Homologs in group_3665

Help

3 homologs were identified in 3 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
NLDBIP_19605 NLDBIP_19605 100.0 Morganella morganii S4 - phosphoribosylanthranilate isomerase
LHKJJB_19570 LHKJJB_19570 100.0 Morganella morganii S3 - phosphoribosylanthranilate isomerase
HKOGLL_19485 HKOGLL_19485 100.0 Morganella morganii S5 - phosphoribosylanthranilate isomerase

Distribution of the homologs in the orthogroup group_3665

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3665

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2W020 4.27e-73 223 54 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9S3U4 7.3e-67 207 50 3 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Zymomonas mobilis subsp. pomaceae (strain ATCC 29192 / DSM 22645 / JCM 10191 / CCUG 17912 / NBRC 13757 / NCIMB 11200 / NRRL B-4491 / Barker I)
Q5NPZ5 1.85e-66 206 49 3 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A7HPD4 5.16e-64 200 48 1 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q13EQ3 9.65e-63 197 52 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain BisB5)
B6IVY6 9.15e-62 194 53 1 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q07UH2 3.79e-61 193 52 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain BisA53)
Q2RNS6 4.32e-61 192 49 2 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A6UEI0 2.39e-59 188 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Sinorhizobium medicae (strain WSM419)
C3MB98 3.15e-59 188 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2J2G3 4.46e-59 187 52 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain HaA2)
A1B8L1 5.17e-59 187 52 1 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Paracoccus denitrificans (strain Pd 1222)
Q9X4E3 4.58e-58 185 51 1 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1MND7 7.42e-58 184 46 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A3PPV2 1.18e-57 184 50 1 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B5ZV69 1.89e-57 184 45 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A4YJI7 1.95e-57 183 48 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bradyrhizobium sp. (strain ORS 278)
B2IKV4 7.05e-57 182 50 2 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B3PVV1 2.72e-56 181 45 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium etli (strain CIAT 652)
Q8UJB1 4.36e-56 180 45 1 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2KE83 5.33e-56 180 44 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B9JG42 5.39e-56 180 45 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A5E8A5 3.64e-55 177 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q2N9N2 7.14e-55 177 46 1 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Erythrobacter litoralis (strain HTCC2594)
Q92TD0 9.55e-55 176 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhizobium meliloti (strain 1021)
Q28LA8 1.9e-54 176 49 2 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Jannaschia sp. (strain CCS1)
Q89WE6 2.97e-54 176 46 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q21CB8 9.4e-54 174 52 1 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain BisB18)
P12289 2.05e-52 171 46 2 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3SWL7 7.67e-52 169 45 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q98CN8 7.72e-52 169 48 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1QS32 8.84e-52 169 45 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B9JXV5 1.48e-51 169 42 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q6NDN7 1.79e-51 168 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q11KK8 4.03e-51 167 45 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chelativorans sp. (strain BNC1)
B3Q604 5.72e-51 167 47 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rhodopseudomonas palustris (strain TIE-1)
P67004 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella suis biovar 1 (strain 1330)
B0CJK9 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella suis (strain ATCC 23445 / NCTC 10510)
P67003 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RFZ5 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M9U3 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57AE9 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella abortus biovar 1 (strain 9-941)
Q2YQW4 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella abortus (strain 2308)
B2S9A6 6.22e-51 167 47 1 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brucella abortus (strain S19)
Q1GK79 5.43e-49 162 49 2 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Ruegeria sp. (strain TM1040)
Q0BQI7 5.84e-49 161 46 3 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A8HQ40 2.48e-48 160 51 1 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B6JCP1 5.22e-44 150 47 3 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B0T692 1.34e-43 148 46 2 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Caulobacter sp. (strain K31)
Q0ATJ7 9.36e-43 145 46 2 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Maricaulis maris (strain MCS10)
Q0BWJ4 6.56e-42 144 44 5 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Hyphomonas neptunium (strain ATCC 15444)
