Homologs in group_3508

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17345 FBDBKF_17345 100.0 Morganella morganii S1 gcd14 tRNA A58 N-methylase Trm61
EHELCC_01545 EHELCC_01545 100.0 Morganella morganii S2 gcd14 tRNA A58 N-methylase Trm61
NLDBIP_01915 NLDBIP_01915 100.0 Morganella morganii S4 gcd14 tRNA A58 N-methylase Trm61
LHKJJB_00120 LHKJJB_00120 100.0 Morganella morganii S3 gcd14 tRNA A58 N-methylase Trm61

Distribution of the homologs in the orthogroup group_3508

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3508

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P39367 3.45e-155 446 85 0 248 1 yjhP Uncharacterized protein YjhP Escherichia coli (strain K12)
A9KGL7 3.25e-11 67 35 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
Q820B5 3.57e-11 66 35 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBI0 3.57e-11 66 35 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J1W2 3.57e-11 66 35 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuG_Q212)
B6J5Y2 3.57e-11 66 35 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuK_Q154)
P54458 2.19e-10 64 33 3 121 3 yqeM Putative methyltransferase YqeM Bacillus subtilis (strain 168)
Q8PK00 4.27e-09 60 28 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas axonopodis pv. citri (strain 306)
C5D4V7 9.9e-09 59 34 1 104 3 GWCH70_2453 Putative methyltransferase GWCH70_2453 Geobacillus sp. (strain WCH70)
B2VIL6 2.65e-08 58 28 2 114 3 ubiG Ubiquinone biosynthesis O-methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8P8H2 5.66e-08 57 27 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RS27 5.66e-08 57 27 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVL4 5.66e-08 57 27 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q5QZ53 7.61e-08 57 32 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3BSF8 8.92e-08 56 27 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0U3W1 1.02e-07 56 28 2 114 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M12)
Q5GZB5 1.85e-07 55 26 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SHS9 1.85e-07 55 26 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2C4 1.85e-07 55 26 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4WCN5 1.97e-07 55 27 4 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Enterobacter sp. (strain 638)
Q87BG5 2.21e-07 55 28 2 114 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I705 2.21e-07 55 28 2 114 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M23)
Q9PAM5 3.14e-07 55 30 1 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain 9a5c)
A4VLX7 3.25e-07 55 28 3 136 3 ubiG Ubiquinone biosynthesis O-methyltransferase Stutzerimonas stutzeri (strain A1501)
A6TBT7 6.31e-07 54 25 2 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MPA9 9.3e-07 53 26 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q3J8U2 1.18e-06 53 30 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B5XNZ3 1.43e-06 53 25 2 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae (strain 342)
A0A482NB13 1.72e-06 53 35 7 148 1 iccD S-adenosyl-L-methionine-dependent Diels-Alderase iccD Talaromyces variabilis
O69687 2.47e-06 53 33 3 118 1 Rv3720 Probable fatty acid methyltransferase Rv3720 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6D7X5 2.65e-06 52 26 2 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3SVP3 4.69e-06 52 33 2 100 3 ubiG Ubiquinone biosynthesis O-methyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A8ADY5 5.2e-06 51 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3IJV7 5.53e-06 51 34 5 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudoalteromonas translucida (strain TAC 125)
P67064 6.24e-06 51 32 2 105 3 menG Demethylmenaquinone methyltransferase Tropheryma whipplei (strain Twist)
P67065 6.24e-06 51 32 2 105 3 menG Demethylmenaquinone methyltransferase Tropheryma whipplei (strain TW08/27)
A8GPB1 8.58e-06 50 31 1 88 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia akari (strain Hartford)
Q63QN9 9.62e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain K96243)
A3NDQ7 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 668)
Q3JNI0 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 1710b)
A1V0M1 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain SAVP1)
Q62GX2 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S5P8 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MRB1 9.7e-06 51 29 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10247)
A9MJY3 1.44e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q54I98 1.49e-05 50 24 3 158 1 smt1 Probable cycloartenol-C-24-methyltransferase 1 Dictyostelium discoideum
A4YKT6 1.49e-05 50 29 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium sp. (strain ORS 278)
Q3YZX6 1.51e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella sonnei (strain Ss046)
Q820C5 1.51e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri
Q0T2P9 1.51e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri serotype 5b (strain 8401)
B1IXV6 1.56e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q39JS9 1.57e-05 50 28 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8FFP0 1.58e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9CMI6 1.64e-05 50 32 1 80 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pasteurella multocida (strain Pm70)
A8A296 1.65e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O9:H4 (strain HS)
B7MXR3 1.65e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O81 (strain ED1a)
Q31Z65 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TW20 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R9I4 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain UTI89 / UPEC)
B6I7I7 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SE11)
B7M5R7 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O8 (strain IAI1)
B5YX17 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE29 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7
