Homologs in group_1410

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_12815 EHELCC_12815 100.0 Morganella morganii S2 srmB DEAD/DEAH family ATP-dependent RNA helicase
NLDBIP_13155 NLDBIP_13155 100.0 Morganella morganii S4 srmB DEAD/DEAH family ATP-dependent RNA helicase
LHKJJB_13400 LHKJJB_13400 100.0 Morganella morganii S3 srmB DEAD/DEAH family ATP-dependent RNA helicase
HKOGLL_11630 HKOGLL_11630 100.0 Morganella morganii S5 srmB DEAD/DEAH family ATP-dependent RNA helicase
F4V73_RS09925 F4V73_RS09925 90.2 Morganella psychrotolerans - DEAD/DEAH family ATP-dependent RNA helicase
PMI_RS17055 PMI_RS17055 82.9 Proteus mirabilis HI4320 - DEAD/DEAH family ATP-dependent RNA helicase

Distribution of the homologs in the orthogroup group_1410

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1410

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33906 0.0 951 84 3 570 3 deaD ATP-dependent RNA helicase DeaD Klebsiella pneumoniae
P0A9P8 0.0 926 84 2 567 3 deaD ATP-dependent RNA helicase DeaD Shigella flexneri
P0A9P6 0.0 926 84 2 567 1 deaD ATP-dependent RNA helicase DeaD Escherichia coli (strain K12)
P0A9P7 0.0 926 84 2 567 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA87 0.0 925 79 4 636 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O157:H7
P57453 0.0 827 67 5 618 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9H6 0.0 796 70 3 569 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AF9 0.0 769 66 5 566 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P44586 0.0 760 62 8 626 3 deaD ATP-dependent RNA helicase DeaD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WH05 9.38e-161 476 47 4 548 1 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH04 9.38e-161 476 47 4 548 3 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6HPE6 2.25e-130 396 45 3 432 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VG0 2.25e-130 396 45 3 432 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus anthracis
A0R8U6 2.25e-130 396 45 3 432 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis (strain Al Hakam)
Q63GX5 2.74e-130 396 45 3 432 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ZK / E33L)
Q81IT9 3.1e-130 396 45 3 432 2 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73EU1 4.14e-130 395 45 3 432 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q65N62 9.33e-125 380 42 5 490 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P96614 1.87e-124 380 42 3 464 1 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus subtilis (strain 168)
Q5L3G9 8.19e-122 372 45 3 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Geobacillus kaustophilus (strain HTA426)
Q8Y8N0 3.25e-118 365 45 5 435 2 cshA ATP-dependent RNA helicase CshA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q55804 7.66e-117 360 45 5 423 1 crhR RNA helicase CrhR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q4L7W0 2.02e-112 349 40 8 496 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus haemolyticus (strain JCSC1435)
Q9Z6C9 1.5e-111 347 46 3 375 3 cshA ATP-dependent RNA helicase CshA Limosilactobacillus reuteri
Q49Z29 8.95e-111 345 42 5 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HME0 9.29e-108 337 47 3 356 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0D2 3.04e-107 336 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MW2)
Q6G7M9 3.04e-107 336 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MSSA476)
Q7A4G0 3.04e-107 336 41 6 437 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain N315)
Q99SH6 3.04e-107 336 41 6 437 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEB9 3.04e-107 336 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain COL)
Q2FWH5 3.04e-107 336 41 6 437 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF45 3.04e-107 336 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain USA300)
Q2YUH3 3.2e-107 336 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CRP6 3.74e-107 336 46 3 356 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GEZ3 4.01e-107 335 41 6 437 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MRSA252)
P42305 2.94e-103 325 44 3 383 1 dbpA ATP-dependent RNA helicase DbpA Bacillus subtilis (strain 168)
Q81DF9 5.51e-103 323 44 0 358 2 cshE DEAD-box ATP-dependent RNA helicase CshE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O25029 3.19e-102 322 36 6 478 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain ATCC 700392 / 26695)
