Homologs in group_2539

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02000 FBDBKF_02000 100.0 Morganella morganii S1 - Adenylate cyclase
EHELCC_02470 EHELCC_02470 100.0 Morganella morganii S2 - Adenylate cyclase
NLDBIP_00990 NLDBIP_00990 100.0 Morganella morganii S4 - Adenylate cyclase
LHKJJB_01045 LHKJJB_01045 100.0 Morganella morganii S3 - Adenylate cyclase
F4V73_RS04365 F4V73_RS04365 67.7 Morganella psychrotolerans - leucine-rich repeat domain-containing protein

Distribution of the homologs in the orthogroup group_2539

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2539

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6GPJ5 1.36e-33 132 32 2 238 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 2.4e-26 111 32 5 276 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 9.43e-20 92 28 3 240 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 1.5e-13 73 25 7 289 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 3.8e-11 67 28 2 166 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 9.84e-10 62 21 4 321 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q6GPJ5 9.19e-05 47 22 3 179 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus laevis
Q5M8G4 1.45e-33 132 33 2 238 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 1.31e-25 109 31 5 276 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 5.67e-20 93 28 3 240 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 5.29e-11 66 24 8 292 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 1.12e-07 56 24 3 182 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q5M8G4 6.91e-05 47 22 4 202 2 lrrc40 Leucine-rich repeat-containing protein 40 Xenopus tropicalis
Q54AX5 3.31e-33 130 34 2 247 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 1.06e-28 117 30 3 279 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 3.18e-23 102 25 2 282 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q54AX5 5.39e-19 90 29 4 251 1 lrrA Leucine-rich repeat protein lrrA Dictyostelium discoideum
Q9H9A6 2.17e-30 123 32 3 247 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 7.22e-20 92 29 0 219 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 6.06e-19 90 30 6 256 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 1.15e-14 77 27 7 275 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q9H9A6 4.68e-06 51 28 4 174 1 LRRC40 Leucine-rich repeat-containing protein 40 Homo sapiens
Q5RFE9 5.86e-30 122 31 3 247 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 5.49e-20 93 29 0 219 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 6.23e-19 90 30 6 256 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 1.5e-16 83 25 9 331 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 4.72e-15 78 27 7 275 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q5RFE9 2.36e-06 52 23 3 191 2 LRRC40 Leucine-rich repeat-containing protein 40 Pongo abelii
Q4R3P6 6.09e-30 122 31 3 247 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 3.24e-20 94 29 0 219 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 2.7e-19 91 30 6 256 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 3.75e-17 84 25 9 331 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 2.45e-14 76 27 7 275 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q4R3P6 1.3e-05 50 23 3 191 2 LRRC40 Leucine-rich repeat-containing protein 40 Macaca fascicularis
Q7SXW3 7.96e-30 121 30 4 298 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 1.35e-27 115 32 2 237 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 4.72e-20 93 29 1 227 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 1.16e-15 80 22 6 332 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 9.41e-11 65 23 7 295 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 2.56e-08 58 27 4 196 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 3.67e-06 51 25 3 171 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 4.29e-05 48 38 0 72 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7SXW3 6.24e-05 47 26 2 146 2 lrrc40 Leucine-rich repeat-containing protein 40 Danio rerio
Q7KRY7 1.09e-29 122 33 0 233 1 scrib Protein lap4 Drosophila melanogaster
Q7KRY7 4.97e-26 111 32 1 231 1 scrib Protein lap4 Drosophila melanogaster
Q7KRY7 7.44e-24 105 30 2 267 1 scrib Protein lap4 Drosophila melanogaster
Q5F4C4 1.3e-29 120 35 1 227 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 2.45e-23 102 26 2 283 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.91e-22 100 32 4 225 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 3.43e-20 93 30 2 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.2e-19 92 28 3 240 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 1.17e-18 89 27 4 241 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 4.94e-15 78 34 1 138 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5F4C4 6.73e-06 50 31 0 115 2 SHOC2 Leucine-rich repeat protein SHOC-2 Gallus gallus
Q5ZLN0 2.66e-29 120 32 2 239 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 1.98e-28 117 32 3 256 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 1.56e-24 106 30 2 242 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 2.58e-19 91 26 10 338 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 1.12e-16 83 30 0 176 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 7.53e-14 75 25 6 276 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 5.28e-11 66 30 3 147 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
Q5ZLN0 2.45e-10 64 24 7 295 2 LRRC40 Leucine-rich repeat-containing protein 40 Gallus gallus
O61967 9.74e-29 119 31 1 276 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 6.4e-28 116 30 1 267 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 1.03e-17 86 29 2 241 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 7.52e-14 75 25 2 230 1 let-413 Protein lap1 Caenorhabditis elegans
O61967 3.86e-12 70 25 0 196 1 let-413 Protein lap1 Caenorhabditis elegans
Q1L8Y7 5.33e-28 116 35 2 249 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 1.62e-20 94 33 2 182 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 2.2e-20 94 27 3 292 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 3.18e-19 90 32 5 243 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 9.85e-16 80 25 2 270 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 4.69e-14 75 27 3 240 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 3.85e-09 60 41 0 89 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
Q1L8Y7 6.12e-08 57 29 1 159 2 shoc2 Leucine-rich repeat protein SHOC-2 Danio rerio
A7SFP1 8.45e-28 115 32 0 219 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 6.1e-22 99 27 3 265 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.01e-20 95 28 1 232 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.87e-17 85 27 4 271 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.42e-14 77 28 1 204 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.97e-12 70 30 1 151 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
A7SFP1 1.92e-08 58 30 1 133 3 v1g189306 Leucine-rich repeat protein soc-2 homolog Nematostella vectensis
Q22875 2.17e-27 114 32 0 205 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 2e-25 108 30 0 220 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 3.13e-22 99 26 4 294 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 9.47e-19 89 26 2 293 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 1.12e-15 80 28 2 210 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 9.5e-13 71 28 2 198 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
Q22875 1.49e-10 65 26 4 242 1 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis elegans
O88520 2.73e-27 114 33 1 210 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 1.5e-26 112 36 1 208 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 5.14e-21 96 26 2 292 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 2.85e-20 94 32 2 182 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 1.3e-19 92 32 5 243 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 1.92e-14 76 28 4 241 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
O88520 3.7e-08 57 29 1 159 1 Shoc2 Leucine-rich repeat protein SHOC-2 Mus musculus
Q9BTT6 2.77e-27 114 32 0 237 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 8.63e-26 109 33 0 234 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 5.64e-25 107 28 0 242 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 7.83e-21 95 30 1 230 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q9BTT6 2.33e-15 79 29 1 199 1 LRRC1 Leucine-rich repeat-containing protein 1 Homo sapiens
Q6AYI5 3.51e-27 114 34 0 196 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 5.43e-27 113 34 3 245 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 8.99e-21 95 32 2 182 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 1.51e-20 94 25 2 292 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 1.46e-19 92 32 5 243 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 1.62e-18 89 28 4 257 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 7.02e-13 72 24 2 270 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
Q6AYI5 5.04e-08 57 33 0 126 2 Shoc2 Leucine-rich repeat protein SHOC-2 Rattus norvegicus
P70587 5.33e-27 114 29 1 262 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 1.38e-25 110 29 0 231 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 7.62e-21 95 32 0 214 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
P70587 7.82e-17 84 29 1 205 1 Lrrc7 Leucine-rich repeat-containing protein 7 Rattus norvegicus
Q80TE7 5.38e-27 114 29 1 262 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 1.4e-25 110 29 0 231 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 8.37e-21 95 32 0 214 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
Q80TE7 7.67e-17 84 29 1 205 1 Lrrc7 Leucine-rich repeat-containing protein 7 Mus musculus
A4D1F6 5.7e-27 114 32 0 243 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 1.3e-26 112 28 2 263 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 6.84e-21 95 30 1 228 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 8.74e-21 95 25 0 239 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 6.6e-20 93 26 0 245 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 1.2e-18 89 26 1 260 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 2.32e-17 85 26 3 252 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 9.69e-16 80 27 0 237 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 1.62e-14 77 26 1 211 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 5.94e-14 75 27 2 210 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
A4D1F6 2.51e-06 52 29 0 124 1 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Homo sapiens
Q5RAV5 5.86e-27 113 33 1 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 4.72e-26 110 36 1 208 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 8.66e-21 95 32 2 182 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 9.25e-21 95 25 2 306 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 1.26e-19 92 32 5 243 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 8.03e-15 77 28 4 241 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q5RAV5 4.65e-08 57 30 1 155 2 SHOC2 Leucine-rich repeat protein SHOC-2 Pongo abelii
Q9UQ13 5.86e-27 113 33 1 210 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 4.72e-26 110 36 1 208 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 8.66e-21 95 32 2 182 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 9.25e-21 95 25 2 306 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 1.26e-19 92 32 5 243 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 8.03e-15 77 28 4 241 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
Q9UQ13 4.65e-08 57 30 1 155 1 SHOC2 Leucine-rich repeat protein SHOC-2 Homo sapiens
A6QLV3 5.86e-27 113 33 1 210 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 5.09e-26 110 36 1 208 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 8.66e-21 95 32 2 182 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 9.16e-21 95 25 2 306 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 1.29e-19 92 32 5 243 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 8.26e-15 77 28 4 241 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
A6QLV3 4.69e-08 57 30 1 155 2 SHOC2 Leucine-rich repeat protein SHOC-2 Bos taurus
Q4R6F0 6.65e-27 113 32 0 243 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 3.47e-25 108 27 2 263 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.65e-21 97 30 1 233 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 8.91e-21 95 25 0 239 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.34e-20 95 27 1 253 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 8.13e-18 87 24 0 237 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 1.22e-17 86 28 4 253 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 4.42e-17 84 27 0 237 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 2.07e-14 77 26 1 211 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 3.52e-11 67 25 2 213 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
Q4R6F0 9.09e-07 53 30 0 124 2 LRRD1 Leucine-rich repeat and death domain-containing protein 1 Macaca fascicularis
A6NIV6 7.85e-27 112 27 2 273 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 1.74e-25 108 28 1 255 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 2.7e-22 99 28 2 282 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 1.85e-14 76 27 4 276 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
A6NIV6 1.37e-13 74 27 2 176 1 LRRIQ4 Leucine-rich repeat and IQ domain-containing protein 4 Homo sapiens
Q80TH2 9.96e-27 113 29 1 260 1 Erbin Erbin Mus musculus
Q80TH2 1.59e-25 109 27 0 238 1 Erbin Erbin Mus musculus
Q80TH2 1.05e-23 104 25 0 259 1 Erbin Erbin Mus musculus
Q80TH2 7.76e-18 87 31 2 205 1 Erbin Erbin Mus musculus
Q80TH2 3.43e-15 79 26 1 223 1 Erbin Erbin Mus musculus
Q80TH2 5.94e-11 66 25 1 219 1 Erbin Erbin Mus musculus
Q96RT1 1.25e-26 112 28 0 238 1 ERBIN Erbin Homo sapiens
Q96RT1 1.94e-26 112 30 2 260 1 ERBIN Erbin Homo sapiens
Q96RT1 5.14e-19 90 29 0 214 1 ERBIN Erbin Homo sapiens
Q96RT1 7.7e-18 87 31 2 205 1 ERBIN Erbin Homo sapiens
Q96RT1 1.32e-15 80 26 1 223 1 ERBIN Erbin Homo sapiens
Q96RT1 3.28e-11 67 26 1 219 1 ERBIN Erbin Homo sapiens
Q8AVI4 2.5e-26 111 33 1 248 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 5.39e-24 104 32 5 243 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 8.93e-23 101 27 3 280 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 3.21e-21 96 33 2 182 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 9.61e-19 89 28 3 240 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8AVI4 9.48e-08 56 30 1 149 2 shoc2 Leucine-rich repeat protein SHOC-2 Xenopus laevis
Q8C0R9 3.62e-26 111 28 0 236 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 5e-26 111 31 0 238 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 8.99e-26 110 27 1 278 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 1.49e-24 106 25 1 277 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 7.01e-24 104 28 2 267 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 6.22e-23 102 30 2 230 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 1.1e-22 101 26 0 237 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 6.47e-22 99 26 2 291 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 6.76e-21 95 28 0 230 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 1.01e-20 95 27 0 245 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 1.95e-18 89 24 0 267 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 5.16e-14 75 27 1 194 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8C0R9 4.44e-08 57 29 2 147 2 Lrrd1 Leucine-rich repeat and death domain-containing protein 1 Mus musculus
Q8S7M7 7.27e-26 110 30 1 239 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 1.87e-23 103 30 1 226 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 2.15e-22 100 29 0 224 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 2.61e-13 73 28 0 168 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 4.67e-12 69 30 2 169 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 6.26e-11 66 35 2 141 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q8S7M7 6.41e-07 53 30 2 131 2 IRL5 Plant intracellular Ras-group-related LRR protein 5 Oryza sativa subsp. japonica
Q96NW7 1.02e-25 110 28 1 260 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 1.37e-24 107 28 0 231 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 3.67e-21 97 32 0 214 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 6.71e-19 90 26 1 257 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q96NW7 4.45e-16 82 29 1 205 1 LRRC7 Leucine-rich repeat-containing protein 7 Homo sapiens
Q9CRC8 1.27e-25 109 30 3 247 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 2.8e-19 91 33 0 176 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 9.75e-18 86 30 3 248 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 5.02e-17 84 26 8 299 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 1.09e-15 80 25 8 307 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 1.06e-14 77 27 5 263 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 9.61e-09 59 25 3 191 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q9CRC8 3.25e-08 58 29 2 169 1 Lrrc40 Leucine-rich repeat-containing protein 40 Mus musculus
Q80VQ1 1.42e-25 108 32 0 218 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 7.05e-25 107 33 0 227 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 1.06e-22 100 30 0 242 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 1.05e-19 92 31 1 230 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q80VQ1 7e-15 77 29 1 199 1 Lrrc1 Leucine-rich repeat-containing protein 1 Mus musculus
Q4H4B6 1.87e-25 109 29 1 261 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 2.01e-22 100 29 1 267 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 2.45e-20 94 31 0 205 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 2.22e-15 80 32 1 211 1 scrib Protein scribble homolog Danio rerio
Q4H4B6 3.04e-05 49 38 1 70 1 scrib Protein scribble homolog Danio rerio
