCCGGGCTTATCACACTACGCACAGGTTATGGATCGCTTACTGACGCATTTACCGGCACCACTGCTGGGCGAGATCCCGTATCTGCTGCGCCCGGAAGAGCGGGAGTTGTCGCACTATCTCAATGAAGAGCAGATTGAGATGCTCTGGGGTGAGGCGTTAGCAGCGTCCTGAGTCTCCGGTAAGAAATACAAAAGGGCTGATAAATCAGCCCTTTTTCATGG