Homologs in group_2483

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_10475 EHELCC_10475 100.0 Morganella morganii S2 nikB nickel ABC transporter permease subunit NikB
NLDBIP_10820 NLDBIP_10820 100.0 Morganella morganii S4 nikB nickel ABC transporter permease subunit NikB
LHKJJB_10535 LHKJJB_10535 100.0 Morganella morganii S3 nikB nickel ABC transporter permease subunit NikB
HKOGLL_13595 HKOGLL_13595 100.0 Morganella morganii S5 nikB nickel ABC transporter permease subunit NikB
PMI_RS14565 PMI_RS14565 44.2 Proteus mirabilis HI4320 - ABC transporter permease subunit

Distribution of the homologs in the orthogroup group_2483

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2483

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33591 6.52e-153 433 67 0 307 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
Q3Z3V2 1.21e-77 242 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q32IB7 1.37e-77 242 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 1.37e-77 242 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 1.37e-77 242 40 2 308 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 1.37e-77 242 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 1.37e-77 242 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8X6V7 1.88e-77 241 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q0T6D1 4.02e-77 241 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q83S26 8.05e-77 240 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q8FJK9 1.27e-76 239 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q323W3 2.16e-76 239 40 2 308 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q8ZQM2 4.63e-73 230 39 4 309 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z862 1.1e-72 229 39 4 309 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 1.1e-72 229 39 4 309 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q2YJK1 6.59e-72 228 40 2 315 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 6.59e-72 228 40 2 315 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q5PGP5 9.19e-72 227 39 4 309 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8YDG7 9.3e-72 227 40 2 315 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P94311 1.41e-71 227 39 2 335 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8FUX0 9.64e-71 224 40 2 315 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
Q6D3B1 2.07e-70 223 40 4 309 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P45096 6.12e-70 223 35 4 334 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEF8 1.82e-69 222 37 3 338 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 1.82e-69 222 37 3 338 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 1.82e-69 222 37 3 338 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
A0A0H2ZGW7 2.84e-69 221 37 2 335 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
P42062 4.89e-67 215 38 4 319 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
Q53191 1.76e-65 211 39 3 315 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8YBN9 2.9e-61 200 35 3 320 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 2.9e-61 200 35 3 320 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q2FVE8 6.38e-60 197 33 2 312 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 1.16e-59 196 33 2 312 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8FWN8 1.52e-59 196 35 3 320 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
P24138 2.08e-57 190 37 3 310 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P45054 9.32e-56 186 36 4 310 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AFH5 1.89e-53 180 36 6 311 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 1.89e-53 180 36 6 311 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 1.89e-53 180 36 6 311 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 1.89e-53 180 36 6 311 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P77308 7.63e-53 179 36 4 329 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
P08005 7.94e-53 178 36 6 311 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26903 8.94e-53 178 33 3 314 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
Q7A5Q6 1.59e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 1.59e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG38 1.68e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 1.68e-52 178 30 1 309 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 1.68e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q8NWT4 1.7e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 1.7e-52 178 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
P0A4N8 4.2e-52 177 33 2 322 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 4.2e-52 177 33 2 322 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
A2RI75 5.31e-51 173 35 2 286 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
Q2YXY7 1.02e-50 173 30 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GH25 2.17e-50 172 29 1 309 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
P0AGH3 2.86e-50 172 34 1 270 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 2.86e-50 172 34 1 270 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
P0A2J3 1.3e-43 155 34 1 270 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 1.3e-43 155 34 1 270 3 sapB Peptide transport system permease protein SapB Salmonella typhi
A9CKL3 7.02e-35 133 27 5 360 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P66967 5.07e-34 129 30 6 329 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 5.07e-34 129 30 6 329 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 5.07e-34 129 30 6 329 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AFU0 1.47e-28 115 26 5 364 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 1.47e-28 115 26 5 364 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
P0A4M8 5.64e-24 105 28 2 208 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 5.64e-24 105 28 2 208 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P75554 4.83e-23 101 24 4 275 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47323 6.15e-22 98 25 9 326 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P45286 4.31e-21 94 22 1 276 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H3JU73 0.000208 45 25 7 183 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FVE9 0.000235 45 24 6 183 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8YDG8 0.000256 45 28 9 217 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 0.000256 45 28 9 217 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 0.000256 45 28 9 217 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)
Q8FUW9 0.000301 45 28 9 217 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08935
Feature type CDS
Gene nikB
Product nickel ABC transporter permease subunit NikB
Location 4152 - 5096 (strand: -1)
Length 945 (nucleotides) / 314 (amino acids)
In genomic island -