Q9Y4C4 2.24e-25 109 32 0 214 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 4.03e-24 105 30 1 239 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 6.07e-23 102 29 3 297 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 6.71e-21 96 31 2 230 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
Q9Y4C4 3.07e-08 58 29 0 147 1 MFHAS1 Malignant fibrous histiocytoma-amplified sequence 1 Homo sapiens
B4LXW1 2.57e-25 108 29 1 251 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 9.54e-24 104 27 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 2.83e-22 99 28 2 250 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 5.55e-22 99 28 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 1.66e-21 97 30 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 1.27e-18 89 28 3 270 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 4.16e-12 69 31 1 151 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B4LXW1 1.11e-05 50 34 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila virilis
B0W6M9 2.9e-25 108 31 0 196 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 5.67e-24 104 31 0 219 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.4e-23 103 27 2 269 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 9.38e-20 92 27 4 257 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 9.83e-20 92 33 0 155 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 2.79e-18 88 28 4 270 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 2.55e-12 70 28 1 171 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.16e-11 68 25 4 247 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B0W6M9 1.06e-07 56 40 0 89 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Culex quinquefasciatus
B5DX45 6.99e-25 107 32 0 200 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 7.41e-24 104 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 1.47e-23 103 30 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 4.05e-22 99 31 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 5.93e-21 95 28 3 240 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 1.22e-16 83 27 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 1.27e-06 53 34 1 110 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B5DX45 1.75e-06 52 23 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila pseudoobscura pseudoobscura
B4N9T4 8.46e-25 107 27 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 6.11e-24 104 31 0 200 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 1.75e-22 100 29 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 6.23e-22 99 30 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 1.92e-19 91 27 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 4.6e-19 90 28 3 270 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 2.04e-16 82 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 4.36e-07 54 35 1 110 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
B4N9T4 4.91e-06 51 30 1 124 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila willistoni
Q6K7R2 1e-24 107 33 3 246 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 1.13e-18 89 28 2 248 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 8.4e-13 72 26 2 199 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 6.21e-11 66 26 7 311 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
Q6K7R2 0.000151 46 30 5 228 2 IRL6 Plant intracellular Ras-group-related LRR protein 6 Oryza sativa subsp. japonica
B4JTV9 1.05e-24 107 29 1 249 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 5.76e-23 102 27 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 8.18e-22 98 28 2 250 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 4.36e-21 96 30 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 1.21e-20 95 28 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 8.07e-18 86 28 3 270 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 8.75e-12 68 31 1 151 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4JTV9 1.12e-05 50 34 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila grimshawi
B4IBI9 1.57e-24 106 31 0 200 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 3.42e-24 105 29 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 2.21e-23 103 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 1.16e-22 101 28 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 3.8e-22 99 31 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 2.64e-18 88 26 4 319 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 1.33e-15 80 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 2.6e-06 52 35 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B4IBI9 4.38e-06 51 23 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila sechellia
B0M0P8 1.67e-24 107 30 1 223 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 4.48e-23 102 30 1 239 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 4.36e-14 76 27 4 225 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 1.87e-09 62 26 3 178 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
B0M0P8 1.03e-05 50 31 0 104 2 gefL Ras guanine nucleotide exchange factor L Dictyostelium discoideum
Q01513 1.68e-24 107 32 5 240 3 None Adenylate cyclase Podospora anserina
Q01513 1.4e-17 86 30 4 204 3 None Adenylate cyclase Podospora anserina
Q01513 6.73e-09 60 23 3 212 3 None Adenylate cyclase Podospora anserina
Q01513 1.25e-06 53 24 5 271 3 None Adenylate cyclase Podospora anserina
Q01513 4.09e-05 48 24 3 153 3 None Adenylate cyclase Podospora anserina
Q6Z8P4 2.41e-24 105 29 1 238 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 2.71e-22 99 28 2 221 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 4.77e-21 96 28 2 248 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 1.01e-14 77 37 1 116 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 1.34e-11 68 26 1 188 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 4.19e-10 63 24 1 192 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q6Z8P4 1.23e-09 62 23 0 168 2 IRL4 Plant intracellular Ras-group-related LRR protein 4 Oryza sativa subsp. japonica
Q9SVW8 3.58e-24 105 32 3 268 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 3.81e-22 99 29 3 264 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 9.46e-12 68 25 3 188 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 3.59e-11 67 37 1 116 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 3.23e-10 63 28 0 155 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 3.95e-09 60 26 1 166 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
Q9SVW8 1.98e-08 58 28 2 157 1 PIRL4 Plant intracellular Ras-group-related LRR protein 4 Arabidopsis thaliana
B4QVR7 3.71e-24 105 31 1 207 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 5.52e-24 105 30 1 229 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 2.4e-23 103 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 4.63e-22 99 31 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 5.97e-22 99 27 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 5.68e-18 87 26 4 319 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 1.35e-15 80 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 7.22e-08 57 37 1 107 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B4QVR7 4.15e-06 51 23 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila simulans
B3LWU3 5.05e-24 105 30 0 200 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 5.79e-23 102 29 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 1.31e-22 100 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 8.84e-21 95 26 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 2.31e-20 94 29 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 6.48e-18 87 27 3 270 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 6.62e-16 81 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 8.49e-07 53 35 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
B3LWU3 1.73e-06 52 24 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila ananassae
Q9V780 7.48e-24 104 30 1 259 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 3.33e-21 97 26 1 256 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 1.03e-19 92 28 2 254 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 6.59e-16 81 27 1 201 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 6.1e-13 72 26 0 198 2 Lap1 Protein lap1 Drosophila melanogaster
Q9V780 3.7e-08 58 26 0 136 2 Lap1 Protein lap1 Drosophila melanogaster
B4PU77 7.64e-24 104 29 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 2.15e-23 103 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 3.86e-22 99 31 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 6.31e-22 99 27 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 5.29e-18 87 26 4 319 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 1.32e-15 80 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 2.49e-07 55 36 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
B4PU77 3.63e-06 51 23 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila yakuba
Q5G5E0 8.22e-24 103 30 1 211 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 1.41e-23 103 30 1 239 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 8.07e-19 89 28 1 239 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 2.56e-12 70 25 1 195 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 3.48e-11 67 25 4 219 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 1.19e-09 62 27 0 151 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q5G5E0 8.24e-09 59 36 1 116 2 PIRL5 Plant intracellular Ras-group-related LRR protein 5 Arabidopsis thaliana
Q9VEK6 8.93e-24 104 29 1 231 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 2e-23 103 26 1 292 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 3.3e-22 99 31 5 248 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 6.78e-22 99 27 1 232 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 5.18e-18 87 26 4 319 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 6.5e-16 81 26 4 252 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 2.49e-07 55 36 0 93 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
Q9VEK6 3.11e-06 52 23 2 184 2 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila melanogaster
F1MCA7 1.37e-23 103 28 2 260 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 1.67e-22 100 28 1 231 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 1.04e-19 92 32 1 214 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 3.66e-16 82 29 1 200 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
F1MCA7 3.4e-06 52 27 1 150 3 LRRC7 Leucine-rich repeat-containing protein 7 Bos taurus
Q3V1N1 1.84e-23 103 31 2 270 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 1.4e-21 98 32 0 214 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 3.04e-21 97 32 4 259 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 2.99e-20 94 30 1 239 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
Q3V1N1 5.67e-08 57 27 0 147 1 Mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Mus musculus
B3P3E8 2.32e-23 103 29 1 231 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 6.95e-23 101 26 1 292 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 6.86e-22 99 27 1 232 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 1.09e-21 98 30 5 248 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 1.05e-17 86 26 4 293 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 1.67e-15 80 26 4 252 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 2.22e-07 55 36 0 93 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
B3P3E8 5.29e-06 51 23 2 184 3 Sur-8 Leucine-rich repeat protein soc-2 homolog Drosophila erecta
Q9LRV8 2.38e-23 102 30 4 262 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 2.18e-17 85 29 2 203 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 1.32e-10 65 33 1 117 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
Q9LRV8 4.36e-09 60 25 2 180 2 PIRL2 Plant intracellular Ras-group-related LRR protein 2 Arabidopsis thaliana
A6H6A4 2.87e-23 102 28 6 301 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 1.66e-20 94 26 2 293 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 1.5e-16 83 31 3 245 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
A6H6A4 7.07e-15 78 25 3 299 2 Lrriq4 Leucine-rich repeat and IQ domain-containing protein 4 Mus musculus
Q7XK44 9.72e-23 100 30 2 239 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 2.62e-15 79 31 2 175 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 1.07e-13 74 29 1 156 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 4.87e-12 69 28 2 201 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 5.25e-09 60 30 1 120 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
Q7XK44 6.41e-09 60 28 1 145 2 IRL3 Plant intracellular Ras-group-related LRR protein 3 Oryza sativa subsp. japonica
P34268 1.24e-22 101 29 3 273 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P34268 2.96e-15 79 28 5 239 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P34268 7.74e-13 72 24 4 256 2 fli-1 Protein flightless-1 homolog Caenorhabditis elegans
P23466 2.27e-22 100 27 4 273 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 8.75e-08 57 27 5 221 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 2.65e-07 55 27 0 135 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 4.2e-07 55 28 6 220 3 CYR1 Adenylate cyclase Lachancea kluyveri
P23466 0.000113 47 25 7 199 3 CYR1 Adenylate cyclase Lachancea kluyveri
Q8VYG9 3.07e-22 99 31 4 244 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 1.91e-17 85 31 3 164 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 8.09e-16 80 30 2 159 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 2.17e-14 76 26 2 204 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 2.7e-12 70 27 1 145 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 1.17e-08 59 29 1 131 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
Q8VYG9 2.73e-07 55 32 0 89 2 PIRL9 Plant intracellular Ras-group-related LRR protein 9 Arabidopsis thaliana
G9LZD7 3.3e-22 100 31 9 264 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 1.31e-16 83 29 9 276 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 3.76e-12 70 36 6 144 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
G9LZD7 4.53e-11 67 28 13 266 2 XIAO Probable inactive leucine-rich repeat receptor kinase XIAO Oryza sativa subsp. japonica
Q0JA29 8.36e-22 99 32 11 277 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 1.51e-20 95 29 13 265 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q0JA29 1.77e-19 92 31 10 256 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Oryza sativa subsp. japonica
Q9FFJ3 9.55e-22 98 31 3 238 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 1.46e-16 82 28 2 204 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 5.22e-16 81 31 2 174 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 1.33e-08 58 33 0 104 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 2.38e-07 55 29 1 131 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
Q9FFJ3 2.4e-07 55 34 0 89 2 PIRL1 Plant intracellular Ras-group-related LRR protein 1 Arabidopsis thaliana
B9F655 1.09e-21 94 27 2 204 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
B9F655 2.8e-18 85 29 1 174 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
B9F655 1.91e-13 72 28 0 153 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
B9F655 1.06e-09 61 22 0 149 2 IRL7 Plant intracellular Ras-group-related LRR protein 7 Oryza sativa subsp. japonica
Q80U72 1.26e-21 98 28 4 297 1 Scrib Protein scribble homolog Mus musculus
Q80U72 1.97e-20 94 28 1 262 1 Scrib Protein scribble homolog Mus musculus
Q80U72 1.03e-19 92 30 0 221 1 Scrib Protein scribble homolog Mus musculus
Q80U72 4.77e-18 87 32 1 200 1 Scrib Protein scribble homolog Mus musculus
Q80U72 2.08e-16 82 30 0 204 1 Scrib Protein scribble homolog Mus musculus
Q80U72 0.000468 45 28 0 105 1 Scrib Protein scribble homolog Mus musculus
A8XWW4 2.43e-21 97 32 0 205 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 1.09e-20 95 31 0 220 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 1.25e-19 92 25 3 323 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 3.98e-15 79 28 2 210 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 3.32e-14 75 30 3 235 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
A8XWW4 1.11e-13 74 28 2 198 3 soc-2 Leucine-rich repeat protein soc-2 Caenorhabditis briggsae
Q8W4Q3 2.49e-21 96 31 2 244 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 3.23e-09 60 30 1 131 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 1.14e-07 56 26 2 173 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q8W4Q3 4.48e-07 54 29 2 131 2 PIRL3 Plant intracellular Ras-group-related LRR protein 3 Arabidopsis thaliana
Q14160 3.08e-21 97 29 1 262 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 1.23e-20 95 27 3 297 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 6.91e-19 90 29 0 221 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 4.3e-18 87 32 1 200 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 2.6e-16 82 30 0 204 1 SCRIB Protein scribble homolog Homo sapiens
Q14160 0.000432 45 28 0 105 1 SCRIB Protein scribble homolog Homo sapiens
F8WK50 4.62e-21 96 28 3 273 1 flii Protein flightless-1 homolog Danio rerio
F8WK50 6.09e-14 75 27 6 253 1 flii Protein flightless-1 homolog Danio rerio
F8WK50 6.17e-07 54 26 4 181 1 flii Protein flightless-1 homolog Danio rerio
Q6INV3 7.05e-21 92 26 4 258 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 3.12e-15 76 26 3 175 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
Q6INV3 4.44e-14 73 33 1 151 2 lrrc57 Leucine-rich repeat-containing protein 57 Xenopus laevis
A0A8P0N4K0 7.36e-21 96 27 3 297 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 4.6e-19 90 30 0 205 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 8.95e-19 90 27 1 261 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 2.78e-14 76 32 1 200 1 SCRIB Protein scribble homolog Canis lupus familiaris
A0A8P0N4K0 0.000113 47 28 0 105 1 SCRIB Protein scribble homolog Canis lupus familiaris
Q9Y2L9 8.23e-21 95 31 6 222 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q9Y2L9 1.76e-10 65 32 1 132 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q9Y2L9 2e-08 58 26 2 164 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q9Y2L9 6.32e-05 48 23 3 177 1 LRCH1 Leucine-rich repeat and calponin homology domain-containing protein 1 Homo sapiens