B7LAP9 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain 55989 / EAEC)
B7MFZ8 1.7e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q68WB5 1.76e-05 50 31 1 87 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q32DV8 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7N5J4 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P17993 1.76e-05 50 26 4 116 1 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12)
Q0TFL0 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1X8C6 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZU73 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZP50 1.76e-05 50 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LLI3 2.1e-05 49 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
A1U3K1 2.12e-05 49 26 3 128 3 ubiG Ubiquinone biosynthesis O-methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
C3SBU5 2.15e-05 50 32 2 78 1 TNMT1 (S)-tetrahydroprotoberberine N-methyltransferase 1 Papaver bracteatum
B8EI29 2.22e-05 49 41 0 58 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q108P1 2.48e-05 50 32 2 78 1 TNMT (S)-tetrahydroprotoberberine N-methyltransferase Papaver somniferum
Q9ZCT9 2.59e-05 49 30 2 105 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia prowazekii (strain Madrid E)
Q11E01 2.75e-05 49 31 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chelativorans sp. (strain BNC1)
A4JBD7 2.77e-05 49 29 5 115 3 prmA Ribosomal protein L11 methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B7UFP4 3.11e-05 49 26 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P37431 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPG0 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella schwarzengrund (strain CVM19633)
B4SYU8 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella newport (strain SL254)
B4TBE3 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella heidelberg (strain SL476)
B5FNR7 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella dublin (strain CT_02021853)
B5EYW1 3.4e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella agona (strain SL483)
Q8Z560 3.5e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhi
C6DBN5 3.54e-05 48 25 2 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B4E5V2 4.07e-05 49 28 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q1BZC1 4.1e-05 49 28 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain AU 1054)
A0K4C9 4.1e-05 49 28 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain HI2424)
Q72HI4 4.12e-05 48 33 3 103 3 menG Demethylmenaquinone methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q3K8T6 4.89e-05 48 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain Pf0-1)
A1K8Q1 5.12e-05 48 26 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azoarcus sp. (strain BH72)
Q9FR44 5.54e-05 49 28 3 107 1 NMT1 Phosphoethanolamine N-methyltransferase 1 Arabidopsis thaliana
C1DRQ3 5.56e-05 48 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A8GGX8 5.58e-05 48 26 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Serratia proteamaculans (strain 568)
A5II63 5.6e-05 48 25 5 135 3 rsmG Ribosomal RNA small subunit methyltransferase G Legionella pneumophila (strain Corby)
Q5X0Z7 5.76e-05 48 25 5 135 3 rsmG Ribosomal RNA small subunit methyltransferase G Legionella pneumophila (strain Paris)
B7LM95 5.8e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q21IR9 5.81e-05 48 23 2 125 3 ubiG Ubiquinone biosynthesis O-methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9C6B9 5.83e-05 49 29 3 106 1 NMT3 Phosphoethanolamine N-methyltransferase 3 Arabidopsis thaliana
C0Q093 5.84e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi C (strain RKS4594)
B5RCA1 5.84e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R249 5.84e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella enteritidis PT4 (strain P125109)
Q57M77 5.84e-05 48 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella choleraesuis (strain SC-B67)
B3H0C8 6.09e-05 48 32 0 64 3 ubiG Ubiquinone biosynthesis O-methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q2SE61 6.19e-05 48 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Hahella chejuensis (strain KCTC 2396)
Q5WSS3 6.26e-05 47 25 5 135 3 rsmG Ribosomal RNA small subunit methyltransferase G Legionella pneumophila (strain Lens)
E1X791 6.66e-05 48 31 4 131 2 tehB Probable S-adenosyl-L-methionine-dependent methyltransferase TehB Haemophilus influenzae (strain 10810)
Q4K8M4 6.8e-05 48 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1IDA6 6.99e-05 48 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas entomophila (strain L48)
A1TP97 7.39e-05 48 42 2 66 3 tam Trans-aconitate 2-methyltransferase Paracidovorax citrulli (strain AAC00-1)
B0UAV0 7.97e-05 48 37 0 56 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylobacterium sp. (strain 4-46)
B7NN47 7.98e-05 47 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q13EZ9 7.99e-05 48 25 5 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain BisB5)
C3SBW0 8.92e-05 48 27 3 113 1 PavNMT Pavine N-methyltransferase Thalictrum flavum subsp. glaucum
Q8YLP4 9.3e-05 47 34 5 111 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P45134 0.000117 47 31 4 131 1 tehB Probable S-adenosyl-L-methionine-dependent methyltransferase TehB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0KU76 0.000118 48 37 2 80 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sp. (strain ANA-3)
Q87ND5 0.00012 47 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8FSS4 0.00013 48 31 2 80 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sediminis (strain HAW-EB3)
C3LLV3 0.000138 47 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KSJ9 0.000138 47 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F1U0 0.000138 47 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B1JVC0 0.000161 47 27 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain MC0-3)