B0JNJ4 9.04e-42 143 38 2 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9JVD1 6.02e-40 138 45 6 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F9X5 4.95e-39 136 43 6 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RJU3 5.94e-39 136 43 6 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria gonorrhoeae (strain NCCP11945)
A6L9J9 7.15e-39 136 37 7 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A5FZ94 2.25e-38 134 45 4 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Acidiphilium cryptum (strain JF-5)
A0LA38 2.97e-38 134 45 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P16923 1.22e-37 132 39 3 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Acinetobacter calcoaceticus
B7JUH3 3.5e-37 132 36 2 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8DGP3 9.03e-37 131 39 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9K0C6 2.55e-36 129 43 4 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8XXX9 4.16e-36 129 40 4 217 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3SHL8 4.84e-36 128 42 4 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thiobacillus denitrificans (strain ATCC 25259)
B0CA72 6.83e-36 128 36 3 214 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Acaryochloris marina (strain MBIC 11017)
Q82WI3 6.98e-36 128 36 3 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8YLL0 7.05e-36 128 36 2 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C0ZCE4 7.63e-36 128 38 5 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q3MA33 8.71e-36 128 36 2 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B7KC08 1.2e-35 128 35 2 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Gloeothece citriformis (strain PCC 7424)
A1KSV1 3.27e-35 126 43 4 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B1LA13 5.58e-35 125 38 4 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermotoga sp. (strain RQ2)
A5IKT2 5.58e-35 125 38 4 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B2J1L6 8.16e-35 125 35 2 203 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q56320 1.28e-34 125 39 4 204 1 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A9M342 1.48e-34 124 42 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Neisseria meningitidis serogroup C (strain 053442)
C3JZS5 2.47e-34 124 43 4 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas fluorescens (strain SBW25)
C1DQD4 2.64e-34 124 44 8 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1U0X4 3.12e-34 124 39 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A4VKF4 5.17e-34 123 42 8 214 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Stutzerimonas stutzeri (strain A1501)
Q2SJD2 1.56e-33 122 42 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Hahella chejuensis (strain KCTC 2396)
Q0AGX6 1.62e-33 122 38 6 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1ICS3 1.89e-33 122 41 3 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas entomophila (strain L48)
Q1CZH4 5.39e-33 120 39 4 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Myxococcus xanthus (strain DK1622)
Q3KF16 6.23e-33 120 42 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas fluorescens (strain Pf0-1)
B3PFN8 6.28e-33 120 43 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Cellvibrio japonicus (strain Ueda107)
B1GZC1 1.32e-32 119 39 6 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Endomicrobium trichonymphae
B7VBQ7 1.34e-32 120 43 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas aeruginosa (strain LESB58)
A6V2W1 1.59e-32 119 43 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas aeruginosa (strain PA7)
B3E754 1.81e-32 119 38 5 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q10XS2 1.93e-32 120 32 3 217 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Trichodesmium erythraeum (strain IMS101)
A5GES5 2.98e-32 119 40 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geotalea uraniireducens (strain Rf4)
Q02PS6 3.33e-32 119 43 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q59649 3.7e-32 119 43 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7J4T0 4.06e-32 118 43 4 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q87YI1 5.22e-32 118 42 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B2U6Z0 5.26e-32 119 39 4 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Ralstonia pickettii (strain 12J)
A1WY07 5.41e-32 118 37 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Halorhodospira halophila (strain DSM 244 / SL1)
Q74AH7 7.99e-32 117 39 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P74435 1.08e-31 117 35 4 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8R9M8 1.43e-31 117 35 5 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q4KEZ9 1.46e-31 117 44 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3JCB9 1.46e-31 117 36 4 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6L7N0 2.05e-31 116 33 4 203 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B1WT19 3.54e-31 116 32 2 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5W6Y0 4.7e-31 115 41 3 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1XNB2 5.22e-31 115 34 2 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
C6DYM2 6.16e-31 115 38 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geobacter sp. (strain M21)
Q48L25 7.07e-31 115 41 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5IBF6 9.18e-31 115 33 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Legionella pneumophila (strain Corby)