Q55E58 1.68e-20 95 29 4 284 3 pats1 Probable serine/threonine-protein kinase pats1 Dictyostelium discoideum
Q55E58 0.000823 44 32 3 119 3 pats1 Probable serine/threonine-protein kinase pats1 Dictyostelium discoideum
Q13045 2.61e-20 94 30 3 273 1 FLII Protein flightless-1 homolog Homo sapiens
Q13045 1.37e-16 83 29 6 234 1 FLII Protein flightless-1 homolog Homo sapiens
Q13045 2.67e-06 52 25 4 177 1 FLII Protein flightless-1 homolog Homo sapiens
Q1ZXD6 3.36e-20 94 28 6 236 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 5.97e-15 78 30 5 222 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 4.94e-13 72 26 5 234 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 2.21e-09 62 25 8 289 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q1ZXD6 7e-07 54 26 5 194 3 roco5 Probable serine/threonine-protein kinase roco5 Dictyostelium discoideum
Q9JJ28 6.69e-20 93 30 3 273 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 7.47e-16 81 29 6 234 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 1.86e-15 80 28 5 273 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 5.13e-08 57 25 1 169 1 Flii Protein flightless-1 homolog Mus musculus
Q9JJ28 1.4e-06 53 25 4 177 1 Flii Protein flightless-1 homolog Mus musculus
A4IIK1 7.5e-20 93 27 1 215 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 3.67e-19 90 27 2 240 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 6.75e-19 90 32 2 225 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 2.44e-17 85 25 2 274 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 1.34e-09 62 30 4 180 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
A4IIK1 0.000577 45 25 1 154 2 mfhas1 Malignant fibrous histiocytoma-amplified sequence 1 homolog Xenopus tropicalis
P08678 7.59e-20 93 29 4 268 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 7.7e-16 81 28 5 241 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 2.58e-14 76 26 5 228 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 3.89e-12 70 32 7 200 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P08678 1.02e-06 53 28 0 135 1 CYR1 Adenylate cyclase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P62046 7.86e-20 92 30 3 196 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 6.01e-13 72 31 2 147 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 3.56e-11 67 33 1 133 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 2.36e-08 58 36 3 117 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
P62046 3.54e-08 58 26 2 164 1 Lrch1 Leucine-rich repeat and calponin homology domain-containing protein 1 Mus musculus
Q01631 9.73e-20 92 32 4 239 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 5.19e-12 69 28 4 198 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 6.08e-07 54 26 5 195 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01631 1.02e-06 53 26 2 178 1 cr-1 Adenylate cyclase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
F1R6I3 1.37e-19 90 28 1 213 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 3.97e-19 89 28 2 227 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 3.37e-15 78 27 1 193 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 4.41e-14 74 26 1 196 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
F1R6I3 6.79e-14 74 27 1 188 2 lrrc39 Leucine-rich repeat-containing protein 39 Danio rerio
Q80X72 2.08e-19 91 30 10 272 1 Lrrc15 Leucine-rich repeat-containing protein 15 Mus musculus
Q80X72 1.93e-15 79 32 9 243 1 Lrrc15 Leucine-rich repeat-containing protein 15 Mus musculus
Q80X72 0.000177 46 33 5 123 1 Lrrc15 Leucine-rich repeat-containing protein 15 Mus musculus
Q55CS7 2.08e-19 91 30 3 234 2 mpl1 MAP kinase phosphatase with leucine-rich repeats protein 1 Dictyostelium discoideum
Q55CS7 3.44e-07 55 33 0 106 2 mpl1 MAP kinase phosphatase with leucine-rich repeats protein 1 Dictyostelium discoideum
Q55CS7 2.82e-05 48 40 0 69 2 mpl1 MAP kinase phosphatase with leucine-rich repeats protein 1 Dictyostelium discoideum
Q9LRT1 2.14e-19 91 28 12 302 1 At3g28040 Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040 Arabidopsis thaliana
Q9LRT1 1.24e-13 74 26 11 290 1 At3g28040 Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040 Arabidopsis thaliana
Q9LRT1 1.35e-08 59 31 13 257 1 At3g28040 Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040 Arabidopsis thaliana
C0LGQ5 3.32e-19 91 30 10 259 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 1.54e-15 80 30 13 325 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 8.57e-14 75 30 9 230 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 4.42e-12 70 28 13 310 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 4.37e-10 63 25 9 241 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
C0LGQ5 3.15e-09 61 27 10 224 1 GSO1 LRR receptor-like serine/threonine-protein kinase GSO1 Arabidopsis thaliana
Q8TF66 3.53e-19 90 28 10 293 1 LRRC15 Leucine-rich repeat-containing protein 15 Homo sapiens
Q8TF66 2.56e-14 76 32 9 250 1 LRRC15 Leucine-rich repeat-containing protein 15 Homo sapiens
Q3UV48 4.47e-19 88 27 3 236 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 2.39e-16 80 26 0 191 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 1.12e-09 61 32 0 125 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q3UV48 4.1e-09 60 25 0 171 2 Lrrc30 Leucine-rich repeat-containing protein 30 Mus musculus
Q15404 4.82e-19 87 31 1 161 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 1.41e-15 78 29 2 168 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 3.87e-15 77 29 2 161 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q15404 2.04e-14 75 41 1 118 1 RSU1 Ras suppressor protein 1 Homo sapiens
Q3KQF4 4.84e-19 89 32 1 203 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 1.29e-14 76 29 1 193 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 3.56e-10 63 25 1 181 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 1.03e-08 58 31 1 154 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q3KQF4 3.8e-07 54 26 1 184 2 lrrc69 Leucine-rich repeat-containing protein 69 Xenopus laevis
Q5E9C0 6.2e-19 87 31 1 164 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 9.24e-18 84 28 2 217 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 3.3e-15 77 29 2 168 2 RSU1 Ras suppressor protein 1 Bos taurus
Q5E9C0 8.58e-15 76 29 2 161 2 RSU1 Ras suppressor protein 1 Bos taurus
Q6ZH85 6.67e-19 89 28 2 198 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 4.29e-15 78 28 2 178 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 4.79e-14 75 28 1 156 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 6.16e-14 75 30 4 178 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 1.08e-12 71 28 2 191 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 1.28e-10 65 32 0 109 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 1.86e-09 61 28 3 177 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q6ZH85 4.61e-05 48 29 1 115 2 IRL2 Plant intracellular Ras-group-related LRR protein 2 Oryza sativa subsp. japonica
Q9RBS2 6.86e-19 90 26 7 281 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9RBS2 3.57e-18 88 27 6 262 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9RBS2 8.76e-13 72 29 6 213 4 popC Protein PopC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5VUJ6 1.5e-18 89 27 5 257 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q5VUJ6 3.23e-13 73 30 2 180 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q5VUJ6 2.38e-07 55 28 1 135 1 LRCH2 Leucine-rich repeat and calponin homology domain-containing protein 2 Homo sapiens
Q9HB75 1.65e-18 89 33 0 169 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 6.36e-18 87 28 0 175 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 1.94e-08 58 34 0 102 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 8.04e-07 53 30 1 127 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q9HB75 2.66e-06 52 25 3 197 1 PIDD1 p53-induced death domain-containing protein 1 Homo sapiens
Q7XDQ7 1.73e-18 87 27 4 257 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q7XDQ7 5.68e-10 62 31 1 134 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
Q7XDQ7 0.000141 46 22 2 181 2 IRL8 Plant intracellular Ras-group-related LRR protein 8 Oryza sativa subsp. japonica
V9M398 1.89e-18 89 26 7 278 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 2.3e-18 88 27 6 239 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 3.9e-11 67 25 4 189 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
V9M398 4.78e-05 48 27 7 189 1 RUN1 Disease resistance protein RUN1 Vitis rotundifolia
A8JAM0 2.11e-18 89 27 1 197 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 3.31e-14 76 24 2 211 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 9.79e-14 75 23 1 197 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
A8JAM0 1.15e-07 56 26 0 130 1 DRC7 Dynein regulatory complex subunit 7 (Fragment) Chlamydomonas reinhardtii
C0LGP4 2.27e-18 88 30 12 275 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
C0LGP4 4.74e-11 67 28 10 281 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
C0LGP4 5.13e-06 51 23 10 256 2 At3g47570 Probable LRR receptor-like serine/threonine-protein kinase At3g47570 Arabidopsis thaliana
Q6NSJ5 2.3e-18 88 29 5 234 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6NSJ5 7.7e-16 81 30 0 147 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6NSJ5 4.32e-13 72 29 3 201 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6NSJ5 3.38e-11 67 27 7 234 1 LRRC8E Volume-regulated anion channel subunit LRRC8E Homo sapiens
Q6DHL5 2.73e-18 85 27 3 197 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 1.13e-17 83 26 5 261 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
Q6DHL5 6.66e-15 75 33 1 151 2 lrrc57 Leucine-rich repeat-containing protein 57 Danio rerio
C0LGE4 2.74e-18 88 28 14 336 1 At1g12460 Probable LRR receptor-like serine/threonine-protein kinase At1g12460 Arabidopsis thaliana
Q00874 2.97e-18 87 31 8 213 2 DRT100 DNA damage-repair/toleration protein DRT100 Arabidopsis thaliana
O64566 3.16e-18 87 29 4 228 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 1.64e-11 67 28 3 184 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 4.66e-10 63 29 2 161 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
O64566 8.19e-07 53 25 2 149 2 PIRL6 Plant intracellular Ras-group-related LRR protein 6 Arabidopsis thaliana
Q8BGI7 3.43e-18 86 29 1 188 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 6.91e-17 82 26 3 267 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 1.11e-14 76 28 4 233 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q8BGI7 5.17e-05 47 27 2 136 1 Lrrc39 Leucine-rich repeat-containing protein 39 Mus musculus
Q42371 3.53e-18 88 30 10 249 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 2.2e-16 82 26 11 277 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 2.37e-14 76 30 9 244 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q42371 2.32e-11 67 27 8 220 1 ERECTA LRR receptor-like serine/threonine-protein kinase ERECTA Arabidopsis thaliana
Q3UMG5 3.6e-18 87 27 5 257 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q3UMG5 6.03e-13 72 30 2 180 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
Q3UMG5 1.3e-07 56 29 1 135 2 Lrch2 Leucine-rich repeat and calponin homology domain-containing protein 2 Mus musculus
C0LGV1 4.21e-18 87 30 9 255 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 6.99e-13 72 29 9 237 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 2.81e-09 61 26 10 265 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 3.86e-09 61 26 10 243 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 2.46e-08 58 26 7 235 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
C0LGV1 8.19e-05 47 32 3 107 1 RGI2 LRR receptor-like serine/threonine-protein kinase RGI2 Arabidopsis thaliana
Q9LZV7 6e-18 87 29 8 235 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q9LZV7 1.56e-10 65 31 7 189 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q9LZV7 1.25e-07 56 27 8 203 1 PXC2 Leucine-rich repeat receptor-like protein kinase PXC2 Arabidopsis thaliana
Q55CS8 9.07e-18 86 29 3 234 3 mpl2 MAP kinase phosphatase with leucine-rich repeats protein 2 Dictyostelium discoideum
Q55CS8 1.26e-08 59 31 1 119 3 mpl2 MAP kinase phosphatase with leucine-rich repeats protein 2 Dictyostelium discoideum
Q55CS8 5.27e-06 51 32 0 99 3 mpl2 MAP kinase phosphatase with leucine-rich repeats protein 2 Dictyostelium discoideum
Q5BKY1 1.19e-17 84 27 1 220 1 LRRC10 Leucine-rich repeat-containing protein 10 Homo sapiens
Q5BKY1 2.33e-14 74 27 1 199 1 LRRC10 Leucine-rich repeat-containing protein 10 Homo sapiens
Q9C7T7 1.26e-17 86 28 8 237 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 1.58e-10 65 26 13 304 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 3.29e-09 61 27 12 254 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 3.59e-07 55 26 9 222 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
Q9C7T7 0.000392 45 24 7 177 1 CEPR2 Receptor protein-tyrosine kinase CEPR2 Arabidopsis thaliana
P0C895 1.79e-17 84 25 5 261 1 At2g30105 LRR repeats and ubiquitin-like domain-containing protein At2g30105 Arabidopsis thaliana
P0C895 1.11e-10 65 32 1 126 1 At2g30105 LRR repeats and ubiquitin-like domain-containing protein At2g30105 Arabidopsis thaliana
Q7L1W4 2.11e-17 85 31 2 183 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q7L1W4 3.56e-15 79 26 2 179 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q7L1W4 5.31e-14 75 28 3 203 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q7L1W4 3.23e-10 64 23 1 168 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q7L1W4 4.68e-05 48 25 8 226 1 LRRC8D Volume-regulated anion channel subunit LRRC8D Homo sapiens
Q01730 2.39e-17 83 30 3 188 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 5.3e-17 82 28 2 217 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 4.16e-14 74 28 2 168 1 Rsu1 Ras suppressor protein 1 Mus musculus
Q01730 2.56e-12 68 27 2 161 1 Rsu1 Ras suppressor protein 1 Mus musculus
V9M2S5 2.41e-17 85 26 5 257 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
V9M2S5 6.24e-17 84 26 5 242 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
V9M2S5 1.09e-16 84 25 6 278 1 RPV1 Disease resistance protein RPV1 Vitis rotundifolia
Q8VZG8 2.42e-17 85 29 10 257 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8VZG8 1.15e-14 77 29 11 281 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8VZG8 1.78e-12 71 24 11 336 1 MIK2 MDIS1-interacting receptor like kinase 2 Arabidopsis thaliana
Q8K3W2 2.53e-17 83 26 1 221 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q8K3W2 1.13e-15 78 27 1 199 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q8K3W2 4.86e-05 47 25 0 157 1 Lrrc10 Leucine-rich repeat-containing protein 10 Mus musculus
Q7F8Q9 3.07e-17 85 30 10 255 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q7F8Q9 1.86e-08 58 27 8 219 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q7F8Q9 2.01e-08 58 26 12 298 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q7F8Q9 5.3e-08 57 28 9 242 2 MSL1 Leucine-rich repeat receptor protein kinase MSL1 Oryza sativa subsp. japonica
Q9D9Q0 3.71e-17 83 28 1 199 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 1.96e-16 81 28 1 214 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 1.57e-15 79 31 1 164 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 1.95e-08 58 29 1 162 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q9D9Q0 2.78e-06 51 25 1 156 2 Lrrc69 Leucine-rich repeat-containing protein 69 Mus musculus
Q5U308 3.73e-17 85 31 2 183 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q5U308 1.1e-15 80 29 3 203 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q5U308 2.43e-15 79 26 2 179 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q5U308 5.83e-11 66 23 2 195 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q5U308 0.000124 47 24 8 246 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Rattus norvegicus
Q8BGR2 3.73e-17 85 30 2 182 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8BGR2 8.5e-16 80 26 2 179 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8BGR2 1.02e-15 80 29 3 203 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8BGR2 8.33e-11 65 23 2 195 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8BGR2 4.36e-05 48 25 8 226 1 Lrrc8d Volume-regulated anion channel subunit LRRC8D Mus musculus
Q8RWE5 3.78e-17 84 28 5 239 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 8.1e-10 62 28 3 179 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
Q8RWE5 5.1e-06 50 28 3 128 2 PIRL8 Plant intracellular Ras-group-related LRR protein 8 Arabidopsis thaliana
O49318 3.86e-17 85 30 9 250 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 3.03e-15 79 28 10 255 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 1.92e-14 77 27 8 250 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 2.95e-13 73 29 10 243 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
O49318 9.59e-07 53 29 7 198 2 At2g33170 Probable leucine-rich repeat receptor-like protein kinase At2g33170 Arabidopsis thaliana
Q9SYQ8 4.02e-17 85 28 10 253 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q9SYQ8 3.76e-07 55 25 5 191 1 CLV1 Receptor protein kinase CLAVATA1 Arabidopsis thaliana
Q55FD8 4.3e-17 85 30 4 256 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q55FD8 5.89e-15 78 28 5 268 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q55FD8 4.35e-11 67 31 2 218 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q55FD8 2.77e-09 61 25 5 235 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
Q55FD8 5.78e-09 60 29 7 192 2 gefV Ras guanine nucleotide exchange factor V Dictyostelium discoideum
D3ZXS4 4.54e-17 83 26 3 267 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
D3ZXS4 1.59e-16 81 29 1 188 1 Lrrc39 Leucine-rich repeat-containing protein 39 Rattus norvegicus
Q96DD0 5.05e-17 83 26 3 262 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 7.75e-16 79 28 1 192 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 3.31e-15 78 28 1 188 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q96DD0 5.96e-10 62 24 1 193 1 LRRC39 Leucine-rich repeat-containing protein 39 Homo sapiens