Contig

Accession contig_10
Length 146103 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2483
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF19300 Binding-prot-dependent transport system membrane comp, N-term

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0601 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15585 nickel transport system permease protein ABC transporters -

Protein Sequence

MMRFIFRRVLLLIPMLLGTSLFIFLILRLGPSDPALDYLRLSKIPPTPQAVESARELLGLDKPIMTQYFHWLSDALHLDFGISYATQKPVLPDLLYFLPATLQLAGLALALTIILSVPMGMLAARYREKWPDQLVRVIAFIGVSMPNFWLGFLLILLFSIHLGWLPPMGKGEAKHLIMPVIAISLMSLAINARLLRASMLEVAGQRHVRYARLRGLSEMTVERSHILRNAWLPVITAIGMHIGELLGGALIIESIFSWPGVGRYAVSAIMNRDYPVIQCFTLLMVVIFVLCNLIVDIIYAIADPRIRLSAEGIE

Flanking regions ( +/- flanking 50bp)

GATCCCGTTTGATCAGCTGACGCCAACTGCGAAGTAACAGGTCCGCGATTATGATGCGATTTATTTTCCGGCGGGTGCTGCTGCTGATCCCGATGCTGCTCGGCACCTCGCTGTTTATCTTTCTGATCCTGCGCCTGGGGCCGTCTGACCCCGCGCTGGATTATCTGCGGCTCTCCAAAATTCCGCCGACCCCGCAGGCGGTGGAAAGCGCCCGTGAGCTTCTCGGTCTCGATAAGCCGATCATGACCCAGTATTTTCACTGGCTGTCTGACGCGCTGCATCTGGATTTTGGTATCTCTTATGCCACACAGAAACCGGTGCTGCCGGATCTGCTCTATTTCCTGCCCGCCACACTGCAACTGGCGGGGCTGGCACTGGCGCTGACTATTATTCTGTCTGTGCCGATGGGGATGCTGGCGGCGCGTTACCGCGAAAAATGGCCGGATCAGCTGGTGCGGGTGATTGCGTTTATCGGGGTTTCCATGCCGAATTTCTGGCTGGGGTTCCTGCTGATCCTGCTCTTTTCGATTCACCTCGGCTGGCTGCCGCCGATGGGTAAAGGGGAAGCAAAACACCTGATCATGCCGGTCATTGCTATCTCGCTGATGTCACTGGCGATTAATGCCCGGTTGCTGCGGGCAAGCATGCTCGAGGTGGCCGGGCAGCGCCATGTCCGTTATGCGCGGCTGCGCGGGTTATCTGAAATGACGGTGGAGCGCTCACATATTCTGCGCAACGCCTGGCTGCCGGTGATCACGGCTATCGGTATGCATATCGGGGAACTGCTCGGCGGCGCGCTGATTATCGAGAGTATTTTCAGCTGGCCGGGTGTGGGGCGCTATGCGGTCTCTGCCATTATGAACCGGGATTATCCGGTGATTCAGTGCTTTACCCTGCTGATGGTGGTGATTTTTGTCCTCTGTAACCTGATTGTGGATATTATTTATGCGATTGCGGATCCCCGCATCCGCCTCTCTGCGGAGGGTATCGAATGAGCGATATGATACTGAAAGCCCCTTCCGCCTGGCGGACACTCAGCCGCAAT