Q97EF4 9.4e-31 115 35 6 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6VWY4 1.04e-30 114 37 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Marinomonas sp. (strain MWYL1)
Q4ZVW1 1.26e-30 114 41 3 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas syringae pv. syringae (strain B728a)
Q5X5Q3 1.64e-30 114 33 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Legionella pneumophila (strain Paris)
Q5WX33 1.88e-30 114 33 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Legionella pneumophila (strain Lens)
Q5ZVY5 1.94e-30 114 33 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A3DDS6 1.98e-30 114 35 8 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B5EBV0 2.4e-30 114 38 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q88LE0 2.85e-30 114 41 3 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2JPT2 4.77e-30 114 35 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Synechococcus sp. (strain JA-2-3B'a(2-13))
B9IU37 5.78e-30 112 39 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain Q1)
B9K6Z3 6.68e-30 112 36 4 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q2Y7R3 8.92e-30 112 37 4 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q63EC8 9.17e-30 112 38 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain ZK / E33L)
B7JES9 9.88e-30 112 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain AH820)
Q31R79 1e-29 112 36 5 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2JW90 1.06e-29 112 37 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Synechococcus sp. (strain JA-3-3Ab)
A1ANJ2 1.1e-29 112 39 4 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B7I0F1 1.19e-29 112 39 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain AH187)
Q39SQ9 1.6e-29 111 37 3 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B0KF94 2.06e-29 111 40 4 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas putida (strain GB-1)
B1J538 2.08e-29 111 41 3 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pseudomonas putida (strain W619)
Q5N322 2.1e-29 112 36 5 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B7IM75 2.51e-29 111 38 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain G9842)
C1ELE9 2.76e-29 111 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain 03BB102)
A0RB63 2.76e-29 111 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus thuringiensis (strain Al Hakam)
B8FA39 3.33e-29 111 35 2 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulfatibacillum aliphaticivorans
B0K2U0 3.75e-29 110 33 7 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermoanaerobacter sp. (strain X514)
Q7NML1 4.13e-29 111 38 3 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q73BQ8 6.09e-29 110 38 9 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HLU5 6.16e-29 110 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81TL9 6.16e-29 110 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus anthracis
C3LAV9 6.16e-29 110 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P3T9 6.16e-29 110 37 6 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus anthracis (strain A0248)
Q0W628 1.42e-28 109 35 4 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B1I3Z6 1.7e-28 109 38 6 203 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulforudis audaxviator (strain MP104C)
B0K8T5 2.74e-28 108 33 7 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q2LUD8 4.62e-28 108 37 6 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Syntrophus aciditrophicus (strain SB)
Q1QY43 5.63e-28 108 41 5 203 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q81GG6 6.56e-28 107 37 7 203 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q47HQ6 9.02e-28 107 39 5 214 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Dechloromonas aromatica (strain RCB)
B1XY47 3.07e-27 106 41 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A9VJW1 5.76e-27 105 37 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus mycoides (strain KBAB4)
B7HH00 7.6e-27 104 37 10 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus cereus (strain B4264)
A2SHS5 9.34e-27 104 39 6 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P57855 1.68e-26 108 33 5 199 3 trpC Tryptophan biosynthesis protein TrpCF Pasteurella multocida (strain Pm70)
Q5HWC0 2.39e-26 103 34 8 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Campylobacter jejuni (strain RM1221)
Q9PIF3 2.39e-26 103 34 8 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1AU93 7.55e-26 102 37 3 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B9M5M0 1.05e-25 102 37 5 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8FKD6 1.12e-25 101 33 8 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q67PJ5 1.33e-25 102 38 6 225 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A4G4G1 1.74e-25 102 35 5 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Herminiimonas arsenicoxydans
A8AW04 2.63e-25 100 36 6 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8ESU3 2.78e-25 100 34 5 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8DVF4 4.5e-25 100 33 5 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O25867 5.59e-25 104 33 7 207 3 trpC Tryptophan biosynthesis protein TrpCF Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU8 6.37e-25 104 34 7 207 3 trpC Tryptophan biosynthesis protein TrpCF Helicobacter pylori (strain J99 / ATCC 700824)