Q921G6 5.42e-17 84 28 4 216 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q921G6 1.35e-13 74 32 2 156 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q921G6 5.73e-12 69 32 3 164 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q921G6 3.97e-05 48 28 2 148 1 Lrch4 Leucine-rich repeat and calponin homology domain-containing protein 4 Mus musculus
Q24020 5.47e-17 84 28 4 273 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 2.91e-16 82 28 6 256 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 0.000133 47 36 1 91 2 fliI Protein flightless-1 Drosophila melanogaster
Q24020 0.00043 45 28 1 151 2 fliI Protein flightless-1 Drosophila melanogaster
Q9LVP0 5.68e-17 84 29 9 283 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q9LVP0 5.72e-14 75 31 10 257 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q9LVP0 3.8e-11 67 26 9 260 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q9LVP0 2.39e-07 55 27 6 194 1 At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930 Arabidopsis thaliana
Q66JT1 6.08e-17 84 29 5 234 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 9.19e-16 80 30 0 147 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 1.51e-14 77 29 1 168 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 2.53e-13 73 27 7 266 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q66JT1 6.63e-12 69 29 4 201 2 Lrrc8e Volume-regulated anion channel subunit LRRC8E Mus musculus
Q4V8I7 8.57e-17 84 29 3 200 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q4V8I7 6.23e-14 75 31 0 147 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q4V8I7 4.1e-12 70 27 1 172 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q4V8I7 3.92e-10 63 26 6 242 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q4V8I7 0.000503 45 23 6 194 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Rattus norvegicus
Q3ZC49 9e-17 82 27 4 262 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q3ZC49 5.63e-14 74 26 1 205 2 LRRC39 Leucine-rich repeat-containing protein 39 Bos taurus
Q7XNY1 9.22e-17 82 29 5 237 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 1.87e-14 75 30 4 208 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 1.42e-09 61 28 2 151 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 1.11e-07 55 25 2 191 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q7XNY1 1.67e-05 49 30 2 114 2 IRL1 Plant intracellular Ras-group-related LRR protein 1 Oryza sativa subsp. japonica
Q80WG5 9.41e-17 84 29 3 200 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q80WG5 4.8e-14 75 31 0 147 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q80WG5 4.21e-12 70 27 1 172 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q80WG5 4.01e-11 67 26 6 268 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q80WG5 1.02e-05 50 24 6 227 1 Lrrc8a Volume-regulated anion channel subunit LRRC8A Mus musculus
Q9ERV7 1.04e-16 83 28 0 172 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 7.12e-16 81 30 1 178 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q9ERV7 2.16e-06 52 27 1 143 1 Pidd1 p53-induced death domain-containing protein 1 Mus musculus
Q658G7 1.2e-16 83 30 9 244 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 6.17e-15 78 26 9 267 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 4.1e-14 75 29 10 249 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 4.34e-13 72 30 9 204 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
Q658G7 6.4e-05 48 28 7 190 1 SIK1 LRR receptor-like serine/threonine-protein kinase SIK1 Oryza sativa subsp. japonica
O49545 1.34e-16 83 30 12 267 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
O49545 2.47e-16 82 27 9 248 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
O49545 6.23e-16 81 27 12 271 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
O49545 4.38e-10 63 28 11 244 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
O49545 0.000129 47 25 6 184 1 BAM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 Arabidopsis thaliana
Q6XHA6 1.4e-16 83 27 3 251 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
Q6XHA6 1.62e-10 65 30 3 195 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
Q6XHA6 1.8e-09 62 26 4 245 3 roco10 Probable inactive serine/threonine-protein kinase roco10 Dictyostelium discoideum
P14605 1.45e-16 83 28 6 270 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P14605 2.63e-08 58 24 6 272 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P14605 4.02e-08 58 28 5 206 1 cyr1 Adenylate cyclase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8IWT6 1.51e-16 83 28 5 220 1 LRRC8A Volume-regulated anion channel subunit LRRC8A Homo sapiens
Q8IWT6 2.17e-13 73 31 0 147 1 LRRC8A Volume-regulated anion channel subunit LRRC8A Homo sapiens
Q8IWT6 3.9e-11 67 26 6 268 1 LRRC8A Volume-regulated anion channel subunit LRRC8A Homo sapiens
Q8IWT6 5.02e-06 51 24 6 227 1 LRRC8A Volume-regulated anion channel subunit LRRC8A Homo sapiens
Q9LYN8 1.86e-16 83 33 12 264 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 5.06e-14 75 32 7 199 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 5.99e-12 69 28 10 241 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 9.31e-11 65 28 8 242 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q9LYN8 1.88e-05 49 41 5 105 1 EMS1 Leucine-rich repeat receptor protein kinase EMS1 Arabidopsis thaliana
Q6GLE8 2.06e-16 81 31 1 158 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 9.29e-14 73 27 2 197 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 8.21e-12 68 30 0 141 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 1.84e-10 64 26 2 180 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 8.88e-10 62 23 0 144 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q6GLE8 1.89e-07 55 27 0 123 2 lrrc28 Leucine-rich repeat-containing protein 28 Xenopus tropicalis
Q9LP24 2.47e-16 82 32 10 242 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 1.57e-10 65 28 9 257 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 2.74e-07 55 27 10 249 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
Q9LP24 5.38e-05 48 33 2 100 1 At1g35710 Probable leucine-rich repeat receptor-like protein kinase At1g35710 Arabidopsis thaliana
A6NM36 2.74e-16 80 30 1 203 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 8.75e-16 79 26 0 169 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 5.58e-14 74 28 1 192 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
A6NM36 6.63e-12 68 25 1 179 4 LRRC30 Leucine-rich repeat-containing protein 30 Homo sapiens
Q68F79 3.02e-16 82 29 5 249 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus tropicalis
Q68F79 2.8e-14 76 31 1 164 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus tropicalis
Q68F79 4.05e-12 70 28 1 194 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus tropicalis
Q68F79 3.44e-09 61 24 7 272 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus tropicalis
P47735 3.21e-16 82 29 8 244 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
P47735 6.93e-12 69 23 9 311 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
P47735 8.91e-10 62 25 14 347 1 RLK5 Receptor-like protein kinase 5 Arabidopsis thaliana
Q3KRC6 3.55e-16 82 29 0 147 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q3KRC6 6.76e-16 81 28 5 234 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q3KRC6 2.36e-14 76 28 1 168 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q3KRC6 4.74e-13 72 27 7 266 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
Q3KRC6 8.97e-13 72 29 4 201 1 Lrrc8e Volume-regulated anion channel subunit LRRC8E Rattus norvegicus
G7JIK2 3.57e-16 82 30 11 250 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
G7JIK2 7.4e-09 60 21 11 282 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
G7JIK2 6.52e-08 57 25 8 227 1 SUNN Leucine-rich repeat receptor-like kinase protein SUNN Medicago truncatula
Q24K06 4.46e-16 79 25 1 220 2 LRRC10 Leucine-rich repeat-containing protein 10 Bos taurus
Q24K06 1.78e-14 75 27 1 199 2 LRRC10 Leucine-rich repeat-containing protein 10 Bos taurus
Q9FGL5 5.12e-16 81 29 11 247 1 CEPR1 Receptor protein-tyrosine kinase CEPR1 Arabidopsis thaliana
Q9FGL5 6.14e-10 63 27 8 245 1 CEPR1 Receptor protein-tyrosine kinase CEPR1 Arabidopsis thaliana
F4K6B8 5.73e-16 81 28 12 285 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
F4K6B8 5.81e-14 75 31 11 243 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
F4K6B8 7.74e-13 72 27 10 236 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
F4K6B8 2.17e-11 67 29 9 241 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
F4K6B8 5.54e-06 51 24 10 296 1 RGI4 Leucine-rich repeat receptor-like serine/threonine-protein kinase RGI4 Arabidopsis thaliana
Q5G5D8 5.78e-16 80 30 6 229 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q5G5D8 8.56e-12 68 30 2 161 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q5G5D8 1.56e-09 61 28 3 184 2 PIRL7 Plant intracellular Ras-group-related LRR protein 7 Arabidopsis thaliana
Q9FL28 5.99e-16 81 30 9 246 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 1.59e-13 74 29 13 274 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 1.38e-12 71 28 11 248 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 1.42e-12 71 27 10 248 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 2.79e-11 67 28 15 292 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q9FL28 3.06e-05 48 25 8 189 1 FLS2 LRR receptor-like serine/threonine-protein kinase FLS2 Arabidopsis thaliana
Q8BVU0 6.11e-16 81 27 5 240 1 Lrch3 DISP complex protein LRCH3 Mus musculus
Q8BVU0 1.29e-10 65 26 4 231 1 Lrch3 DISP complex protein LRCH3 Mus musculus
Q5DU41 6.18e-16 81 33 0 147 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 4.26e-11 67 29 3 200 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 1.06e-08 59 24 6 277 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 8.43e-06 50 30 1 113 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q5DU41 5.37e-05 48 24 4 198 1 Lrrc8b Volume-regulated anion channel subunit LRRC8B Mus musculus
Q96II8 7.36e-16 81 26 6 260 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q96II8 4.35e-12 69 28 4 231 1 LRCH3 DISP complex protein LRCH3 Homo sapiens
Q5FVI3 8.16e-16 78 36 2 152 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 1.2e-13 72 26 4 175 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 1.77e-11 66 24 6 240 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
Q5FVI3 3.1e-08 56 28 2 129 2 Lrrc57 Leucine-rich repeat-containing protein 57 Rattus norvegicus
A5PK13 8.64e-16 80 25 5 251 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 2.28e-14 76 27 1 199 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 4.36e-12 69 27 0 151 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 2.2e-10 64 29 1 129 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 8.93e-07 53 25 0 135 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
A5PK13 1.03e-05 50 20 4 275 2 LRRC8C Volume-regulated anion channel subunit LRRC8C Bos taurus
C0LGS2 8.64e-16 80 31 9 244 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
C0LGS2 1.73e-13 74 28 11 278 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
C0LGS2 1.33e-12 71 26 11 302 1 At4g36180 Probable LRR receptor-like serine/threonine-protein kinase At4g36180 Arabidopsis thaliana
Q6NU09 8.65e-16 80 29 5 249 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 4.41e-15 79 32 1 175 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 2.48e-11 67 28 1 194 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q6NU09 3.47e-09 61 24 7 268 2 lrrc8e Volume-regulated anion channel subunit LRRC8E Xenopus laevis
Q9D1G5 9.48e-16 78 36 2 152 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 7.83e-14 72 26 4 175 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 3.8e-11 65 24 6 240 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q9D1G5 4.48e-08 56 29 2 129 1 Lrrc57 Leucine-rich repeat-containing protein 57 Mus musculus
Q8TDW0 9.66e-16 80 25 5 251 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 2.67e-14 76 27 1 199 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 4.73e-12 69 27 0 151 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 2.16e-10 64 29 1 129 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 8.85e-07 53 25 0 135 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q8TDW0 1.21e-05 50 20 4 275 1 LRRC8C Volume-regulated anion channel subunit LRRC8C Homo sapiens
Q6XAT2 1.03e-15 80 28 10 278 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
Q6XAT2 1.2e-15 80 29 9 244 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
Q6XAT2 1.08e-14 77 28 10 298 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
Q6XAT2 2.4e-11 67 27 12 282 1 ERL2 LRR receptor-like serine/threonine-protein kinase ERL2 Arabidopsis thaliana
I1Z695 1.05e-15 80 31 9 244 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
I1Z695 4.06e-15 79 31 9 244 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
I1Z695 2.59e-08 58 24 10 263 1 ER2 LRR receptor-like serine/threonine-protein kinase ER2 Oryza sativa subsp. japonica
Q9FIZ3 1.21e-15 80 29 11 281 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 3.22e-11 67 27 10 266 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 7.34e-11 66 26 11 296 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9FIZ3 2.49e-09 61 29 8 191 1 GSO2 LRR receptor-like serine/threonine-protein kinase GSO2 Arabidopsis thaliana
Q9ZPS9 2.13e-15 79 27 10 277 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 1.11e-14 77 30 13 253 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 3.56e-14 76 28 10 228 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 5.66e-09 60 26 13 257 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q9ZPS9 9.81e-06 50 28 8 187 1 BRL2 Serine/threonine-protein kinase BRI1-like 2 Arabidopsis thaliana
Q96CX6 2.16e-15 79 38 0 123 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 7.08e-15 77 32 2 156 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 6.49e-14 74 29 3 197 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 4.17e-12 69 27 2 177 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 4.58e-12 69 28 3 195 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 3.84e-07 54 30 0 125 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q96CX6 1.14e-05 49 32 2 131 1 LRRC58 Leucine-rich repeat-containing protein 58 Homo sapiens
Q3TX51 3.82e-15 78 31 1 158 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 9.1e-12 68 25 1 167 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 1.33e-11 67 26 2 180 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
Q3TX51 1.15e-09 62 26 0 141 2 Lrrc28 Leucine-rich repeat-containing protein 28 Mus musculus
O82318 4.56e-15 79 28 10 250 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
O82318 6.72e-13 72 28 11 254 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
O82318 2.77e-10 64 26 9 268 1 SKM1 Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1 Arabidopsis thaliana
Q8N9N7 5.88e-15 75 35 2 152 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 8.78e-12 67 27 5 201 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q8N9N7 1.06e-08 58 30 2 129 1 LRRC57 Leucine-rich repeat-containing protein 57 Homo sapiens
Q9SCT4 8.16e-15 78 27 10 251 1 IMK2 Probably inactive leucine-rich repeat receptor-like protein kinase IMK2 Arabidopsis thaliana
Q498T9 8.36e-15 78 25 5 251 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 1.83e-13 73 26 3 219 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 2.1e-12 70 27 0 151 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 1.92e-09 62 29 1 129 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 8.9e-06 50 20 4 275 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
Q498T9 9.22e-06 50 27 0 100 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Rattus norvegicus
F7D3V9 8.83e-15 77 30 11 248 2 lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Xenopus tropicalis
F7D3V9 1.52e-10 65 28 8 219 2 lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Xenopus tropicalis
A0A0R0HPY5 9.63e-15 77 29 11 277 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
A0A0R0HPY5 3.29e-11 67 28 10 244 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
A0A0R0HPY5 1.2e-10 65 30 8 199 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
A0A0R0HPY5 5.62e-10 63 25 9 244 2 CLV1A Leucine-rich repeat receptor-like kinase protein CLV1a Glycine max
Q9LHP4 9.79e-15 77 29 12 252 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q9LHP4 2.59e-12 70 28 9 247 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q9LHP4 4.52e-11 67 29 9 207 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q9LHP4 6.37e-09 60 21 9 284 1 RGI1 LRR receptor-like serine/threonine-protein kinase RGI1 Arabidopsis thaliana
Q69SP5 9.9e-15 77 30 11 256 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 7.27e-14 75 25 10 272 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 1.46e-13 74 27 9 244 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 3e-07 55 28 9 222 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 1.39e-05 50 32 5 128 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 0.000107 47 25 6 197 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q69SP5 0.000494 45 36 4 97 1 ER1 LRR receptor-like serine/threonine-protein kinase ER1 Oryza sativa subsp. japonica
Q9FRS6 1.02e-14 77 28 12 276 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
Q9FRS6 3.06e-13 73 27 10 268 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
Q9FRS6 4.97e-09 60 27 10 272 1 PXL1 Leucine-rich repeat receptor-like protein kinase PXL1 Arabidopsis thaliana
P0DL10 1.03e-14 77 29 10 281 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
P0DL10 4.69e-13 72 28 13 286 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
P0DL10 1.47e-09 62 25 9 261 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
P0DL10 6.54e-09 60 26 10 256 2 TD1 Leucine-rich repeat receptor-like kinase protein THICK TASSEL DWARF1 Zea mays
Q8R502 1.19e-14 77 24 5 251 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 1.48e-13 74 26 3 219 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 2.05e-12 70 27 0 151 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 2.02e-09 61 29 1 129 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 7.64e-06 50 20 4 275 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