B9XXL6 1.67e-101 320 36 6 478 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain B128)
P0A4D8 3.89e-99 315 39 8 512 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4D7 3.89e-99 315 39 8 512 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q814I2 1.03e-98 313 41 2 388 2 dbpA ATP-dependent RNA helicase DbpA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q58083 3.08e-95 300 41 6 369 1 MJ0669 Probable ATP-dependent RNA helicase MJ0669 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P25888 2.46e-94 301 42 3 378 1 rhlE ATP-dependent RNA helicase RhlE Escherichia coli (strain K12)
Q8Y7M8 1.55e-92 296 42 4 359 2 dbpA ATP-dependent RNA helicase DbpA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P21693 1.72e-87 283 41 2 384 1 dbpA ATP-dependent RNA helicase DbpA Escherichia coli (strain K12)
Q6CH58 1.67e-84 276 39 3 389 3 RRP3 ATP-dependent rRNA helicase RRP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q55D61 2.3e-83 270 36 3 382 3 tifA Eukaryotic initiation factor 4A Dictyostelium discoideum
P38919 1.56e-82 268 38 3 380 1 EIF4A3 Eukaryotic initiation factor 4A-III Homo sapiens
Q3B8Q2 1.74e-82 268 38 3 380 1 Eif4a3 Eukaryotic initiation factor 4A-III Rattus norvegicus
A6M931 1.74e-82 268 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Sus scrofa
Q2NL22 1.74e-82 268 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Bos taurus
Q91VC3 2.15e-82 268 38 3 380 1 Eif4a3 Eukaryotic initiation factor 4A-III Mus musculus
B5FZY7 2.34e-82 268 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Taeniopygia guttata
Q5ZM36 2.46e-82 268 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Gallus gallus
Q6C347 2.86e-82 267 38 3 375 3 FAL1 ATP-dependent RNA helicase FAL1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q5B5E7 3.09e-82 270 38 6 404 3 rrp3 ATP-dependent rRNA helicase rrp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9LUW5 3.89e-82 273 40 5 371 1 RH53 DEAD-box ATP-dependent RNA helicase 53, mitochondrial Arabidopsis thaliana
Q9LUW6 5.41e-82 273 41 5 366 1 RH9 DEAD-box ATP-dependent RNA helicase 9, mitochondrial Arabidopsis thaliana
A3LS22 6.04e-82 269 38 4 375 3 RRP3 ATP-dependent rRNA helicase RRP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q4R3Q1 6.67e-82 267 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Macaca fascicularis
P44701 7.43e-82 268 41 4 361 3 srmB ATP-dependent RNA helicase SrmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7ZVA6 2.65e-81 265 38 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Danio rerio
B7ZTW1 2.97e-81 265 38 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Xenopus tropicalis
P34580 4.97e-81 267 37 5 410 3 T26G10.1 Putative ATP-dependent RNA helicase T26G10.1 Caenorhabditis elegans
O42226 6.12e-81 265 38 3 380 2 eif4a3-b Eukaryotic initiation factor 4A-III-B Xenopus laevis
B5DG42 9.55e-81 264 38 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Salmo salar
Q0DM51 1.16e-80 273 38 7 413 2 Os03g0827700 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Oryza sativa subsp. japonica
A7EML8 1.75e-80 265 39 8 418 3 rrp3 ATP-dependent rRNA helicase rrp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A0A1D6LAB7 2.41e-80 272 36 6 436 2 RH3B DEAD-box ATP-dependent RNA helicase 3B, chloroplastic Zea mays
B1KQF6 2.47e-80 264 38 5 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella woodyi (strain ATCC 51908 / MS32)
O02494 2.91e-80 262 39 4 374 2 EIF4-A Eukaryotic initiation factor 4A Cryptosporidium parvum
Q5U526 4.23e-80 262 38 3 380 2 eif4a3-a Eukaryotic initiation factor 4A-III-A Xenopus laevis
Q9CWX9 6.6e-80 263 38 5 385 2 Ddx47 Probable ATP-dependent RNA helicase DDX47 Mus musculus
A0A1D6GDY8 6.63e-80 271 36 6 438 3 RH3A DEAD-box ATP-dependent RNA helicase 3A, chloroplastic Zea mays
A8G0U0 7.34e-80 262 38 5 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sediminis (strain HAW-EB3)
P27639 1.07e-79 261 38 2 374 2 inf-1 Eukaryotic initiation factor 4A Caenorhabditis elegans
Q9VHS8 1.12e-79 261 37 3 380 1 CG7483 Eukaryotic initiation factor 4A-III Drosophila melanogaster
A5DQF1 1.42e-79 263 37 2 365 3 RRP3 ATP-dependent rRNA helicase RRP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q29S22 1.49e-79 262 38 5 385 2 DDX47 Probable ATP-dependent RNA helicase DDX47 Bos taurus