C1CT52 9.95e-25 99 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain Taiwan19F-14)
B1I7S8 1.3e-24 99 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain Hungary19A-6)
P22098 1.5e-24 103 35 6 207 3 trpC Tryptophan biosynthesis protein TrpCF Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DNM7 1.51e-24 99 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04IY8 1.51e-24 99 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7WKG8 1.61e-24 99 36 5 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
C1CMD4 1.71e-24 98 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain P1031)
B5E7M4 1.71e-24 98 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae serotype 19F (strain G54)
C1CG43 1.75e-24 98 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain JJA)
Q97P31 1.75e-24 98 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1C967 1.75e-24 98 35 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain 70585)
Q7W923 1.79e-24 99 35 4 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B3EKM6 2.54e-24 98 34 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobium phaeobacteroides (strain BS1)
A5N7N9 3.92e-24 97 33 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E150 3.92e-24 97 33 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Clostridium kluyveri (strain NBRC 12016)
B8ZN60 4.5e-24 97 34 5 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q3B533 4.69e-24 97 36 5 217 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q0VPI8 5.33e-24 97 35 4 214 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8TXZ9 6.1e-24 97 36 9 225 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q7VY68 6.65e-24 97 35 5 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5WGS2 6.79e-24 97 33 5 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Shouchella clausii (strain KSM-K16)
Q0B004 8.23e-24 97 34 6 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q01NI7 1.36e-23 96 38 5 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Solibacter usitatus (strain Ellin6076)
A9IRJ9 2.15e-23 96 37 3 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
P00910 2.5e-23 99 40 8 198 3 trpC Tryptophan biosynthesis protein TrpCF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A6LU95 2.97e-23 96 32 6 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P46451 7.57e-23 98 33 6 200 3 trpC Tryptophan biosynthesis protein TrpCF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B8J162 7.6e-23 94 34 3 195 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q02002 7.61e-23 97 34 6 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lactococcus lactis subsp. lactis (strain IL1403)
A1BEZ1 8.94e-23 94 36 6 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
C6C1D3 1.12e-22 94 30 5 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
P70938 1.37e-22 94 32 9 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Priestia megaterium (strain ATCC 12872 / QMB1551)
Q8Z7D9 1.66e-22 97 39 8 198 3 trpC Tryptophan biosynthesis protein TrpCF Salmonella typhi
Q2RIT8 3.42e-22 93 36 6 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9KCB1 3.56e-22 93 30 5 214 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q42527 3.78e-22 94 34 7 217 2 PAI2 N-(5'-phosphoribosyl)anthranilate isomerase 2, chloroplastic Arabidopsis thaliana
Q2KYM1 4.05e-22 92 38 8 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bordetella avium (strain 197N)
Q88WI1 4.57e-22 92 33 4 200 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q4L678 1.28e-21 91 30 8 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus haemolyticus (strain JCSC1435)
Q42440 1.46e-21 92 33 7 217 1 PAI1 N-(5'-phosphoribosyl)anthranilate isomerase 1, chloroplastic Arabidopsis thaliana
Q9PDK5 1.94e-21 91 35 9 217 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xylella fastidiosa (strain 9a5c)
B0U6K5 2.66e-21 90 35 9 217 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xylella fastidiosa (strain M12)
Q87DS0 2.92e-21 90 35 9 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9J1 2.92e-21 90 35 9 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xylella fastidiosa (strain M23)
B3QMF2 3.88e-21 90 36 5 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q9KST5 4.7e-21 93 34 6 207 3 trpCF Tryptophan biosynthesis protein TrpCF Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B4S715 1.78e-20 88 35 6 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q8PJ26 2.19e-20 88 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas axonopodis pv. citri (strain 306)
A9KL42 2.36e-20 88 30 6 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q3BRL1 2.85e-20 88 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q92B80 2.99e-20 87 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5GXR3 4.46e-20 87 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SVN9 4.46e-20 87 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0U0 4.46e-20 87 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P67007 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain MW2)
Q6G9I8 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain MSSA476)
P67006 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain N315)
P67005 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG48 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain COL)