Q8R502 9.82e-06 50 27 0 100 1 Lrrc8c Volume-regulated anion channel subunit LRRC8C Mus musculus
C0LGR3 1.35e-14 77 27 10 275 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 1.31e-13 74 26 9 270 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 1.33e-10 65 25 10 246 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 1.8e-09 62 26 11 257 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 3.84e-07 55 27 7 190 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
C0LGR3 1.3e-05 50 26 5 196 1 RGI3 LRR receptor-like serine/threonine-protein kinase RGI3 Arabidopsis thaliana
Q32NT4 1.37e-14 76 30 2 173 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 1.14e-13 73 28 2 189 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 1.64e-12 70 29 2 196 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 2.28e-11 67 28 2 194 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 3.32e-09 60 26 2 178 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q32NT4 4.26e-07 54 29 2 148 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus laevis
Q1MX30 1.47e-14 77 30 12 281 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. indica
Q1MX30 4.47e-07 54 28 10 231 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. indica
Q1MX30 2.95e-06 52 26 11 300 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. indica
Q1MX30 6.56e-05 48 24 9 230 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. indica
Q6P9F7 1.74e-14 77 31 0 147 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 3.38e-13 73 29 3 200 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 5.06e-07 54 23 6 277 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 4.46e-06 51 25 5 209 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
Q6P9F7 0.000116 47 27 1 148 1 LRRC8B Volume-regulated anion channel subunit LRRC8B Homo sapiens
O75473 2.43e-14 76 27 12 290 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
O75473 1.08e-11 68 31 6 209 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
O75473 3.47e-11 67 28 10 230 1 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Homo sapiens
Q8R5M3 2.51e-14 76 31 10 250 2 Lrrc15 Leucine-rich repeat-containing protein 15 Rattus norvegicus
Q8GRU6 2.6e-14 76 29 11 252 1 HAR1 Leucine-rich repeat receptor-like kinase protein HAR1 Lotus japonicus
Q8GRU6 5.87e-11 66 29 10 200 1 HAR1 Leucine-rich repeat receptor-like kinase protein HAR1 Lotus japonicus
Q8GRU6 2.88e-06 52 23 10 294 1 HAR1 Leucine-rich repeat receptor-like kinase protein HAR1 Lotus japonicus
Q3UGP9 2.66e-14 75 35 2 142 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 3.86e-14 75 32 0 131 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 5.31e-13 72 29 3 194 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 6.35e-12 68 29 2 185 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 7.24e-12 68 27 2 177 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 1.97e-07 55 32 0 125 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
Q3UGP9 2e-05 48 31 2 130 2 Lrrc58 Leucine-rich repeat-containing protein 58 Mus musculus
O60346 2.83e-14 76 28 9 245 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 4.29e-13 73 27 5 247 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 1.52e-06 53 24 8 298 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 3.2e-06 52 34 0 100 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
O60346 0.000177 46 23 5 208 1 PHLPP1 PH domain leucine-rich repeat-containing protein phosphatase 1 Homo sapiens
P49606 2.92e-14 76 28 6 241 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 2.44e-12 70 24 4 278 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 1.94e-11 68 28 7 248 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 5.38e-11 67 27 3 194 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
P49606 0.000351 45 25 5 247 3 UAC1 Adenylate cyclase Ustilago maydis (strain 521 / FGSC 9021)
Q9M2Z1 3.42e-14 76 26 13 360 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
Q9M2Z1 9.07e-11 65 25 11 277 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
Q9M2Z1 0.000845 44 25 5 167 1 BAM2 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 Arabidopsis thaliana
Q6JN46 3.44e-14 76 26 8 231 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 5.71e-11 66 29 9 254 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 1.93e-09 62 26 11 283 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 1.68e-07 55 29 12 288 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 1.27e-06 53 26 9 238 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q6JN46 0.00065 45 22 11 298 1 EIX2 Receptor-like protein EIX2 Solanum lycopersicum
Q940E8 3.85e-14 75 31 12 256 1 FEA2 Leucine-rich repeat receptor-like protein FASCIATED EAR2 Zea mays
Q940E8 2.22e-13 73 28 12 292 1 FEA2 Leucine-rich repeat receptor-like protein FASCIATED EAR2 Zea mays
Q940E8 4.43e-11 66 27 11 268 1 FEA2 Leucine-rich repeat receptor-like protein FASCIATED EAR2 Zea mays
P0DM44 4.35e-14 75 31 9 231 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
P0DM44 3.01e-10 64 32 6 209 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
P0DM44 7.72e-08 57 27 11 270 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
P0DM44 1.11e-06 53 25 10 271 2 lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Danio rerio
F1MLX5 4.54e-14 75 29 9 241 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
F1MLX5 3.16e-12 70 30 9 245 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
F1MLX5 1.96e-06 52 31 4 142 3 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Bos taurus
Q9CQ07 4.65e-14 73 29 2 158 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 8.2e-12 67 26 1 139 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 9.66e-12 67 27 1 148 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 2.58e-10 63 29 1 146 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 3.21e-08 57 32 1 108 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9CQ07 1.83e-05 48 27 1 124 2 Lrrc18 Leucine-rich repeat-containing protein 18 Mus musculus
Q9SGP2 5e-14 75 29 12 258 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 2.69e-13 73 28 7 210 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 2.13e-12 70 27 9 302 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SGP2 8.96e-07 53 26 9 241 1 HSL1 Receptor-like protein kinase HSL1 Arabidopsis thaliana
Q9SD62 5.12e-14 75 29 10 255 3 At3g47110 Putative receptor-like protein kinase At3g47110 Arabidopsis thaliana
Q9SD62 5.06e-09 60 29 11 275 3 At3g47110 Putative receptor-like protein kinase At3g47110 Arabidopsis thaliana
Q9SD62 4.28e-05 48 23 11 266 3 At3g47110 Putative receptor-like protein kinase At3g47110 Arabidopsis thaliana
P93194 5.41e-14 75 28 11 283 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 1.16e-12 71 29 7 258 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 1.37e-11 68 25 11 289 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 3.88e-09 61 25 11 287 2 INRPK1 Receptor-like protein kinase Ipomoea nil
P93194 5.33e-08 57 25 8 199 2 INRPK1 Receptor-like protein kinase Ipomoea nil
E7FE13 5.55e-14 75 29 8 251 2 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Danio rerio
E7FE13 8.9e-13 72 28 10 287 2 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Danio rerio
E7FE13 1.53e-08 59 26 9 230 2 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Danio rerio
Q2R2D5 6.07e-14 75 29 12 281 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. japonica
Q2R2D5 3.04e-06 52 26 10 261 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. japonica
Q2R2D5 5.41e-05 48 24 9 230 1 XA21 Receptor kinase-like protein Xa21 Oryza sativa subsp. japonica
P35858 6.81e-14 75 27 11 331 1 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Homo sapiens
P35858 5.6e-12 69 27 11 314 1 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Homo sapiens
P35858 2.41e-07 55 29 7 221 1 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Homo sapiens
Q9M0G7 6.94e-14 75 29 8 219 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9M0G7 4.67e-13 72 25 9 268 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
Q9M0G7 5.04e-12 69 26 11 304 1 MIK1 MDIS1-interacting receptor like kinase 1 Arabidopsis thaliana
F1MT22 7.13e-14 75 34 8 202 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
F1MT22 3.28e-13 73 29 11 232 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
F1MT22 3.84e-11 67 27 10 269 3 LGR5 Leucine-rich repeat-containing G-protein coupled receptor 5 Bos taurus
O02833 7.9e-14 75 27 10 295 2 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Papio hamadryas
O02833 4.88e-12 69 27 11 314 2 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Papio hamadryas
O02833 9.12e-09 59 30 7 220 2 IGFALS Insulin-like growth factor-binding protein complex acid labile subunit Papio hamadryas
C0LGW6 8.25e-14 75 28 8 268 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
C0LGW6 1.52e-12 71 28 11 302 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
C0LGW6 3.61e-12 70 24 10 321 1 ERL1 LRR receptor-like serine/threonine-protein kinase ERL1 Arabidopsis thaliana
Q6ZCZ2 9.98e-14 75 27 13 298 2 BRL3 Brassinosteroid LRR receptor kinase BRL3 Oryza sativa subsp. japonica
Q6ZCZ2 6.1e-08 57 30 12 245 2 BRL3 Brassinosteroid LRR receptor kinase BRL3 Oryza sativa subsp. japonica
O75427 1.01e-13 74 28 3 232 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
O75427 1.05e-13 74 32 2 162 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
O75427 1.65e-11 68 28 4 213 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
O75427 8.6e-07 53 28 2 150 1 LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Homo sapiens
Q8CHE4 1.23e-13 74 27 9 257 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 5.11e-13 72 26 5 249 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 6.93e-11 66 24 6 275 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 4.57e-08 57 24 4 205 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 2.47e-07 55 34 0 99 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 2.46e-06 52 23 5 208 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
Q8CHE4 2.73e-05 49 23 7 291 1 Phlpp1 PH domain leucine-rich repeat-containing protein phosphatase 1 Mus musculus
D4AC13 1.29e-13 74 33 7 199 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
D4AC13 5.41e-13 72 29 10 231 3 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Rattus norvegicus
Q9BXB1 1.37e-13 74 29 9 238 1 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Homo sapiens
Q9BXB1 3.76e-12 70 30 9 245 1 LGR4 Leucine-rich repeat-containing G-protein coupled receptor 4 Homo sapiens
Q8RX63 1.42e-13 74 28 10 277 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q8RX63 3.33e-11 67 27 12 247 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q8RX63 4.9e-11 66 27 10 236 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q8RX63 7.83e-06 50 23 11 260 2 RLP31 Receptor-like protein 31 Arabidopsis thaliana
Q9LS79 1.87e-13 73 29 10 250 3 RLP38 Receptor-like protein 38 Arabidopsis thaliana
Q9LS79 7.35e-13 72 27 6 250 3 RLP38 Receptor-like protein 38 Arabidopsis thaliana
Q9LS79 6.6e-12 69 28 9 232 3 RLP38 Receptor-like protein 38 Arabidopsis thaliana
C0LGH3 2.43e-13 73 31 9 228 2 At1g56140 Probable LRR receptor-like serine/threonine-protein kinase At1g56140 Arabidopsis thaliana
Q9HBX8 2.62e-13 73 32 6 211 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9HBX8 1.53e-09 62 28 10 268 1 LGR6 Leucine-rich repeat-containing G-protein coupled receptor 6 Homo sapiens
Q9SHI2 2.66e-13 73 27 10 271 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 2.04e-12 70 27 9 241 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 3.25e-11 67 27 10 244 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 1.02e-08 59 26 7 198 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 1.75e-08 58 28 8 216 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9SHI2 3.07e-06 52 31 5 135 1 At1g17230 Leucine-rich repeat receptor-like serine/threonine-protein kinase At1g17230 Arabidopsis thaliana
Q9FZ59 2.7e-13 73 28 10 277 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q9FZ59 1.41e-12 71 27 11 298 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q9FZ59 5.44e-10 63 26 11 260 1 PEPR2 Leucine-rich repeat receptor-like protein kinase PEPR2 Arabidopsis thaliana
Q6PEZ8 2.73e-13 73 29 13 325 1 PODNL1 Podocan-like protein 1 Homo sapiens
Q8BXA7 2.75e-13 73 24 5 267 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q8BXA7 7.81e-13 72 31 8 224 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q8BXA7 5.35e-08 57 34 0 98 1 Phlpp2 PH domain leucine-rich repeat-containing protein phosphatase 2 Mus musculus
Q9Z2H4 2.84e-13 73 29 9 238 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
Q9Z2H4 2.85e-11 67 27 11 314 2 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Rattus norvegicus
P0DO09 2.86e-13 73 26 0 138 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 8.91e-11 65 27 2 165 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 1.21e-10 65 27 2 165 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 2.42e-06 52 22 0 122 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 1.01e-05 50 32 0 88 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
P0DO09 1.56e-05 50 22 1 108 3 PIKS-1 Disease resistance protein Piks-1 Oryza sativa subsp. japonica
Q7FZR1 2.92e-13 73 28 14 303 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
Q7FZR1 1.33e-05 50 24 10 242 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
Q7FZR1 0.000251 46 35 2 74 2 RLP52 Receptor-like protein 52 Arabidopsis thaliana
B5UBC1 2.94e-13 73 26 0 138 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 8.91e-11 65 27 2 165 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 1.27e-10 65 27 2 165 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 2.4e-06 52 22 0 122 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 1.05e-05 50 32 0 88 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
B5UBC1 1.55e-05 50 22 1 108 1 PIKM1-TS Disease resistance protein Pikm1-TS Oryza sativa subsp. japonica
F2VYU4 2.96e-13 73 26 0 138 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 8.35e-11 66 27 2 165 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 1.21e-10 65 27 2 165 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 2.36e-06 52 22 0 122 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 1.01e-05 50 32 0 88 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
F2VYU4 1.44e-05 50 22 1 108 1 PIK-1 Disease resistance protein Pik-1 Oryza sativa subsp. japonica
Q9Z1P4 3.44e-13 73 32 7 199 1 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Mus musculus
Q9Z1P4 1.48e-12 71 29 10 231 1 Lgr5 Leucine-rich repeat-containing G-protein coupled receptor 5 Mus musculus
E5DHB5 3.46e-13 73 33 7 199 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
E5DHB5 4.7e-13 72 28 10 245 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
E5DHB5 1.31e-08 59 28 9 225 2 lgr5-a Leucine-rich repeat-containing G-protein coupled receptor 5A Xenopus laevis
Q8VDB8 4.59e-13 72 26 3 183 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 1.86e-12 70 25 2 231 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q8VDB8 2.6e-11 67 26 1 172 2 Lrrc2 Leucine-rich repeat-containing protein 2 Mus musculus
Q6P3Y9 5.31e-13 72 28 13 311 1 Podnl1 Podocan-like protein 1 Mus musculus
Q6P3Y9 3.08e-10 63 29 11 264 1 Podnl1 Podocan-like protein 1 Mus musculus
Q6P3Y9 8.36e-10 62 31 10 215 1 Podnl1 Podocan-like protein 1 Mus musculus
Q1PEN0 5.36e-13 72 29 8 219 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q1PEN0 2.84e-09 61 27 6 176 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q1PEN0 2.33e-06 52 26 10 252 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
Q1PEN0 5.27e-06 51 23 8 238 2 RLP36 Receptor-like protein 36 Arabidopsis thaliana
O65440 5.79e-13 72 28 10 270 1 BAM3 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 Arabidopsis thaliana
O65440 7.15e-10 63 24 11 277 1 BAM3 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 Arabidopsis thaliana
O65440 1.18e-09 62 25 10 301 1 BAM3 Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 Arabidopsis thaliana
A2ARI4 5.84e-13 72 29 9 238 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
A2ARI4 1.35e-10 65 26 11 314 1 Lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Mus musculus
Q6XHA7 6.19e-13 72 29 4 238 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6XHA7 2.36e-08 58 26 3 232 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6XHA7 2.56e-07 55 26 4 253 3 roco9 Probable serine/threonine-protein kinase roco9 Dictyostelium discoideum
Q6ZVD8 6.44e-13 72 26 5 243 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q6ZVD8 1.79e-11 68 29 7 224 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q6ZVD8 5.06e-09 60 37 0 98 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q6ZVD8 4.41e-05 48 23 5 231 1 PHLPP2 PH domain leucine-rich repeat-containing protein phosphatase 2 Homo sapiens
Q9BYS8 6.95e-13 71 27 2 225 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 9.84e-13 71 25 1 189 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q9BYS8 1.23e-12 70 26 2 165 1 LRRC2 Leucine-rich repeat-containing protein 2 Homo sapiens
Q8RZV7 1.19e-12 71 30 10 255 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 2.27e-12 70 25 11 283 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 1.3e-11 68 27 8 232 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q8RZV7 2.9e-06 52 27 12 269 1 MSP1 Leucine-rich repeat receptor protein kinase MSP1 Oryza sativa subsp. japonica
Q9M6A7 1.23e-12 71 28 9 274 2 CLV1B Leucine-rich repeat receptor-like kinase protein CLV1B Glycine max
Q9M6A7 3.42e-11 67 26 11 275 2 CLV1B Leucine-rich repeat receptor-like kinase protein CLV1B Glycine max
Q9M6A7 3.71e-11 67 31 8 199 2 CLV1B Leucine-rich repeat receptor-like kinase protein CLV1B Glycine max
Q7G768 1.52e-12 71 27 11 274 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 3.72e-10 64 31 13 246 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 6.57e-09 60 25 11 280 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
Q7G768 7.66e-06 50 27 3 162 2 BRL2 Brassinosteroid LRR receptor kinase BRL2 Oryza sativa subsp. japonica
C0LGJ1 1.65e-12 71 29 10 242 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