P0CR00 1.7e-79 263 39 2 356 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CR01 1.7e-79 263 39 2 356 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q6FNK8 1.85e-79 263 39 3 366 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q0UK12 2.14e-79 265 40 5 369 3 RRP3 ATP-dependent rRNA helicase RRP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q9P6N8 3.05e-79 261 39 2 368 3 rrp3 ATP-dependent rRNA helicase rrp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6RW56 3.21e-79 262 39 9 420 3 rrp3 ATP-dependent rRNA helicase rrp3 Botryotinia fuckeliana (strain B05.10)
Q6BQ61 3.68e-79 262 38 2 365 3 RRP3 ATP-dependent rRNA helicase RRP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q7Y183 5.51e-79 261 38 5 381 2 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. japonica
A2XKG2 5.51e-79 261 38 5 381 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. indica
Q10I26 5.77e-79 259 38 2 374 1 EIF4A3B Eukaryotic initiation factor 4A-III homolog B Oryza sativa subsp. japonica
Q9H0S4 7.16e-79 260 38 5 385 1 DDX47 Probable ATP-dependent RNA helicase DDX47 Homo sapiens
Q5VNM3 7.21e-79 259 38 3 377 1 EIF4A3A Eukaryotic initiation factor 4A-III homolog A Oryza sativa subsp. japonica
Q6CX73 7.32e-79 258 37 4 371 3 FAL1 ATP-dependent RNA helicase FAL1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P41380 8.64e-79 258 37 2 374 2 None Eukaryotic initiation factor 4A-3 Nicotiana plumbaginifolia
Q0ILZ4 1.3e-78 265 39 6 376 2 Os12g0611200 DEAD-box ATP-dependent RNA helicase 9 Oryza sativa subsp. japonica
Q4P184 1.64e-78 258 36 2 374 3 FAL1 ATP-dependent RNA helicase FAL1 Ustilago maydis (strain 521 / FGSC 9021)
Q8SR63 1.93e-78 257 35 2 369 3 RRP3 ATP-dependent rRNA helicase RRP3 Encephalitozoon cuniculi (strain GB-M1)
Q755N4 2.77e-78 262 40 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
B8CHZ1 3.78e-78 258 36 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella piezotolerans (strain WP3 / JCM 13877)
Q54VT4 3.79e-78 261 39 4 364 3 ddx47 Probable ATP-dependent RNA helicase ddx47 Dictyostelium discoideum
A1RFB3 3.83e-78 258 38 5 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain W3-18-1)
A4YB09 3.83e-78 258 38 5 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q59LU0 3.85e-78 261 39 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8EJQ5 4.21e-78 258 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1SZG4 4.35e-78 257 37 5 389 3 rhlB ATP-dependent RNA helicase RhlB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4P3U9 5.09e-78 261 38 2 367 3 RRP3 ATP-dependent rRNA helicase RRP3 Ustilago maydis (strain 521 / FGSC 9021)
A3Q9R3 5.99e-78 257 38 4 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A3D9I5 6.12e-78 257 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E670 6.12e-78 257 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS223)
Q5ACU6 6.3e-78 260 36 2 374 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0CQ72 6.5e-78 256 37 2 373 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ73 6.5e-78 256 37 2 373 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A9L5D5 6.66e-78 257 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS195)
A6WTD3 6.66e-78 257 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS185)
P38712 6.9e-78 259 38 3 366 1 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A8GZJ0 7.15e-78 257 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q4WJE9 8.7e-78 258 38 5 402 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6FLF3 1.07e-77 260 40 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q75EW9 1.17e-77 258 37 3 378 3 RRP3 ATP-dependent rRNA helicase RRP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A6ZSX1 1.23e-77 258 38 3 366 3 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain YJM789)
A0KS84 1.34e-77 256 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain ANA-3)
Q0HQL1 1.43e-77 256 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-7)
Q0HN76 1.43e-77 256 37 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-4)
A5E1W4 2.07e-77 259 38 8 397 3 DBP3 ATP-dependent RNA helicase DBP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
B0TJ29 2.12e-77 256 37 3 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella halifaxensis (strain HAW-EB4)