Q2FYR5 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH65 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain USA300)
A7X235 5e-20 87 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q71Z39 5.27e-20 87 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria monocytogenes serotype 4b (strain F2365)
P50857 6.14e-20 87 32 7 209 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A0AJ81 6.85e-20 86 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0B9D8 7.07e-20 86 35 8 219 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
B4SD44 7.91e-20 86 38 9 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8ZEG8 8.31e-20 90 33 7 211 3 trpC Tryptophan biosynthesis protein TrpCF Yersinia pestis
B8DHB3 9.49e-20 86 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria monocytogenes serotype 4a (strain HCC23)
C1KVS6 1.07e-19 86 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y6Q5 1.46e-19 85 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6GH34 1.52e-19 85 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain MRSA252)
Q3IQ37 1.74e-19 85 34 6 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P00909 2.29e-19 88 36 6 195 1 trpC Tryptophan biosynthesis protein TrpCF Escherichia coli (strain K12)
A9BHQ4 2.65e-19 85 30 4 196 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q3AQC1 3.75e-19 85 36 6 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobium chlorochromatii (strain CaD3)
Q8P7R6 3.93e-19 85 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RR82 3.93e-19 85 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas campestris pv. campestris (strain B100)
Q4UWD4 3.93e-19 85 35 9 220 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Xanthomonas campestris pv. campestris (strain 8004)
Q2YXU8 6.06e-19 84 28 8 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q65I34 6.59e-19 84 31 8 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8X7B7 7.25e-19 87 36 7 198 3 trpC Tryptophan biosynthesis protein TrpCF Escherichia coli O157:H7
P17218 7.83e-19 84 33 5 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lacticaseibacillus casei
P00912 8.64e-19 84 29 6 215 1 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6Q1S6 1.02e-18 83 32 6 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Nitratiruptor sp. (strain SB155-2)
P57366 1.02e-18 87 27 6 207 3 trpC Tryptophan biosynthesis protein TrpCF Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P20409 1.21e-18 87 33 9 252 3 trp1 Multifunctional tryptophan biosynthesis protein Phycomyces blakesleeanus
A4IQ83 1.33e-18 83 29 6 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Geobacillus thermodenitrificans (strain NG80-2)
A4SF78 2.08e-18 83 34 6 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q8KEH1 2.18e-18 83 34 6 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2S1Z4 2.76e-18 82 34 5 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Salinibacter ruber (strain DSM 13855 / M31)
B9DP52 2.85e-18 82 27 7 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus carnosus (strain TM300)
B2V7Q4 3.02e-18 82 29 7 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Sulfurihydrogenibium sp. (strain YO3AOP1)
A4J148 3.66e-18 82 35 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A7Z617 3.81e-18 82 31 7 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P42393 7.21e-18 84 30 9 204 3 trpC Tryptophan biosynthesis protein TrpCF Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B3W6W7 7.67e-18 81 32 5 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lacticaseibacillus casei (strain BL23)
Q03CY2 9.56e-18 80 32 5 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
O68427 1.18e-17 84 29 8 202 3 trpC Tryptophan biosynthesis protein TrpCF Buchnera aphidicola subsp. Diuraphis noxia
Q8PT98 1.91e-17 80 29 6 233 3 trpF1 N-(5'-phosphoribosyl)anthranilate isomerase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B4SQV5 2.83e-17 80 34 9 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Stenotrophomonas maltophilia (strain R551-3)
Q8TLP6 6.57e-17 79 28 6 231 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q051T8 7.85e-17 79 30 6 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04RT3 7.85e-17 79 30 6 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q8CSN5 8.01e-17 78 28 7 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPH1 8.01e-17 78 28 7 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P24920 8.22e-17 81 32 11 258 3 TRP1 Tryptophan biosynthesis protein TRP1 Phytophthora nicotianae
B2FNZ5 1.01e-16 78 33 9 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Stenotrophomonas maltophilia (strain K279a)
P20167 1.31e-16 78 29 9 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Bacillus subtilis (strain 168)
Q44603 1.44e-16 80 30 9 204 3 trpC Tryptophan biosynthesis protein TrpCF Buchnera aphidicola subsp. Schlechtendalia chinensis
Q3ZZ13 2.78e-16 77 32 9 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Dehalococcoides mccartyi (strain CBDB1)
Q24SK5 3.06e-16 77 31 8 235 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulfitobacterium hafniense (strain Y51)
Q254S9 3.23e-16 77 31 7 191 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia felis (strain Fe/C-56)
Q3Z6G4 4.52e-16 77 32 9 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q5XQP9 1.05e-15 75 29 7 216 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Saccharomyces kudriavzevii (strain ATCC MYA-4449 / AS 2.2408 / CBS 8840 / NBRC 1802 / NCYC 2889)