C0LGJ1 2.8e-10 64 26 14 297 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
C0LGJ1 1.44e-07 56 27 11 265 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
C0LGJ1 5.09e-05 48 36 5 113 1 At1g74360 Probable LRR receptor-like serine/threonine-protein kinase At1g74360 Arabidopsis thaliana
C0LGX3 1.66e-12 71 30 11 213 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 4.59e-11 67 28 10 235 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 1.52e-07 56 27 11 260 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 7.55e-07 53 25 11 247 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
C0LGX3 0.000898 44 31 5 116 1 HSL2 LRR receptor-like serine/threonine-protein kinase HSL2 Arabidopsis thaliana
Q9DBB9 1.83e-12 70 30 8 213 1 Cpn2 Carboxypeptidase N subunit 2 Mus musculus
Q9DBB9 1.1e-10 65 30 8 224 1 Cpn2 Carboxypeptidase N subunit 2 Mus musculus
Q6UWE0 1.92e-12 70 34 2 129 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 1.19e-10 65 33 0 95 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 4.81e-08 57 32 0 98 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 3.04e-07 55 26 4 176 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 9.38e-06 50 22 3 159 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q6UWE0 7.15e-05 47 36 0 69 1 LRSAM1 E3 ubiquitin-protein ligase LRSAM1 Homo sapiens
Q9SSL9 2.19e-12 70 27 9 236 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 2.18e-11 67 27 9 261 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 2.44e-11 67 26 8 235 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 2.92e-07 55 27 10 273 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 1.34e-06 53 27 6 150 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
Q9SSL9 2.24e-05 49 25 7 236 1 PEPR1 Leucine-rich repeat receptor-like protein kinase PEPR1 Arabidopsis thaliana
C0LGG7 2.23e-12 70 28 10 241 2 At1g53420 Probable LRR receptor-like serine/threonine-protein kinase At1g53420 Arabidopsis thaliana
Q6JN47 2.42e-12 70 29 10 261 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 2.72e-11 67 27 8 233 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 1.21e-08 59 27 10 277 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 1.45e-06 53 26 11 290 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
Q6JN47 1.74e-05 49 29 11 232 2 EIX1 Receptor-like protein EIX1 Solanum lycopersicum
F4J8G2 2.45e-12 70 31 9 223 3 RLP33 Receptor-like protein 33 Arabidopsis thaliana
F4J8G2 1.57e-05 50 29 9 179 3 RLP33 Receptor-like protein 33 Arabidopsis thaliana
F4J8G2 0.000161 46 27 11 227 3 RLP33 Receptor-like protein 33 Arabidopsis thaliana
Q09564 2.66e-12 70 27 6 276 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 4.88e-12 69 31 2 152 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 4.14e-09 60 25 9 286 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 8.65e-09 60 26 7 245 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q09564 1.4e-06 53 28 6 249 3 phlp-2 Protein phosphatase PHLPP-like protein Caenorhabditis elegans
Q9LY03 2.86e-12 70 28 9 239 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 4.71e-12 69 28 8 212 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 7.08e-11 66 28 11 276 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9LY03 0.000256 46 38 4 81 1 IRK Probable LRR receptor-like serine/threonine-protein kinase IRK Arabidopsis thaliana
Q9FN37 2.97e-12 70 27 13 297 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 5.29e-10 63 29 13 247 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 1.2e-06 53 25 9 227 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 3.55e-05 48 23 11 289 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 0.000109 47 24 11 287 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
Q9FN37 0.000124 47 24 10 239 1 PSKR2 Phytosulfokine receptor 2 Arabidopsis thaliana
O22938 3.08e-12 70 29 8 227 2 PXC3 Leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 Arabidopsis thaliana
O22938 5.3e-12 69 28 12 279 2 PXC3 Leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 Arabidopsis thaliana
O22938 3.71e-10 63 27 8 253 2 PXC3 Leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 Arabidopsis thaliana
Q93YT3 3.73e-12 70 28 9 246 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q93YT3 3.88e-05 48 26 13 284 2 RLP50 Receptor-like protein 50 Arabidopsis thaliana
Q80ZI6 4.18e-12 69 33 2 132 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 5.13e-10 63 31 0 100 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 7.18e-08 57 26 4 183 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 1.29e-07 56 32 0 94 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
Q80ZI6 3.83e-06 51 24 5 170 1 Lrsam1 E3 ubiquitin-protein ligase LRSAM1 Mus musculus
A4IHG1 4.43e-12 68 31 3 190 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 1.29e-11 67 31 3 148 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 9.05e-09 59 28 2 169 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
A4IHG1 1.1e-07 55 29 2 148 2 lrrc58 Leucine-rich repeat-containing protein 58 Xenopus tropicalis
Q5S006 4.6e-12 70 28 9 272 1 Lrrk2 Leucine-rich repeat serine/threonine-protein kinase 2 Mus musculus
Q5S006 4.37e-08 58 25 5 204 1 Lrrk2 Leucine-rich repeat serine/threonine-protein kinase 2 Mus musculus
Q5Z9N5 5.16e-12 69 31 11 233 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q5Z9N5 1.24e-09 62 28 10 269 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q5Z9N5 3.9e-09 60 28 5 196 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q5Z9N5 0.000505 45 25 11 288 1 FON1 Leucine-rich repeat receptor-like kinase protein FLORAL ORGAN NUMBER1 Oryza sativa subsp. japonica
Q2QZF2 5.55e-12 69 28 2 163 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 1.01e-10 65 28 1 131 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q2QZF2 6.78e-05 48 25 1 107 2 PIK5-NP Disease resistance protein PIK5-NP Oryza sativa subsp. japonica
Q66HD6 5.79e-12 67 27 2 147 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 3.14e-11 65 30 1 146 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 5.6e-11 65 26 2 160 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 2.1e-08 57 33 1 108 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q66HD6 4.72e-06 50 28 1 124 2 Lrrc18 Leucine-rich repeat-containing protein 18 Rattus norvegicus
Q93373 6e-12 69 27 8 252 2 let-4 Leucine-rich repeat-containing protein let-4 Caenorhabditis elegans
Q9C9H7 6e-12 69 28 11 269 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 9.86e-12 68 28 10 256 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 6.47e-09 60 26 11 297 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H7 1.13e-05 50 23 13 296 2 RLP12 Receptor-like protein 12 Arabidopsis thaliana
Q9C9H6 6.08e-12 69 27 9 244 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9C9H6 4.54e-08 57 25 10 241 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9C9H6 3.15e-05 48 25 9 249 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q9C9H6 0.000575 45 23 9 274 3 RLP11 Receptor-like protein 11 Arabidopsis thaliana
Q54XZ5 6.38e-12 69 26 4 307 3 DDB_G0278509 Probable serine/threonine-protein kinase DDB_G0278509 Dictyostelium discoideum
F4I2N7 6.52e-12 69 25 8 271 1 RLK7 Receptor-like protein kinase 7 Arabidopsis thaliana
F4I2N7 7.42e-12 69 26 8 259 1 RLK7 Receptor-like protein kinase 7 Arabidopsis thaliana
F4I2N7 1.07e-07 56 24 9 246 1 RLK7 Receptor-like protein kinase 7 Arabidopsis thaliana
O80809 6.97e-12 69 30 10 253 1 CLV2 Receptor-like protein CLAVATA2 Arabidopsis thaliana
O80809 3.65e-06 51 22 9 286 1 CLV2 Receptor-like protein CLAVATA2 Arabidopsis thaliana
O80809 0.000791 44 26 11 273 1 CLV2 Receptor-like protein CLAVATA2 Arabidopsis thaliana
B0BLW3 7.52e-12 69 29 10 262 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
B0BLW3 4.59e-11 67 29 9 226 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
B0BLW3 8.14e-09 60 29 8 216 1 lgr4 Leucine-rich repeat-containing G-protein coupled receptor 4 Xenopus tropicalis
Q3UVD5 7.82e-12 69 32 6 218 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q3UVD5 2.84e-09 61 28 9 252 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q3UVD5 5.73e-08 57 23 10 321 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
Q3UVD5 0.000228 46 30 6 139 2 Lgr6 Leucine-rich repeat-containing G-protein coupled receptor 6 Mus musculus
C0LGF5 8.39e-12 68 23 12 342 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
C0LGF5 3.71e-11 67 28 9 261 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
C0LGF5 4.03e-11 67 28 9 239 1 RGI5 LRR receptor-like serine/threonine-protein kinase RGI5 Arabidopsis thaliana
Q9WTR8 1.04e-11 68 26 5 249 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 8.88e-11 66 24 6 275 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 6.02e-07 54 24 4 205 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 2.04e-06 52 34 0 99 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 6.9e-06 51 23 5 208 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
Q9WTR8 3.06e-05 49 23 8 298 1 Phlpp1 PH domain leucine-rich repeat protein phosphatase 1 Rattus norvegicus
P70389 1.11e-11 68 26 10 310 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Mus musculus
P35859 1.84e-11 67 28 10 274 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Rattus norvegicus
P35859 2.03e-11 67 27 9 255 1 Igfals Insulin-like growth factor-binding protein complex acid labile subunit Rattus norvegicus
Q32KX5 2.11e-11 67 31 1 158 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 2.74e-11 67 32 2 153 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 2.69e-07 54 27 0 141 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 2.72e-07 54 25 2 196 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q32KX5 6.64e-07 53 25 2 180 2 LRRC28 Leucine-rich repeat-containing protein 28 Bos taurus
Q86X40 2.13e-11 67 31 1 158 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 2.27e-11 67 32 2 153 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 1.02e-07 56 25 2 180 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 2.12e-07 55 25 2 196 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 5.68e-07 53 27 0 141 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q86X40 0.000295 45 32 1 85 1 LRRC28 Leucine-rich repeat-containing protein 28 Homo sapiens
Q8N456 2.15e-11 66 27 1 139 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 9.35e-11 64 25 2 159 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 1.48e-10 63 30 1 148 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 1.09e-08 58 33 1 108 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 2.23e-05 48 28 1 124 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q8N456 2.44e-05 48 29 1 128 1 LRRC18 Leucine-rich repeat-containing protein 18 Homo sapiens
Q9BZR6 2.45e-11 67 33 10 229 1 RTN4R Reticulon-4 receptor Homo sapiens
Q9FL51 2.52e-11 67 25 10 274 3 At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 Arabidopsis thaliana
D3YY91 2.64e-11 67 33 4 133 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
D3YY91 3.08e-07 54 28 6 173 1 Lrr1 Leucine-rich repeat protein 1 Mus musculus
Q9VUN0 2.81e-11 67 29 10 261 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q9VUN0 3.25e-11 67 26 11 264 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q9VUN0 2.43e-09 61 32 7 162 1 Toll-6 Toll-like receptor 6 Drosophila melanogaster
Q9LFG1 3.25e-11 67 27 9 254 1 At3g53590 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At3g53590 Arabidopsis thaliana
O48851 3.47e-11 67 30 9 239 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
O48851 1.89e-05 49 26 12 311 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
O48851 8.84e-05 47 23 8 245 2 RLP22 Receptor like protein 22 Arabidopsis thaliana
Q9ZUK3 4.03e-11 67 27 9 244 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 1.15e-08 59 26 8 232 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 2.14e-08 58 26 8 241 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 5.19e-06 51 27 8 235 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q9ZUK3 2.97e-05 48 24 9 260 2 RLP19 Receptor-like protein 19 Arabidopsis thaliana
Q7KIN0 4.18e-11 67 30 10 254 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q7KIN0 9.48e-08 57 30 6 168 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q7KIN0 3.2e-06 52 27 6 203 1 Toll-7 Toll-like receptor 7 Drosophila melanogaster
Q9SHI3 4.53e-11 66 25 12 341 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9SHI3 1.69e-06 52 31 12 246 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9SHI3 3.32e-05 48 25 7 213 2 RLP2 Receptor-like protein 2 Arabidopsis thaliana
Q9NZU1 5.05e-11 66 31 9 250 1 FLRT1 Leucine-rich repeat transmembrane protein FLRT1 Homo sapiens
Q9NZU1 1.54e-06 52 28 5 173 1 FLRT1 Leucine-rich repeat transmembrane protein FLRT1 Homo sapiens
Q723K6 5.21e-11 66 31 10 233 3 inlA Internalin A Listeria monocytogenes serotype 4b (strain F2365)
Q723K6 2.36e-06 52 32 6 142 3 inlA Internalin A Listeria monocytogenes serotype 4b (strain F2365)
Q9LJM4 5.27e-11 66 27 10 255 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
Q9LJM4 8.48e-11 66 26 9 238 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
Q9LJM4 8.36e-06 50 25 11 268 1 IKU2 Receptor-like protein kinase HAIKU2 Arabidopsis thaliana
O49879 5.54e-11 66 28 12 270 2 HCR9-0 Receptor-like protein Cf-9 homolog Solanum lycopersicum
O49879 0.000171 46 27 11 227 2 HCR9-0 Receptor-like protein Cf-9 homolog Solanum lycopersicum
Q6RKD8 5.59e-11 66 31 9 250 1 Flrt1 Leucine-rich repeat transmembrane protein FLRT1 Mus musculus
Q6RKD8 1.25e-07 56 29 5 173 1 Flrt1 Leucine-rich repeat transmembrane protein FLRT1 Mus musculus
P0DJM0 6.09e-11 66 31 10 233 1 inlA Internalin A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0DJM0 2.53e-06 52 32 6 142 1 inlA Internalin A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6UXM1 6.5e-11 66 28 11 277 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q6UXM1 3.88e-09 61 28 11 266 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q6UXM1 5.08e-06 51 31 6 152 1 LRIG3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Homo sapiens
Q54TM7 6.55e-11 66 31 1 139 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 2.03e-09 62 31 1 138 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 1.92e-06 52 30 1 128 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 2.49e-06 52 32 3 135 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
Q54TM7 5.89e-06 51 32 1 115 2 drkD Probable serine/threonine-protein kinase drkD Dictyostelium discoideum
P90920 7.62e-11 66 27 10 269 2 egg-6 Leucine-rich repeat-containing protein egg-6 Caenorhabditis elegans
Q942F3 8.02e-11 66 27 12 277 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
Q942F3 2.15e-09 62 27 10 277 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
Q942F3 4.41e-06 51 26 12 286 1 BRI1 Brassinosteroid LRR receptor kinase BRI1 Oryza sativa subsp. japonica
C0LGK4 8.17e-11 66 29 8 232 1 At2g16250 Probable LRR receptor-like serine/threonine-protein kinase At2g16250 Arabidopsis thaliana
Q54WS5 8.32e-11 66 29 10 253 3 roco6 Probable serine/threonine-protein kinase roco6 Dictyostelium discoideum
Q54WS5 3.02e-10 64 24 8 269 3 roco6 Probable serine/threonine-protein kinase roco6 Dictyostelium discoideum
Q54WS5 1.47e-06 53 26 4 167 3 roco6 Probable serine/threonine-protein kinase roco6 Dictyostelium discoideum
Q6R6I7 9.82e-11 65 27 14 275 2 Rxfp1 Relaxin receptor 1 Mus musculus
Q8L899 1e-10 65 28 12 258 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 1.11e-09 62 28 12 265 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 1.25e-08 59 27 13 260 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 4.05e-08 57 24 10 277 1 None Systemin receptor SR160 Solanum peruvianum
Q8L899 6.65e-07 54 25 12 260 1 None Systemin receptor SR160 Solanum peruvianum
Q96L50 1.03e-10 65 27 4 183 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q96L50 5.05e-07 53 27 5 189 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q96L50 4.51e-05 48 30 2 134 1 LRR1 Leucine-rich repeat protein 1 Homo sapiens
Q69JN6 1.08e-10 65 26 11 270 2 BRL1 Brassinosteroid LRR receptor kinase BRL1 Oryza sativa subsp. japonica
Q69JN6 6.59e-07 54 26 13 263 2 BRL1 Brassinosteroid LRR receptor kinase BRL1 Oryza sativa subsp. japonica
P82963 1.14e-10 65 27 9 263 2 CHP Chaoptin (Fragment) Tribolium castaneum
P82963 2.98e-06 52 25 9 256 2 CHP Chaoptin (Fragment) Tribolium castaneum
Q8AVS8 1.18e-10 64 43 0 79 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 3.02e-05 48 28 1 110 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 7.03e-05 47 37 1 77 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
Q8AVS8 0.000472 44 31 2 118 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus laevis
G3XA59 1.23e-10 65 30 8 251 1 Lrrc32 Transforming growth factor beta activator LRRC32 Mus musculus
Q9FII5 1.24e-10 65 28 7 221 1 TDR Leucine-rich repeat receptor-like protein kinase TDR Arabidopsis thaliana
Q9FII5 3.16e-09 61 24 9 287 1 TDR Leucine-rich repeat receptor-like protein kinase TDR Arabidopsis thaliana
Q5RJR8 1.42e-10 64 41 0 81 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 4.72e-07 53 38 1 100 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 6.69e-07 53 32 1 110 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q5RJR8 5.4e-06 50 29 1 110 1 Lrrc59 Leucine-rich repeat-containing protein 59 Rattus norvegicus
Q922Q8 1.45e-10 64 41 0 81 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 4.94e-07 53 38 1 100 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 6.51e-07 53 32 1 110 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q922Q8 5.02e-06 50 29 1 110 1 Lrrc59 Leucine-rich repeat-containing protein 59 Mus musculus
Q8MVR1 1.45e-10 65 28 1 141 1 gbpC Cyclic GMP-binding protein C Dictyostelium discoideum
Q8MVR1 1.06e-05 50 25 1 132 1 gbpC Cyclic GMP-binding protein C Dictyostelium discoideum
Q8MVR1 5.18e-05 48 28 2 128 1 gbpC Cyclic GMP-binding protein C Dictyostelium discoideum
Q6NX28 1.52e-10 64 43 0 79 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 3.53e-06 51 28 1 110 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 2.16e-05 48 37 0 78 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