Q7N2M5 0.00017 47 24 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6G0I1 0.000172 47 29 3 103 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bartonella quintana (strain Toulouse)
B3QCF3 0.000176 47 26 2 103 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q6NC69 0.000176 47 26 2 103 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0I3Y4 0.000177 47 26 4 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Histophilus somni (strain 129Pt)
Q944H0 0.000177 47 28 4 118 1 NMT2 Phosphoethanolamine N-methyltransferase 2 Arabidopsis thaliana
Q92H07 0.000178 47 28 1 83 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B7VGS0 0.000179 47 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio atlanticus (strain LGP32)
Q21BZ6 0.000189 47 26 2 103 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain BisB18)
B2I023 0.000198 46 26 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain ACICU)
B0V5X4 0.0002 46 26 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AYE)
B7IBN2 0.0002 46 26 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB0057)
B7H2Y9 0.0002 46 26 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB307-0294)
P20187 0.000205 47 33 5 121 3 None Uncharacterized 37.1 kDa protein in transposon TN4556 Streptomyces fradiae
Q5P7U3 0.000206 46 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B0VMN8 0.000215 46 26 2 102 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain SDF)
A3MZ07 0.000216 46 32 0 64 3 ubiG Ubiquinone biosynthesis O-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4UME7 0.00024 46 28 1 85 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q02PX7 0.000271 46 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5ZRJ1 0.000274 45 25 5 135 3 rsmG Ribosomal RNA small subunit methyltransferase G Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B5BCS0 0.000283 46 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PCY1 0.000283 46 25 4 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q89XU2 0.000285 46 31 0 69 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q0HXI0 0.000286 47 36 2 80 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sp. (strain MR-7)
Q0BIF9 0.000311 46 28 5 115 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YSW5 0.000311 46 28 5 115 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain MC40-6)
Q07VB6 0.000312 46 25 2 103 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain BisA53)
Q0HL77 0.00032 47 36 2 80 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sp. (strain MR-4)
Q9HZ63 0.00032 45 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88M10 0.000326 45 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W7G3 0.000326 45 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q47GP8 0.000329 45 23 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dechloromonas aromatica (strain RCB)
Q1RJC7 0.000335 46 28 0 66 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia bellii (strain RML369-C)
A8GX11 0.000335 46 28 0 66 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia bellii (strain OSU 85-389)
B7V9J5 0.000351 45 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain LESB58)
A9AI41 0.000362 46 27 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
A7MU79 0.000376 45 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
E5KIC0 0.000377 45 29 2 95 1 cypM Cypemycin N-terminal methyltransferase Streptomyces sp.
Q7MM27 0.000386 45 22 3 149 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio vulnificus (strain YJ016)
Q8D8E0 0.000386 45 22 3 149 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio vulnificus (strain CMCP6)
Q2SZE1 0.000389 46 27 4 111 3 prmA Ribosomal protein L11 methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1J5G4 0.000395 45 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain W619)
Q55214 0.000424 45 34 5 105 1 dauC Aklanonic acid methyltransferase DauC Streptomyces sp. (strain C5)
Q2L2T5 0.000481 45 25 3 112 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella avium (strain 197N)
Q2W6W0 0.000482 45 28 2 107 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q12PZ8 0.000511 46 35 3 85 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8EBQ3 0.000539 46 36 2 80 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0AA73 0.000554 45 24 5 185 3 ubiG Ubiquinone biosynthesis O-methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2NSL7 0.000583 45 25 1 101 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sodalis glossinidius (strain morsitans)
A6V2Q4 0.000665 45 25 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain PA7)
Q7VZG7 0.000667 45 25 2 108 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A8HVC4 0.000691 45 39 1 61 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B0KTX4 0.000735 45 25 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain GB-1)
C3MHQ9 0.000795 45 27 3 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B1JS96 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CZ4 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNI8 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis (strain Pestoides F)
Q1CFZ1 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R284 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGR6 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis
B2K9A4 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C9H5 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FKF4 0.000799 45 24 1 98 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B0UUV6 0.000874 44 28 1 83 3 ubiG Ubiquinone biosynthesis O-methyltransferase Histophilus somni (strain 2336)
Q21UL3 0.001 44 27 4 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7WGT9 0.001 44 25 2 108 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B8F4B1 0.001 44 35 0 59 3 ubiG Ubiquinone biosynthesis O-methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_00160
Feature type CDS
Gene gcd14
Product tRNA A58 N-methylase Trm61
Location 27294 - 28931 (strand: -1)
Length 1638 (nucleotides) / 545 (amino acids)
In genomic island -