B9LQ97 1.1e-15 75 35 10 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B8FVH4 1.21e-15 76 31 7 240 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q57893 1.38e-15 75 27 7 223 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5V212 3.37e-15 74 30 5 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
B3QS44 3.98e-15 74 33 11 213 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A5UYU9 4.74e-15 73 34 5 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Roseiflexus sp. (strain RS-1)
B5YKL4 6.7e-15 73 30 8 218 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q9RY28 8.5e-15 73 31 4 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q875I3 1.07e-14 73 29 9 238 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Wickerhamomyces anomalus
P52563 2.02e-14 72 40 5 137 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P59459 2.46e-14 74 27 6 207 3 trpC Tryptophan biosynthesis protein TrpCF Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B0BBV9 8.67e-14 70 28 5 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7P4 8.67e-14 70 28 5 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q822W4 2.13e-13 69 29 9 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
O84331 2.23e-13 69 28 5 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A7NS83 2.45e-13 69 35 7 204 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q3KM33 7.9e-13 67 27 5 198 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q8PRX4 1.41e-12 67 30 7 211 3 trpF2 N-(5'-phosphoribosyl)anthranilate isomerase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A6QC86 1.52e-12 67 29 5 202 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Sulfurovum sp. (strain NBC37-1)
Q8F495 2.04e-12 67 26 6 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RH2 2.04e-12 67 26 6 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9HFW8 2.17e-12 66 29 7 208 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Zygosaccharomyces bailii
Q9YGB1 2.52e-12 66 32 6 213 1 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O67853 3.06e-12 66 30 7 196 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Aquifex aeolicus (strain VF5)
Q92370 3.73e-12 68 29 9 235 2 trp1 Multifunctional tryptophan biosynthesis protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6UP16 3.75e-12 66 26 5 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q9V1G7 9.53e-12 65 28 9 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pyrococcus abyssi (strain GE5 / Orsay)
P13997 1.11e-11 64 28 7 212 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8U092 2.14e-11 63 29 7 209 1 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A6UW24 2.22e-11 63 28 3 190 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A4FXH5 1.05e-10 62 26 5 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A6VFU0 1.29e-10 62 24 3 206 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
P06560 2.28e-10 62 31 7 195 1 trpC Tryptophan biosynthesis protein TrpCF Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A7I4T5 4.39e-10 60 30 6 212 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A9AAU4 4.79e-10 60 24 3 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
O28671 7.37e-10 59 31 9 205 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O13504 8.58e-10 60 26 9 251 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Komagataella pastoris
P0CN87 1.69e-09 60 30 11 251 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CN86 2.02e-09 60 30 11 251 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q6LYI7 3.92e-09 57 26 7 216 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8ZV18 3.93e-09 57 29 8 209 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q757J9 4.82e-09 57 34 5 206 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q4J8X6 1.52e-08 55 25 8 211 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9PK67 1.59e-08 56 31 8 201 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Chlamydia muridarum (strain MoPn / Nigg)
Q979V6 3.13e-08 55 25 7 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q9HPG4 5.23e-08 54 32 4 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R621 5.23e-08 54 32 4 207 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P43073 6.17e-08 54 26 8 230 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Candida albicans (strain SC5314 / ATCC MYA-2876)
A1RVT3 7.95e-08 53 27 7 208 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
P27710 1.8e-07 54 30 11 251 3 TRP1 Multifunctional tryptophan biosynthesis protein Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
A4WKQ6 1.74e-06 50 28 7 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q8LPI9 1.88e-06 50 32 1 85 2 PAI3 N-(5'-phosphoribosyl)anthranilate isomerase 3, chloroplastic Arabidopsis thaliana
P26941 4e-06 49 28 8 215 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q01128 0.000229 44 27 9 234 3 TRP1 N-(5'-phosphoribosyl)anthranilate isomerase Lipomyces starkeyi
O27695 0.000698 43 25 11 210 3 trpF N-(5'-phosphoribosyl)anthranilate isomerase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_20140
Feature type CDS
Gene -
Product phosphoribosylanthranilate isomerase
Location 1232 - 1870 (strand: -1)
Length 639 (nucleotides) / 212 (amino acids)