Q6NX28 0.000806 43 30 2 118 2 lrrc59 Leucine-rich repeat-containing protein 59 Xenopus tropicalis
G2K3G6 1.75e-10 65 31 10 233 3 inlA Internalin A Listeria monocytogenes serotype 1/2a (strain 10403S)
G2K3G6 2.51e-06 52 32 6 142 3 inlA Internalin A Listeria monocytogenes serotype 1/2a (strain 10403S)
Q6ZNQ3 1.87e-10 64 26 1 187 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q6ZNQ3 2.26e-10 63 28 1 199 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q6ZNQ3 6.13e-08 56 27 2 237 2 LRRC69 Leucine-rich repeat-containing protein 69 Homo sapiens
Q6DF55 1.88e-10 64 28 9 228 2 vasn Vasorin Xenopus tropicalis
Q6DF55 2.34e-10 64 30 6 179 2 vasn Vasorin Xenopus tropicalis
Q9LJW7 1.93e-10 64 26 10 267 2 RLP43 Receptor-like protein 43 Arabidopsis thaliana
Q9LJW7 7.96e-10 63 28 8 239 2 RLP43 Receptor-like protein 43 Arabidopsis thaliana
Q96AG4 2.13e-10 63 40 0 81 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 5.73e-07 53 39 1 100 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 4.88e-06 50 30 1 110 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q96AG4 5.5e-06 50 29 1 110 1 LRRC59 Leucine-rich repeat-containing protein 59 Homo sapiens
Q6P1C6 2.23e-10 64 31 8 206 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q6P1C6 1.26e-07 56 26 11 282 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q6P1C6 0.000147 47 27 6 188 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q6P1C6 0.0008 44 30 6 152 1 Lrig3 Leucine-rich repeats and immunoglobulin-like domains protein 3 Mus musculus
Q54T82 2.42e-10 64 24 6 214 4 DDB_G0281931 Putative leucine-rich repeat-containing protein DDB_G0281931 Dictyostelium discoideum
F4JGB6 2.48e-10 64 30 8 217 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
F4JGB6 3.7e-09 60 28 12 248 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
F4JGB6 2.17e-07 55 27 9 274 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
F4JGB6 5.33e-05 48 38 5 100 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
F4JGB6 0.000182 46 25 12 308 3 RLP46 Receptor-like protein 46 Arabidopsis thaliana
Q8WXD0 2.57e-10 64 32 7 173 1 RXFP2 Relaxin receptor 2 Homo sapiens
C0STK7 2.57e-10 63 31 9 249 1 None Phospholipase A2 inhibitor beta Elaphe climacophora
C0STK7 1.01e-05 50 27 6 188 1 None Phospholipase A2 inhibitor beta Elaphe climacophora
C0LGH2 2.79e-10 64 27 10 237 2 At1g56130 Probable LRR receptor-like serine/threonine-protein kinase At1g56130 Arabidopsis thaliana
C0LGH2 3.6e-07 55 23 9 263 2 At1g56130 Probable LRR receptor-like serine/threonine-protein kinase At1g56130 Arabidopsis thaliana
Q9LS80 2.93e-10 64 27 7 245 3 RLP37 Receptor-like protein 37 Arabidopsis thaliana
Q9LS80 4.54e-10 63 29 10 239 3 RLP37 Receptor-like protein 37 Arabidopsis thaliana
Q9LS80 4.63e-06 51 27 8 215 3 RLP37 Receptor-like protein 37 Arabidopsis thaliana
Q9SJH6 3.51e-10 63 28 6 178 2 RLP29 Receptor like protein 29 Arabidopsis thaliana
Q9SJH6 1.37e-07 55 29 7 186 2 RLP29 Receptor like protein 29 Arabidopsis thaliana
F4J7T6 3.54e-10 64 30 8 213 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
F4J7T6 4.29e-06 51 27 6 189 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
F4J7T6 0.000328 45 24 10 240 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
F4J7T6 0.000429 45 25 10 236 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
F4J7T6 0.0006 45 25 9 262 3 RLP39 Receptor-like protein 39 Arabidopsis thaliana
Q9N0E3 3.66e-10 63 33 10 238 2 RTN4R Reticulon-4 receptor Macaca fascicularis
O93233 4.11e-10 63 31 7 226 1 None Phospholipase A2 inhibitor Gloydius brevicaudus siniticus
O93233 9.02e-05 47 31 6 157 1 None Phospholipase A2 inhibitor Gloydius brevicaudus siniticus
Q7AP87 4.48e-10 63 30 8 209 1 inlH Internalin H Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9C7S5 4.71e-10 63 24 11 314 1 PSY1R Tyrosine-sulfated glycopeptide receptor 1 Arabidopsis thaliana
Q9C7S5 0.000601 45 25 10 202 1 PSY1R Tyrosine-sulfated glycopeptide receptor 1 Arabidopsis thaliana
Q5XM32 4.83e-10 63 32 7 173 2 RXFP2 Relaxin receptor 2 Canis lupus familiaris
Q5XM32 1.11e-08 59 27 9 223 2 RXFP2 Relaxin receptor 2 Canis lupus familiaris
Q75BI3 5.44e-10 63 40 1 87 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P46023 5.57e-10 63 25 8 194 2 None G-protein coupled receptor GRL101 Lymnaea stagnalis
Q5E9X4 8.35e-10 62 40 0 81 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 5.92e-07 53 38 1 100 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 5.63e-06 50 30 1 110 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q5E9X4 6.34e-06 50 29 1 110 2 LRRC59 Leucine-rich repeat-containing protein 59 Bos taurus
Q8GUQ5 9.69e-10 62 28 12 265 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 2.86e-09 61 27 11 235 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 4.01e-09 60 28 13 258 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q8GUQ5 4.47e-09 60 27 13 260 1 CURL3 Brassinosteroid LRR receptor kinase Solanum lycopersicum
Q9V477 1.02e-09 62 26 9 287 1 Tollo Toll-like receptor Tollo Drosophila melanogaster
Q9V477 4.24e-08 57 24 7 241 1 Tollo Toll-like receptor Tollo Drosophila melanogaster
O22476 1.24e-09 62 26 13 271 1 BRI1 Protein BRASSINOSTEROID INSENSITIVE 1 Arabidopsis thaliana
O22476 2.02e-07 55 26 13 281 1 BRI1 Protein BRASSINOSTEROID INSENSITIVE 1 Arabidopsis thaliana
O22476 3.51e-05 48 28 14 253 1 BRI1 Protein BRASSINOSTEROID INSENSITIVE 1 Arabidopsis thaliana
O22476 0.000142 47 31 3 105 1 BRI1 Protein BRASSINOSTEROID INSENSITIVE 1 Arabidopsis thaliana
O22476 0.000262 46 29 14 244 1 BRI1 Protein BRASSINOSTEROID INSENSITIVE 1 Arabidopsis thaliana
Q9SKK5 1.27e-09 62 28 10 237 3 RLP20 Receptor-like protein 20 Arabidopsis thaliana
Q9SKK5 0.000439 45 23 10 264 3 RLP20 Receptor-like protein 20 Arabidopsis thaliana
Q14392 1.42e-09 62 28 8 274 1 LRRC32 Transforming growth factor beta activator LRRC32 Homo sapiens
Q14392 0.000243 46 26 9 263 1 LRRC32 Transforming growth factor beta activator LRRC32 Homo sapiens
Q99PI8 1.56e-09 62 33 10 229 1 Rtn4r Reticulon-4 receptor Mus musculus
Q9FXF2 1.61e-09 62 26 9 267 1 RKF1 Probable LRR receptor-like serine/threonine-protein kinase RFK1 Arabidopsis thaliana
Q9M9X0 1.63e-09 62 28 6 192 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
Q9M9X0 8.02e-09 60 26 11 239 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
Q9M9X0 9.02e-07 53 27 11 228 2 RLP32 Receptor-like protein 32 Arabidopsis thaliana
Q7L0X0 1.72e-09 62 33 9 235 1 TRIL TLR4 interactor with leucine rich repeats Homo sapiens
Q7L0X0 0.000136 47 31 7 160 1 TRIL TLR4 interactor with leucine rich repeats Homo sapiens
C0LGK9 1.98e-09 62 27 9 250 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
C0LGK9 7.71e-07 53 27 4 162 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
C0LGK9 0.000669 44 27 4 137 1 At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230 Arabidopsis thaliana
Q8GT95 2.04e-09 61 27 8 236 2 FOR1 Polygalacturonase inhibitor 1 Oryza sativa subsp. japonica
P0CE12 2.16e-09 61 28 8 239 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZPH9 2.16e-09 61 28 8 239 1 sspH2 E3 ubiquitin-protein ligase SspH2 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q9S7I6 2.3e-09 61 32 10 209 1 RPK2 LRR receptor-like serine/threonine-protein kinase RPK2 Arabidopsis thaliana
Q86WK6 2.43e-09 61 32 9 178 1 AMIGO1 Amphoterin-induced protein 1 Homo sapiens
C0LGT6 2.49e-09 61 25 12 295 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
C0LGT6 1.9e-07 55 26 9 258 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
C0LGT6 0.000234 46 23 7 209 1 EFR LRR receptor-like serine/threonine-protein kinase EFR Arabidopsis thaliana
P40197 2.53e-09 61 27 8 210 1 GP5 Platelet glycoprotein V Homo sapiens
P40197 1.29e-06 53 30 7 173 1 GP5 Platelet glycoprotein V Homo sapiens
Q9C6A8 3.08e-09 61 25 11 261 3 RLP15 Receptor-like protein 15 Arabidopsis thaliana
Q9C6A8 1.01e-08 59 29 10 251 3 RLP15 Receptor-like protein 15 Arabidopsis thaliana
F4I9S3 3.11e-09 61 29 11 237 2 RLP9A Receptor-like protein 9a Arabidopsis thaliana
F4I9S3 7.78e-05 47 26 8 220 2 RLP9A Receptor-like protein 9a Arabidopsis thaliana
F4I9S3 9.72e-05 47 27 7 186 2 RLP9A Receptor-like protein 9a Arabidopsis thaliana
F4I9S3 0.000508 45 26 10 270 2 RLP9A Receptor-like protein 9a Arabidopsis thaliana
F4I9S3 0.00054 45 27 6 177 2 RLP9A Receptor-like protein 9a Arabidopsis thaliana
Q99M75 3.75e-09 60 33 10 229 1 Rtn4r Reticulon-4 receptor Rattus norvegicus
Q38SD2 3.99e-09 61 23 7 242 1 LRRK1 Leucine-rich repeat serine/threonine-protein kinase 1 Homo sapiens
Q38SD2 6.51e-09 60 27 6 232 1 LRRK1 Leucine-rich repeat serine/threonine-protein kinase 1 Homo sapiens
Q4UWF4 4.05e-09 60 29 1 123 1 xopAC Uridine 5'-monophosphate transferase Xanthomonas campestris pv. campestris (strain 8004)
Q4UWF4 0.000208 46 27 1 122 1 xopAC Uridine 5'-monophosphate transferase Xanthomonas campestris pv. campestris (strain 8004)
Q9ZUI0 4.37e-09 60 33 9 178 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q9ZUI0 5.59e-09 60 30 10 256 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q9ZUI0 1.1e-08 59 27 13 254 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q9ZUI0 1.48e-05 50 34 4 105 3 At2g24130 Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g24130 Arabidopsis thaliana
Q9DE67 5.19e-09 60 29 9 217 2 LUM Lumican Coturnix japonica
Q9VPF0 5.22e-09 60 25 10 308 1 atk Protein artichoke Drosophila melanogaster
Q9VPF0 1.37e-05 50 27 8 240 1 atk Protein artichoke Drosophila melanogaster
Q9VPF0 0.000268 46 27 10 266 1 atk Protein artichoke Drosophila melanogaster
Q9C6A6 5.39e-09 60 27 12 273 3 RLP13 Receptor-like protein 13 Arabidopsis thaliana
Q9C6A6 0.000265 46 26 8 220 3 RLP13 Receptor-like protein 13 Arabidopsis thaliana
C0LGD7 5.6e-09 60 26 6 217 1 At1g06840 Probable LRR receptor-like serine/threonine-protein kinase At1g06840 Arabidopsis thaliana
O08742 5.67e-09 60 28 10 268 1 Gp5 Platelet glycoprotein V Mus musculus
C0LGP9 6.93e-09 60 27 9 230 1 IMK3 Probable leucine-rich repeat receptor-like protein kinase IMK3 Arabidopsis thaliana
C0LGP9 6.52e-06 51 27 7 191 1 IMK3 Probable leucine-rich repeat receptor-like protein kinase IMK3 Arabidopsis thaliana
Q9ZWC8 7.33e-09 60 28 10 237 1 BRL1 Serine/threonine-protein kinase BRI1-like 1 Arabidopsis thaliana
Q9ZWC8 1.35e-08 59 27 13 264 1 BRL1 Serine/threonine-protein kinase BRI1-like 1 Arabidopsis thaliana
Q9ZWC8 6.11e-08 57 26 11 259 1 BRL1 Serine/threonine-protein kinase BRI1-like 1 Arabidopsis thaliana
Q54M77 8.18e-09 60 26 5 208 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q54M77 1.14e-08 59 25 6 215 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q54M77 3.36e-08 58 29 3 168 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
Q54M77 1.21e-06 53 37 0 86 3 roco8 Probable serine/threonine-protein kinase roco8 Dictyostelium discoideum
O75094 9.67e-09 60 35 3 106 1 SLIT3 Slit homolog 3 protein Homo sapiens
O75094 1.76e-06 53 26 7 191 1 SLIT3 Slit homolog 3 protein Homo sapiens
O75094 0.000256 46 27 7 155 1 SLIT3 Slit homolog 3 protein Homo sapiens
Q9SRL7 1.09e-08 59 27 10 242 3 RLP35 Receptor-like protein 35 Arabidopsis thaliana
P51890 1.16e-08 58 29 9 217 1 LUM Lumican Gallus gallus
Q8C110 1.24e-08 59 31 4 137 1 Slitrk6 SLIT and NTRK-like protein 6 Mus musculus
E9Q7T7 1.27e-08 59 29 7 184 1 Chadl Chondroadherin-like protein Mus musculus
E9Q7T7 2.65e-08 58 29 12 261 1 Chadl Chondroadherin-like protein Mus musculus
C0LGU1 1.29e-08 59 25 8 248 1 At5g37450 Probable LRR receptor-like serine/threonine-protein kinase At5g37450 Arabidopsis thaliana
D0ZRB2 1.37e-08 59 31 9 195 1 slrP E3 ubiquitin-protein ligase SlrP Salmonella typhimurium (strain 14028s / SGSC 2262)
D0ZRB2 1.01e-05 50 27 11 255 1 slrP E3 ubiquitin-protein ligase SlrP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q960C5 1.42e-08 59 27 4 195 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q960C5 6.12e-08 57 38 1 90 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q960C5 8.47e-07 53 32 3 146 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q960C5 0.000516 45 28 3 148 2 Lrch Leucine-rich repeat and calponin homology domain-containing protein Drosophila melanogaster
Q6NWG1 1.48e-08 58 36 1 95 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 2.65e-08 57 33 2 118 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q6NWG1 0.000439 44 41 1 73 2 lrrc59 Leucine-rich repeat-containing protein 59 Danio rerio
Q5RI43 1.51e-08 58 28 11 258 1 kera Keratocan Danio rerio
A0A1P8ATR9 1.59e-08 59 28 11 259 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
A0A1P8ATR9 2.26e-06 52 23 11 321 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
A0A1P8ATR9 0.000115 47 28 3 134 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
A0A1P8ATR9 0.000207 46 28 7 176 3 RLP9B Receptor-like protein 9b Arabidopsis thaliana
P58823 1.64e-08 58 28 6 224 1 PGIP3 Polygalacturonase inhibitor 3 Phaseolus vulgaris
Q91ZZ5 1.7e-08 58 27 8 225 2 Rxfp2 Relaxin receptor 2 Mus musculus
P22792 1.72e-08 58 29 10 250 1 CPN2 Carboxypeptidase N subunit 2 Homo sapiens
P22792 5.85e-06 51 27 7 192 1 CPN2 Carboxypeptidase N subunit 2 Homo sapiens
P22792 0.000709 44 30 6 153 1 CPN2 Carboxypeptidase N subunit 2 Homo sapiens
Q5RF01 1.78e-08 58 27 8 274 2 LRRC32 Transforming growth factor beta activator LRRC32 Pongo abelii
Q5RF01 0.000301 45 23 10 361 2 LRRC32 Transforming growth factor beta activator LRRC32 Pongo abelii
Q6CJU4 1.82e-08 58 36 1 95 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q7Z2Q7 1.86e-08 58 27 8 235 1 LRRC70 Leucine-rich repeat-containing protein 70 Homo sapiens
Q7Z2Q7 9.11e-07 53 28 9 245 1 LRRC70 Leucine-rich repeat-containing protein 70 Homo sapiens
P12024 2.1e-08 58 27 9 246 1 chp Chaoptin Drosophila melanogaster
P12024 2.09e-07 55 27 9 255 1 chp Chaoptin Drosophila melanogaster
P51884 2.25e-08 58 27 12 256 1 LUM Lumican Homo sapiens
Q9R1B9 2.27e-08 58 31 5 139 2 Slit2 Slit homolog 2 protein Mus musculus
Q9H5Y7 2.57e-08 58 31 4 137 1 SLITRK6 SLIT and NTRK-like protein 6 Homo sapiens
Q9H5Y7 0.000569 45 28 5 137 1 SLITRK6 SLIT and NTRK-like protein 6 Homo sapiens
Q5BK65 2.73e-08 58 28 11 254 2 Nrros Transforming growth factor beta activator LRRC33 Rattus norvegicus
Q9MA83 2.78e-08 58 28 10 246 2 RLP30 Receptor-like protein 30 Arabidopsis thaliana
A6NIK2 3.31e-08 57 26 1 208 1 LRRC10B Leucine-rich repeat-containing protein 10B Homo sapiens
Q28888 3.48e-08 57 28 10 253 2 DCN Decorin Oryctolagus cuniculus
Q8ZQQ2 3.5e-08 58 31 9 195 1 slrP E3 ubiquitin-protein ligase SlrP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQQ2 6.2e-06 51 27 11 255 1 slrP E3 ubiquitin-protein ligase SlrP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LJF3 3.52e-08 58 26 10 233 1 BRL3 Receptor-like protein kinase BRI1-like 3 Arabidopsis thaliana
Q9LJF3 1.05e-07 56 28 12 258 1 BRL3 Receptor-like protein kinase BRI1-like 3 Arabidopsis thaliana
Q5R1V9 3.53e-08 57 27 10 253 2 DCN Decorin Pan troglodytes
P07585 3.53e-08 57 27 10 253 1 DCN Decorin Homo sapiens
Q9S9U3 3.6e-08 58 26 9 254 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
Q9S9U3 0.000165 46 29 4 125 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
Q9S9U3 0.000345 45 28 11 256 3 RLP53 Receptor-like protein 53 Arabidopsis thaliana
C0LGG8 4.01e-08 57 27 10 233 1 At1g53430 Probable LRR receptor-like serine/threonine-protein kinase At1g53430 Arabidopsis thaliana
C0LGG8 1.06e-06 53 26 10 249 1 At1g53430 Probable LRR receptor-like serine/threonine-protein kinase At1g53430 Arabidopsis thaliana
Q8BMT4 4.22e-08 57 28 10 253 1 Nrros Transforming growth factor beta activator LRRC33 Mus musculus
Q3UHC2 4.65e-08 57 25 10 284 1 Lrrk1 Leucine-rich repeat serine/threonine-protein kinase 1 Mus musculus
Q3UHC2 3.28e-06 52 25 7 234 1 Lrrk1 Leucine-rich repeat serine/threonine-protein kinase 1 Mus musculus
Q9JK53 4.7e-08 57 27 8 200 1 Prelp Prolargin Mus musculus
F4J9A8 5.03e-08 57 26 11 287 2 RLP45 Receptor-like protein 45 Arabidopsis thaliana
F4J9A8 0.000345 45 25 14 282 2 RLP45 Receptor-like protein 45 Arabidopsis thaliana
Q9LH52 5.04e-08 57 30 5 160 1 FLR1 Leucine-rich repeat protein FLOR 1 Arabidopsis thaliana
P58822 5.26e-08 57 28 7 229 1 PGIP2 Polygalacturonase inhibitor 2 Phaseolus vulgaris
Q8SU52 5.44e-08 57 40 0 80 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 3.19e-07 54 32 0 93 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 9.43e-06 50 33 0 71 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 0.00019 46 24 0 98 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q8SU52 0.000356 45 27 1 104 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Encephalitozoon cuniculi (strain GB-M1)
Q6NUI6 5.96e-08 57 30 12 257 1 CHADL Chondroadherin-like protein Homo sapiens
Q6NUI6 1.33e-06 53 28 8 187 1 CHADL Chondroadherin-like protein Homo sapiens
Q9WVB4 6.08e-08 57 35 3 106 2 Slit3 Slit homolog 3 protein Mus musculus
Q9WVB4 1.17e-05 50 28 4 137 2 Slit3 Slit homolog 3 protein Mus musculus
Q6R5N8 6.37e-08 57 30 8 212 1 Tlr13 Toll-like receptor 13 Mus musculus
Q6R5N8 2.98e-06 52 28 14 288 1 Tlr13 Toll-like receptor 13 Mus musculus
Q6R5N8 0.000198 46 28 11 224 1 Tlr13 Toll-like receptor 13 Mus musculus
Q7Z5L7 7.01e-08 57 28 11 263 1 PODN Podocan Homo sapiens
Q7Z5L7 4.44e-07 54 24 13 349 1 PODN Podocan Homo sapiens
Q28256 7.27e-08 57 37 6 132 2 GP1BA Platelet glycoprotein Ib alpha chain Canis lupus familiaris
P35334 7.73e-08 56 28 7 229 1 PGIP1 Polygalacturonase inhibitor 1 Phaseolus vulgaris
C0LGG9 7.98e-08 57 26 10 235 2 At1g53440 Probable LRR receptor-like serine/threonine-protein kinase At1g53440 Arabidopsis thaliana
F4HTV4 8.4e-08 57 26 13 299 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
F4HTV4 6.67e-06 51 26 13 288 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
F4HTV4 1.33e-05 50 25 14 291 3 RLP14 Receptor-like protein 14 Arabidopsis thaliana
Q5R6B1 8.74e-08 56 28 6 186 2 LRRTM1 Leucine-rich repeat transmembrane neuronal protein 1 Pongo abelii
Q5R6B1 0.000181 46 24 6 205 2 LRRTM1 Leucine-rich repeat transmembrane neuronal protein 1 Pongo abelii
Q05443 9.46e-08 56 28 11 231 1 LUM Lumican Bos taurus
O94813 1.05e-07 56 32 4 119 1 SLIT2 Slit homolog 2 protein Homo sapiens
Q9SKK2 1.06e-07 56 25 15 309 3 RLP21 Receptor like protein 21 Arabidopsis thaliana
Q9SKK2 2.17e-06 52 28 12 262 3 RLP21 Receptor like protein 21 Arabidopsis thaliana