Contig

Accession ZDB_679
Length 398279 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3508
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF13649 Methyltransferase domain
PF13847 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2230 Lipid transport and metabolism (I) I Cyclopropane fatty-acyl-phospholipid synthase and related methyltransferases

Protein Sequence

MDINTLIYASRYVRLSADESKIPWDEPAFSQRMLANHLSQDHDWASRRQEIIEQQVEWIASQLSPGAHILDLGCGPGFYTHRLAERGFRCTGVDFSPVSVSWARQQAQNANLNIDYIQQDIRAYWPDRSFDFIMMTFGELNVFSTADARLLVSRCALWLELGGRLLTEVHTFEEVKRQGMAEASWQRCPDGLFLGVPHLLLTEHSWDEEEQTSSTQFWAIEANGHTTRFGSQMTAWRDEEYVSLLNNTGFTLLPPPAGHDWPVSETFEGKLFALLAEKAKTSGELPLNTQHNKRNSALDIPRIFTISESKHRIHNPFTEEKYTTLGRVLRMKPETRILDLGSGSGEMLCTWARDHAITGVGIDMSQLFSKQARRRSEELGVSDRVQFIHSDAAGYVAEEKFDVAACVGATWIAGGFTGMMELLAQSLKPGGIMLIGEPYWRQLPSTEEIAQACGVSAIADLLMLPELISAFDYLGYDVVEMVLADQEGWDRYEAAKWLTMRHWLEANPNDDFAAEVRAELTVSPKRHVTYAREYFGWGVFALIAR