Q12S35 2.65e-77 255 36 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1SAL1 3.09e-77 255 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q10055 3.19e-77 254 36 3 375 1 tif412 ATP-dependent RNA helicase fal1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q94A52 3.23e-77 254 36 2 374 1 EIF4A3 Eukaryotic initiation factor 4A-III homolog Arabidopsis thaliana
Q0D8N0 3.9e-77 260 39 8 387 2 Os07g0143700 DEAD-box ATP-dependent RNA helicase 53 Oryza sativa subsp. japonica
C4LB49 4.15e-77 254 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9BUQ8 4.3e-77 265 39 5 379 1 DDX23 Probable ATP-dependent RNA helicase DDX23 Homo sapiens
Q6CXT4 4.5e-77 254 39 2 366 3 TIF1 ATP-dependent RNA helicase eIF4A Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2HFP1 5.25e-77 253 38 2 378 3 TIF1 ATP-dependent RNA helicase eIF4A Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q10202 6.2e-77 259 40 10 396 3 dbp3 ATP-dependent RNA helicase dbp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7RV88 8.82e-77 253 39 2 378 3 tif-1 ATP-dependent RNA helicase eIF4A Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q88NB7 8.89e-77 253 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A7TS37 1.01e-76 256 38 4 367 3 RRP3 ATP-dependent rRNA helicase RRP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q8W4R3 1.16e-76 258 40 4 365 1 RH30 DEAD-box ATP-dependent RNA helicase 30 Arabidopsis thaliana
Q088J2 1.34e-76 254 37 5 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella frigidimarina (strain NCIMB 400)
A1D405 1.36e-76 255 37 5 402 3 rrp3 ATP-dependent rRNA helicase rrp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q6BY27 1.43e-76 256 39 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A1D7N3 1.47e-76 252 39 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
O22907 1.61e-76 262 43 6 358 1 RH24 DEAD-box ATP-dependent RNA helicase 24 Arabidopsis thaliana
Q6C4D4 1.85e-76 257 39 6 363 3 DBP2 ATP-dependent RNA helicase DBP2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8GY84 1.98e-76 254 36 6 400 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Arabidopsis thaliana
Q9VIF6 2.34e-76 255 36 4 405 1 pths ATP-dependent RNA helicase DDX47 Drosophila melanogaster
Q6CT85 2.38e-76 254 37 3 363 3 RRP3 ATP-dependent rRNA helicase RRP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A6QRQ7 3.95e-76 254 38 5 402 3 RRP3 ATP-dependent rRNA helicase RRP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q5RC67 3.99e-76 262 39 5 379 2 DDX23 Probable ATP-dependent RNA helicase DDX23 Pongo abelii
A7TEF4 4.36e-76 251 36 5 375 3 FAL1 ATP-dependent RNA helicase FAL1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q0UU86 4.59e-76 251 39 2 378 3 TIF1 ATP-dependent RNA helicase eIF4A Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0CXD0 4.69e-76 251 39 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A7EGL7 5.13e-76 251 39 2 378 3 tif1 ATP-dependent RNA helicase eIF4A Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q6CIV2 5.81e-76 256 40 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A5DL80 5.99e-76 256 40 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A4QVP2 6.23e-76 251 39 2 378 3 TIF1 ATP-dependent RNA helicase eIF4A Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A2RB17 7.16e-76 253 38 5 378 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q5A9Z6 7.63e-76 251 35 3 374 3 FAL1 ATP-dependent RNA helicase FAL1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A6ZRX0 8.5e-76 255 38 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain YJM789)
Q5APT8 8.63e-76 255 39 11 380 3 DBP3 ATP-dependent RNA helicase DBP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
A6RJ45 8.69e-76 250 39 2 378 3 tif1 ATP-dependent RNA helicase eIF4A Botryotinia fuckeliana (strain B05.10)
P24783 8.77e-76 255 38 6 375 1 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2H1Q8 9.32e-76 253 39 6 386 3 RRP3 ATP-dependent rRNA helicase RRP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P0CQ76 1.08e-75 254 40 6 374 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ77 1.08e-75 254 40 6 374 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A5DE68 1.2e-75 250 36 2 366 3 FAL1 ATP-dependent RNA helicase FAL1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q5QMN3 1.22e-75 253 39 5 360 3 Os01g0197200 DEAD-box ATP-dependent RNA helicase 20 Oryza sativa subsp. japonica