Q9SKK2 4.74e-06 51 25 11 316 3 RLP21 Receptor like protein 21 Arabidopsis thaliana
C0LGN2 1.08e-07 56 26 9 214 1 LRR-RLK Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 Arabidopsis thaliana
C0LGN2 1.6e-06 53 27 9 237 1 LRR-RLK Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 Arabidopsis thaliana
Q54Y32 1.09e-07 56 25 5 205 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 1.19e-07 56 28 2 141 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 2.48e-07 55 32 1 103 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 2.62e-06 52 30 2 108 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q54Y32 5.28e-06 51 26 4 180 3 mpl3 MAP kinase phosphatase with leucine-rich repeats protein 3 Dictyostelium discoideum
Q7TQ62 1.09e-07 56 26 11 300 2 Podn Podocan Mus musculus
Q7TQ62 7.77e-07 53 29 13 281 2 Podn Podocan Mus musculus
A2BHJ4 1.11e-07 56 33 1 123 2 cnot6l CCR4-NOT transcription complex subunit 6-like Danio rerio
A2BHJ4 0.000583 44 38 0 71 2 cnot6l CCR4-NOT transcription complex subunit 6-like Danio rerio
Q9SVN2 1.14e-07 56 24 12 273 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SVN2 2.25e-06 52 24 6 257 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SVN2 0.000225 46 22 12 310 3 RLP47 Receptor-like protein 47 Arabidopsis thaliana
Q9SSD1 1.27e-07 56 27 12 229 1 TMM Protein TOO MANY MOUTHS Arabidopsis thaliana
Q9SSD1 0.000412 45 22 7 253 1 TMM Protein TOO MANY MOUTHS Arabidopsis thaliana
Q5S007 1.29e-07 56 25 7 230 1 LRRK2 Leucine-rich repeat serine/threonine-protein kinase 2 Homo sapiens
Q5S007 1.12e-06 53 26 7 225 1 LRRK2 Leucine-rich repeat serine/threonine-protein kinase 2 Homo sapiens
Q5S007 0.000171 47 25 10 218 1 LRRK2 Leucine-rich repeat serine/threonine-protein kinase 2 Homo sapiens
O49329 1.42e-07 56 28 6 203 3 RLP24 Receptor like protein 24 Arabidopsis thaliana
O49329 4.04e-07 54 25 8 266 3 RLP24 Receptor like protein 24 Arabidopsis thaliana
Q5B778 1.43e-07 56 33 0 101 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 1.52e-05 49 28 1 145 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 2.34e-05 49 27 0 107 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B778 0.000154 46 33 2 114 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q05C16 1.57e-07 55 33 0 104 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 2.1e-06 52 31 2 117 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 7.27e-06 50 28 1 121 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 9.18e-05 47 30 0 101 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
Q05C16 0.001 44 24 2 181 1 LRRC63 Leucine-rich repeat-containing protein 63 Homo sapiens
A0A1D6F5N5 1.68e-07 54 27 6 174 1 BAK6 Disease resistance protein BAK6 Zea mays
O94294 1.69e-07 55 28 1 134 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 2.43e-07 55 29 1 133 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 1.13e-06 53 37 0 81 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 0.000102 47 31 0 86 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94294 0.000634 45 32 1 103 1 sog2 Leucine-rich repeat-containing protein sog2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O02678 1.72e-07 55 28 12 257 2 BGN Biglycan Canis lupus familiaris
O02678 5.54e-05 47 25 7 201 2 BGN Biglycan Canis lupus familiaris
Q6PGX3 1.75e-07 55 31 9 206 2 lrfn1 Leucine-rich repeat and fibronectin type III domain-containing protein 1 Danio rerio
Q6PGX3 1.54e-05 49 27 6 155 2 lrfn1 Leucine-rich repeat and fibronectin type III domain-containing protein 1 Danio rerio
Q9ZUK7 1.77e-07 55 26 14 266 2 RLP18 Receptor-like protein 18 Arabidopsis thaliana
Q9ZUK7 7.1e-06 50 25 12 269 2 RLP18 Receptor-like protein 18 Arabidopsis thaliana
Q86YC3 1.86e-07 55 28 13 260 1 NRROS Transforming growth factor beta activator LRRC33 Homo sapiens
Q86YC3 7.94e-05 47 28 10 213 1 NRROS Transforming growth factor beta activator LRRC33 Homo sapiens
Q86YC3 0.000246 46 28 8 184 1 NRROS Transforming growth factor beta activator LRRC33 Homo sapiens
Q505F5 1.95e-07 55 27 5 180 1 Lrrc47 Leucine-rich repeat-containing protein 47 Mus musculus
Q505F5 1.3e-06 53 32 3 127 1 Lrrc47 Leucine-rich repeat-containing protein 47 Mus musculus
Q505F5 1.39e-06 53 28 6 198 1 Lrrc47 Leucine-rich repeat-containing protein 47 Mus musculus
O88280 2.06e-07 55 34 3 106 2 Slit3 Slit homolog 3 protein Rattus norvegicus
O88280 6.29e-06 51 28 4 137 2 Slit3 Slit homolog 3 protein Rattus norvegicus
Q08817 2.12e-07 55 27 3 155 1 SOG2 Leucine-rich repeat-containing protein SOG2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08817 0.000383 45 28 2 125 1 SOG2 Leucine-rich repeat-containing protein SOG2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P21793 2.23e-07 55 27 7 201 1 DCN Decorin Bos taurus
Q9TTE2 2.25e-07 55 27 7 201 2 DCN Decorin Ovis aries
P31384 2.38e-07 55 36 0 80 1 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P31384 0.001 44 30 2 105 1 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O48849 2.39e-07 55 30 5 192 1 RLP23 Receptor like protein 23 Arabidopsis thaliana
O48849 0.000133 47 25 11 275 1 RLP23 Receptor like protein 23 Arabidopsis thaliana
O48849 0.000499 45 25 5 217 1 RLP23 Receptor like protein 23 Arabidopsis thaliana
Q9LUI1 2.67e-07 55 24 8 230 2 LRX6 Leucine-rich repeat extensin-like protein 6 Arabidopsis thaliana
Q9EQP5 2.81e-07 54 27 8 198 2 Prelp Prolargin Rattus norvegicus
Q8IUZ0 2.81e-07 55 32 6 162 1 LRRC49 Leucine-rich repeat-containing protein 49 Homo sapiens
Q8GZ99 2.85e-07 55 29 13 247 1 HPCA1 Leucine-rich repeat receptor protein kinase HPCA1 Arabidopsis thaliana
Q8GZ99 0.000133 47 26 11 266 1 HPCA1 Leucine-rich repeat receptor protein kinase HPCA1 Arabidopsis thaliana
Q8GZ99 0.000242 46 32 3 113 1 HPCA1 Leucine-rich repeat receptor protein kinase HPCA1 Arabidopsis thaliana
O46379 2.86e-07 53 28 7 187 2 LUM Lumican (Fragment) Oryctolagus cuniculus
Q80WD1 2.99e-07 54 32 8 175 1 Rtn4rl2 Reticulon-4 receptor-like 2 Rattus norvegicus
Q965M2 3.07e-07 55 26 9 279 1 sma-10 Leucine-rich repeats and immunoglobulin-like domains protein sma-10 Caenorhabditis elegans
Q965M2 3.71e-06 52 35 3 111 1 sma-10 Leucine-rich repeats and immunoglobulin-like domains protein sma-10 Caenorhabditis elegans
Q965M2 3.45e-05 48 29 6 168 1 sma-10 Leucine-rich repeats and immunoglobulin-like domains protein sma-10 Caenorhabditis elegans
Q965M2 0.001 44 29 8 208 1 sma-10 Leucine-rich repeats and immunoglobulin-like domains protein sma-10 Caenorhabditis elegans
Q6BMM5 3.14e-07 55 38 0 78 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q6BMM5 4.53e-05 48 32 2 110 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q6BMM5 0.00024 46 29 0 116 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9GZU5 3.4e-07 54 28 11 280 1 NYX Nyctalopin Homo sapiens
Q6FRT2 3.44e-07 55 37 0 80 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FRT2 9.59e-05 47 30 0 91 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q8N1G4 3.48e-07 54 27 7 215 1 LRRC47 Leucine-rich repeat-containing protein 47 Homo sapiens
Q8N1G4 7.42e-07 53 31 3 127 1 LRRC47 Leucine-rich repeat-containing protein 47 Homo sapiens
Q8N1G4 6.18e-05 47 27 6 200 1 LRRC47 Leucine-rich repeat-containing protein 47 Homo sapiens
Q9SZ67 3.65e-07 55 28 6 168 1 WRKY19 Probable WRKY transcription factor 19 Arabidopsis thaliana
Q80XU8 3.9e-07 54 31 9 182 1 Lrfn4 Leucine-rich repeat and fibronectin type-III domain-containing protein 4 Mus musculus
Q80XU8 1.36e-05 50 30 7 152 1 Lrfn4 Leucine-rich repeat and fibronectin type-III domain-containing protein 4 Mus musculus
Q9XSD9 4.29e-07 54 25 10 255 2 DCN Decorin Sus scrofa
Q9XSD9 1.01e-06 53 26 7 201 2 DCN Decorin Sus scrofa
Q9H156 4.36e-07 54 29 4 141 1 SLITRK2 SLIT and NTRK-like protein 2 Homo sapiens
D4ABX8 4.38e-07 54 31 9 182 1 Lrfn4 Leucine-rich repeat and fibronectin type-III domain-containing protein 4 Rattus norvegicus
D4ABX8 1.5e-05 49 30 7 152 1 Lrfn4 Leucine-rich repeat and fibronectin type-III domain-containing protein 4 Rattus norvegicus
Q810C0 4.99e-07 54 29 4 141 1 Slitrk2 SLIT and NTRK-like protein 2 Mus musculus
Q0WR59 5.18e-07 54 26 12 273 1 At5g10020 Probable inactive receptor kinase At5g10020 Arabidopsis thaliana
Q0WR59 1.98e-05 49 22 10 282 1 At5g10020 Probable inactive receptor kinase At5g10020 Arabidopsis thaliana
Q0WR59 0.000836 44 24 12 306 1 At5g10020 Probable inactive receptor kinase At5g10020 Arabidopsis thaliana
Q9DE66 5.34e-07 53 27 10 248 2 KERA Keratocan Coturnix japonica
Q5A761 5.51e-07 54 37 0 88 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A761 5.9e-05 48 34 1 99 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A761 0.000732 44 32 0 77 3 CCR4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q86UN3 5.58e-07 53 32 8 175 1 RTN4RL2 Reticulon-4 receptor-like 2 Homo sapiens
Q496Z2 5.65e-07 54 30 8 193 1 Tril TLR4 interactor with leucine rich repeats Rattus norvegicus
O46390 5.82e-07 53 28 13 259 2 BGN Biglycan Ovis aries
O46390 7.66e-05 47 25 7 201 2 BGN Biglycan Ovis aries
F4HTV6 5.87e-07 53 27 7 215 5 RLP16 Putative receptor-like protein 16 Arabidopsis thaliana
F4HTV6 0.000277 45 23 7 239 5 RLP16 Putative receptor-like protein 16 Arabidopsis thaliana
P47853 6.31e-07 53 28 13 259 1 Bgn Biglycan Rattus norvegicus
P47853 5.11e-05 47 25 7 201 1 Bgn Biglycan Rattus norvegicus
Q4V8G0 6.65e-07 53 30 0 110 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 1.73e-05 49 26 1 131 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 1.79e-05 49 29 0 107 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 0.000111 47 25 0 135 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
Q4V8G0 0.00081 44 29 0 101 2 Lrrc63 Leucine-rich repeat-containing protein 63 Rattus norvegicus
P28653 6.67e-07 53 28 13 259 1 Bgn Biglycan Mus musculus
P28653 6.82e-05 47 25 7 201 1 Bgn Biglycan Mus musculus
P21809 6.73e-07 53 28 13 259 1 BGN Biglycan Bos taurus
P21809 7e-05 47 25 7 201 1 BGN Biglycan Bos taurus
Q9LJS0 6.86e-07 53 25 6 239 1 RLP42 Receptor-like protein 42 Arabidopsis thaliana
Q9LJS0 1.25e-06 53 28 6 192 1 RLP42 Receptor-like protein 42 Arabidopsis thaliana
Q9LJS0 0.000326 45 25 8 211 1 RLP42 Receptor-like protein 42 Arabidopsis thaliana
Q9LNV9 7.07e-07 54 27 11 230 2 RLP1 Receptor-like protein 1 Arabidopsis thaliana
Q9LNV9 1.44e-06 53 30 9 180 2 RLP1 Receptor-like protein 1 Arabidopsis thaliana
Q9LNV9 1.6e-06 53 25 11 256 2 RLP1 Receptor-like protein 1 Arabidopsis thaliana
Q9LNV9 3.23e-06 52 28 8 213 2 RLP1 Receptor-like protein 1 Arabidopsis thaliana
O46403 7.15e-07 53 28 13 259 2 BGN Biglycan Equus caballus
O46403 5.83e-05 47 25 7 201 2 BGN Biglycan Equus caballus
Q9SZA7 7.22e-07 53 25 6 226 2 At4g33300 Probable disease resistance protein At4g33300 Arabidopsis thaliana
Q9SZA7 5.11e-05 48 33 3 89 2 At4g33300 Probable disease resistance protein At4g33300 Arabidopsis thaliana
Q9SZA7 0.000591 45 23 11 263 2 At4g33300 Probable disease resistance protein At4g33300 Arabidopsis thaliana
Q810B7 7.7e-07 53 34 3 107 2 Slitrk5 SLIT and NTRK-like protein 5 Mus musculus
P0CB16 7.81e-07 53 24 8 253 3 At4g19050 Putative disease resistance protein At4g19050 Arabidopsis thaliana
P0DO06 7.87e-07 53 28 12 268 3 9DC2 Receptor-like protein 9DC2 Solanum pimpinellifolium
P0DO05 7.87e-07 53 28 12 268 3 9DC1 Receptor-like protein 9DC1 Solanum pimpinellifolium
Q9SVM3 7.9e-07 53 26 10 258 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 9.76e-06 50 22 12 318 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
Q9SVM3 3.07e-05 48 25 8 254 2 RLP49 Receptor-like protein 49 Arabidopsis thaliana
C4V7I7 8.03e-07 53 37 0 89 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Vairimorpha ceranae (strain BRL01)
C4V7I7 0.000116 47 28 3 128 3 CCR4 Probable CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Vairimorpha ceranae (strain BRL01)
P13605 8.34e-07 53 26 9 253 1 FMOD Fibromodulin Bos taurus
P13605 2.65e-05 48 31 5 184 1 FMOD Fibromodulin Bos taurus
O42235 8.35e-07 53 27 10 248 1 KERA Keratocan Gallus gallus
Q5MR23 8.45e-07 53 28 12 268 3 9DC3 Receptor-like protein 9DC3 Solanum pimpinellifolium
Q5MR23 0.000446 45 27 11 227 3 9DC3 Receptor-like protein 9DC3 Solanum pimpinellifolium
Q9C699 8.61e-07 53 25 11 270 3 RLP7 Receptor-like protein 7 Arabidopsis thaliana
Q9C699 5.37e-06 51 25 9 232 3 RLP7 Receptor-like protein 7 Arabidopsis thaliana
Q9C699 1.07e-05 50 26 13 288 3 RLP7 Receptor-like protein 7 Arabidopsis thaliana
Q9C699 0.000218 46 23 11 253 3 RLP7 Receptor-like protein 7 Arabidopsis thaliana
Q9C699 0.000389 45 27 9 213 3 RLP7 Receptor-like protein 7 Arabidopsis thaliana
Q8K377 9.29e-07 53 28 8 207 2 Lrrtm1 Leucine-rich repeat transmembrane neuronal protein 1 Mus musculus
B1H134 9.76e-07 53 28 5 170 2 flrt3 Leucine-rich repeat transmembrane protein FLRT3 Xenopus tropicalis
B1H134 0.000769 44 27 9 201 2 flrt3 Leucine-rich repeat transmembrane protein FLRT3 Xenopus tropicalis
Q6XHB2 9.8e-07 53 37 2 96 1 roco4 Probable serine/threonine-protein kinase roco4 Dictyostelium discoideum
D4A7P2 1e-06 53 29 9 236 1 Lrrtm2 Leucine-rich repeat transmembrane neuronal protein 2 Rattus norvegicus
Q2UUI3 1.05e-06 53 34 1 98 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UUI3 4.57e-05 48 25 5 234 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UUI3 0.000189 46 37 0 83 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q810B8 1.05e-06 53 26 5 157 1 Slitrk4 SLIT and NTRK-like protein 4 Mus musculus
C0LGE0 1.15e-06 53 25 9 244 1 At1g07650 Probable LRR receptor-like serine/threonine-protein kinase At1g07650 Arabidopsis thaliana
Q0CT27 1.16e-06 53 33 0 100 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CT27 0.000224 46 33 1 99 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CT27 0.000268 45 37 0 83 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CT27 0.000531 45 26 0 125 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q3ZBI5 1.22e-06 53 28 12 263 2 NRROS Transforming growth factor beta activator LRRC33 Bos taurus
Q5F334 1.25e-06 52 43 2 85 2 LRRC59 Leucine-rich repeat-containing protein 59 Gallus gallus
Q5F334 0.000162 46 39 1 81 2 LRRC59 Leucine-rich repeat-containing protein 59 Gallus gallus
Q7M6Z0 1.3e-06 52 32 8 175 1 Rtn4rl2 Reticulon-4 receptor-like 2 Mus musculus
Q8LPB4 1.31e-06 53 29 9 193 1 PSKR Phytosulfokine receptor 1 Daucus carota
Q8LPB4 2.77e-06 52 27 10 246 1 PSKR Phytosulfokine receptor 1 Daucus carota
Q8LPB4 0.000212 46 25 10 257 1 PSKR Phytosulfokine receptor 1 Daucus carota
Q9LVN2 1.34e-06 53 30 13 245 2 At5g58150 Probably inactive leucine-rich repeat receptor-like protein kinase At5g58150 Arabidopsis thaliana
Q9LVT1 1.37e-06 53 25 15 322 3 At5g47280 Putative disease resistance protein At5g47280 Arabidopsis thaliana
Q9LVT1 3.44e-05 48 26 5 156 3 At5g47280 Putative disease resistance protein At5g47280 Arabidopsis thaliana
Q8IW52 1.43e-06 53 26 5 157 1 SLITRK4 SLIT and NTRK-like protein 4 Homo sapiens
A0N0X6 1.54e-06 52 28 9 220 3 LRRN1 Leucine-rich repeat neuronal protein 1 Bos taurus
P21810 1.64e-06 52 27 13 259 1 BGN Biglycan Homo sapiens
P21810 6.39e-05 47 25 7 201 1 BGN Biglycan Homo sapiens
Q5FW85 1.65e-06 52 28 12 257 1 Ecm2 Extracellular matrix protein 2 Mus musculus
Q9SUQ3 1.65e-06 52 33 4 121 1 At4g23740 Probable inactive receptor kinase At4g23740 Arabidopsis thaliana
Q9SUQ3 1.32e-05 50 28 6 147 1 At4g23740 Probable inactive receptor kinase At4g23740 Arabidopsis thaliana
Q9NZU0 1.74e-06 52 28 5 173 1 FLRT3 Leucine-rich repeat transmembrane protein FLRT3 Homo sapiens
Q9NZU0 0.000251 46 26 8 203 1 FLRT3 Leucine-rich repeat transmembrane protein FLRT3 Homo sapiens
Q9NZU0 0.000371 45 27 8 229 1 FLRT3 Leucine-rich repeat transmembrane protein FLRT3 Homo sapiens
Q80ZD8 1.76e-06 52 29 6 156 1 Amigo1 Amphoterin-induced protein 1 Mus musculus
Q9LK43 1.78e-06 52 24 7 234 1 TMK4 Receptor-like kinase TMK4 Arabidopsis thaliana
Q5I2M5 1.8e-06 52 28 10 242 1 TLR9 Toll-like receptor 9 Bos taurus
Q5I2M5 9.46e-06 50 26 11 253 1 TLR9 Toll-like receptor 9 Bos taurus
P51887 1.8e-06 52 28 5 184 2 FMOD Fibromodulin Gallus gallus
Q9ZU46 1.83e-06 52 28 7 187 1 ZAR1 Receptor protein kinase-like protein ZAR1 Arabidopsis thaliana
Q9LRR4 1.93e-06 52 29 3 118 3 RPPL1 Putative disease resistance RPP13-like protein 1 Arabidopsis thaliana
A1CIJ6 1.94e-06 52 39 0 81 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CIJ6 0.000299 45 37 0 78 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CIJ6 0.000604 45 25 1 132 3 ccr4 CCR4-Not complex 3'-5'-exoribonuclease subunit Ccr4 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_01085
Feature type CDS
Gene -
Product Adenylate cyclase
Location 193407 - 194282 (strand: 1)
Length 876 (nucleotides) / 291 (amino acids)
In genomic island -

Contig

Accession ZDB_679
Length 398279 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2539
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF13855 Leucine rich repeat

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4886 Transcription (K) K Leucine-rich repeat (LRR) protein

Protein Sequence

MLHQHTVSDAELNLDNGGYTSIDAFITPPYTRQVISAYNNQLSEYPAALRHCTSLRVLNLSCNQLAYIPPDIAQLTACEMLDLGHNCIADVPPEIGELHQLQYLYLSENGYSSLPSSFSGLKNLRYFNATDNQLTAIPAWFSEMEKMEEIRLYNNRITELSSAVSGLKNTREMHLMNNKITAVPDEIAAVAALEILDLNNNRVAFISPEISRLQQLNTLNLRFNALKALPENTGELSSLLYLDLRANQLSTLPDSLAALTQLRKLDLRWNNFSVIPPVAEKLQAAGCRVLL

Flanking regions ( +/- flanking 50bp)

GACGGGGCTGATAACAAGCCCTGCGGAATCGCGGATGCCGGAGCGTTTCTATGCTGCACCAACACACTGTTTCTGATGCTGAACTGAACCTGGATAACGGCGGGTATACGTCAATTGATGCGTTTATCACGCCGCCGTATACCCGGCAGGTTATCAGTGCCTATAACAATCAGCTCTCTGAATATCCGGCTGCACTGCGTCACTGTACGTCATTACGGGTACTGAATCTCTCCTGTAATCAGCTGGCTTATATTCCGCCGGATATTGCACAGCTGACTGCCTGTGAAATGCTGGATCTGGGACATAATTGTATCGCGGATGTTCCGCCGGAAATAGGTGAATTACATCAGCTGCAATATCTTTATCTCAGTGAAAACGGATACAGCAGCTTACCGTCGTCATTTTCCGGACTGAAAAATCTGCGTTATTTTAATGCAACGGATAATCAACTGACAGCAATACCGGCATGGTTTTCTGAAATGGAAAAAATGGAAGAAATCCGTCTTTATAATAACCGGATAACGGAACTGTCTTCTGCTGTCAGCGGGTTGAAAAATACCCGCGAAATGCATCTGATGAATAATAAAATAACCGCTGTTCCGGATGAGATTGCAGCTGTGGCAGCGCTGGAAATTCTTGATCTGAATAATAACCGGGTGGCGTTTATTTCGCCGGAAATAAGCCGGTTACAACAACTCAATACACTGAATCTGCGTTTCAATGCCCTGAAAGCCCTGCCGGAAAACACCGGTGAATTATCATCCCTGTTATATCTGGATTTACGTGCGAATCAGCTGAGTACACTGCCGGACAGCCTGGCAGCATTAACACAGCTGCGCAAACTGGACCTGCGCTGGAATAATTTCTCCGTCATTCCGCCGGTGGCAGAAAAATTACAGGCAGCAGGGTGCCGGGTATTGCTGTAAGAGACTCAGAAGGCAATAAAAAAGGAACCATAAGGTTCCTTTTTTGCAGA