Flanking regions ( +/- flanking 50bp)

CCGGGCTGAATAACGTTCGCGCACAGCTTGATAACCGCTAAGGAGGCATGATGGATATTAATACCCTTATTTACGCATCCCGATATGTCCGGCTTTCAGCGGATGAAAGCAAAATTCCCTGGGATGAACCAGCATTCAGCCAGCGCATGCTGGCGAACCACTTGTCGCAGGATCACGACTGGGCCAGCCGCAGGCAGGAGATCATTGAGCAGCAGGTAGAGTGGATCGCCAGCCAGTTATCCCCTGGCGCACACATCCTCGATCTCGGCTGCGGTCCCGGCTTTTATACCCACCGCTTAGCGGAGCGCGGATTTCGCTGCACCGGCGTGGATTTCTCACCAGTATCAGTGAGCTGGGCCCGCCAGCAGGCACAAAATGCCAATTTGAACATCGACTATATTCAGCAGGATATCCGCGCATACTGGCCGGATAGGTCGTTCGATTTCATCATGATGACGTTCGGGGAACTGAATGTGTTCAGCACTGCGGATGCACGCTTACTAGTCAGCCGCTGCGCGCTGTGGCTGGAGTTGGGTGGCAGGCTGCTCACTGAAGTCCATACTTTCGAAGAAGTTAAGCGTCAGGGAATGGCTGAAGCGAGCTGGCAACGCTGTCCGGATGGGCTTTTTCTGGGCGTCCCTCATCTGCTGCTGACGGAACATAGCTGGGATGAAGAAGAGCAGACCAGCTCAACGCAGTTCTGGGCTATAGAGGCAAACGGTCACACCACTCGTTTCGGCAGCCAAATGACGGCCTGGCGCGATGAAGAATACGTCAGCCTGCTCAATAATACCGGATTTACCCTGCTTCCTCCCCCTGCAGGCCACGACTGGCCAGTCAGCGAGACATTTGAAGGGAAGCTGTTTGCTCTGTTGGCTGAAAAAGCAAAAACCTCAGGGGAGCTTCCTCTTAATACTCAACACAATAAAAGGAATTCAGCATTGGATATCCCACGTATTTTTACCATCAGTGAAAGCAAACACCGTATCCACAACCCGTTCACCGAAGAGAAGTACACCACACTGGGCCGTGTGCTACGCATGAAGCCGGAAACCCGCATTCTTGACCTCGGCAGCGGCTCGGGGGAAATGCTCTGTACCTGGGCGCGGGATCATGCGATTACCGGAGTCGGTATCGACATGAGCCAGTTGTTCAGCAAGCAGGCCAGACGGCGCTCGGAAGAACTTGGTGTCAGTGATCGGGTCCAGTTCATACATAGCGATGCCGCTGGGTATGTGGCAGAAGAGAAATTCGATGTGGCCGCCTGCGTAGGTGCGACATGGATTGCCGGTGGATTTACCGGGATGATGGAGCTGCTGGCGCAGAGCCTTAAGCCAGGCGGGATCATGCTTATCGGGGAACCCTACTGGCGTCAGCTACCCTCAACAGAAGAGATAGCGCAGGCATGCGGCGTCAGCGCAATAGCTGATCTCCTGATGTTGCCTGAACTTATCAGCGCATTCGACTACCTCGGCTACGACGTGGTGGAAATGGTGCTGGCAGACCAGGAAGGCTGGGACAGGTATGAAGCCGCGAAATGGCTGACCATGCGCCACTGGCTGGAGGCCAACCCTAACGACGACTTCGCGGCAGAAGTCAGGGCTGAGCTAACGGTCTCGCCAAAACGTCACGTGACCTACGCGCGTGAATACTTTGGCTGGGGCGTGTTCGCGCTGATCGCCAGGTAACAACAGACTCCCGGTATTTCTTTCCGGAAATACCGGGACTTCTTCTTTGC