Contig

Accession contig_48
Length 11780 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3665
Orthogroup size 4
N. genomes 4

Actions

Genomic region

Domains

PF00697 N-(5'phosphoribosyl)anthranilate (PRA) isomerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0135 Amino acid transport and metabolism (E) E Phosphoribosylanthranilate isomerase

Kegg Ortholog Annotation(s)

Protein Sequence

MPAKIKICGISTPEALDATIAARADYAGLVFYPASPRAVTSNVAGALTSRAAGQIAMVGLFVDADDAVIADALVAAKLNALQLHGSESPERVAQLRARFGKPVWKALPVASASDVARAAAYAGAADLILFDAKTPKGALPGGMGLAFDWSLLAGYRGALPWGLAGGLNPTNVAEAIARTGAPLVDTSSGVESAPGVKDTDKITNFAFAVRLA

Flanking regions ( +/- flanking 50bp)

CGATCCCGACTGCACGCTGGTGCGGCTGATCCAGAACCCCGACTGACCGCATGCCCGCGAAAATCAAGATTTGCGGGATCAGCACACCCGAGGCGCTCGATGCGACCATCGCGGCGCGGGCGGACTATGCCGGGTTGGTGTTCTATCCAGCGTCGCCCCGTGCGGTTACGTCGAATGTCGCGGGCGCTTTGACATCGCGCGCAGCTGGCCAGATCGCCATGGTCGGTTTGTTCGTCGATGCGGATGATGCTGTCATCGCCGACGCACTGGTGGCAGCCAAGCTGAACGCGCTGCAGCTGCACGGTTCGGAATCGCCCGAACGCGTGGCCCAGTTGCGCGCGCGGTTTGGCAAGCCGGTGTGGAAGGCGCTGCCCGTCGCCAGCGCCAGCGATGTCGCACGCGCCGCAGCCTATGCCGGGGCGGCGGACTTGATCTTGTTCGACGCCAAGACCCCCAAAGGCGCGCTGCCCGGCGGCATGGGGTTGGCGTTCGACTGGTCGCTGCTGGCCGGATATCGCGGTGCCTTGCCGTGGGGGCTGGCAGGCGGGCTAAATCCGACGAATGTTGCCGAGGCGATTGCGCGCACCGGAGCGCCGCTGGTCGATACCTCCAGCGGCGTCGAAAGCGCGCCGGGCGTCAAGGATACCGACAAGATTACCAATTTCGCCTTTGCGGTGCGCTTGGCCTAAATCGCGTCGATCAATAGGCGTCGTTCAGCGCAAAGATCGGCTTGCGGGTG