B5FF87 1.78e-75 251 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain MJ11)
Q6BT27 1.87e-75 249 36 2 366 3 FAL1 ATP-dependent RNA helicase FAL1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5E8U5 1.93e-75 251 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4WX43 2.49e-75 249 39 2 368 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A6VKC3 2.67e-75 249 38 5 379 3 rhlB ATP-dependent RNA helicase RhlB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q5B948 2.77e-75 249 38 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q6Z2Z4 3.93e-75 249 38 2 374 1 Os02g0146600 Eukaryotic initiation factor 4A-3 Oryza sativa subsp. japonica
A1CJT5 4.32e-75 248 39 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q4IFI0 7.26e-75 251 37 6 397 3 RRP3 ATP-dependent rRNA helicase RRP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A1C595 7.61e-75 248 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q12099 7.77e-75 248 36 5 372 1 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXY5 7.77e-75 248 36 5 372 3 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain YJM789)
Q0CIQ3 8.17e-75 249 39 3 362 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9P735 9.36e-75 248 36 3 376 3 fal-1 ATP-dependent RNA helicase fal-1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P09052 1.01e-74 255 40 5 348 1 vas ATP-dependent RNA helicase vasa Drosophila melanogaster
Q2U6P7 1.14e-74 249 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q0CAS8 1.15e-74 248 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q8DDN6 1.23e-74 248 36 4 390 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain CMCP6)
A5AAE5 1.32e-74 247 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q7MGP7 1.46e-74 248 36 4 390 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain YJ016)
A1D071 1.48e-74 247 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q2UAK1 1.61e-74 247 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q887N8 1.71e-74 247 36 5 387 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q99MJ9 1.8e-74 256 38 7 390 2 Ddx50 ATP-dependent RNA helicase DDX50 Mus musculus
A6S4N4 1.9e-74 247 35 3 376 3 fal1 ATP-dependent RNA helicase fal1 Botryotinia fuckeliana (strain B05.10)
A7EM88 1.98e-74 247 35 3 376 3 fal1 ATP-dependent RNA helicase fal1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A7TJ36 1.99e-74 251 39 7 365 3 DBP3 ATP-dependent RNA helicase DBP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q41741 2.02e-74 247 37 3 380 2 None Eukaryotic initiation factor 4A Zea mays
P41376 2.05e-74 247 38 2 366 1 EIF4A1 Eukaryotic initiation factor 4A-1 Arabidopsis thaliana
Q8PFZ3 2.16e-74 252 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas axonopodis pv. citri (strain 306)
Q6FJG1 2.32e-74 246 35 5 372 3 FAL1 ATP-dependent RNA helicase FAL1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q40470 2.39e-74 247 38 3 380 2 None Eukaryotic initiation factor 4A-7 Nicotiana tabacum
Q2UPY3 2.45e-74 247 38 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A4QU31 2.51e-74 246 35 4 387 3 FAL1 ATP-dependent RNA helicase FAL1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q9BQ39 2.61e-74 256 38 7 390 1 DDX50 ATP-dependent RNA helicase DDX50 Homo sapiens
A3GFV3 2.61e-74 246 35 2 368 3 FAL1 ATP-dependent RNA helicase FAL1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6BLU9 2.72e-74 252 36 8 391 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q3BNH8 2.91e-74 251 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
P41382 3.14e-74 247 37 3 380 2 None Eukaryotic initiation factor 4A-10 Nicotiana tabacum
A2QEN5 3.37e-74 246 39 2 374 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4IAA0 3.63e-74 246 35 3 376 3 FAL1 ATP-dependent RNA helicase FAL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q87KH5 3.76e-74 247 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2UNB7 4.33e-74 248 37 5 402 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P41378 4.34e-74 246 38 2 378 2 None Eukaryotic initiation factor 4A Triticum aestivum
Q40471 4.45e-74 246 37 3 384 2 None Eukaryotic initiation factor 4A-9 Nicotiana tabacum
Q0I1X0 4.59e-74 246 39 4 370 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 129Pt)
Q5AUL4 4.81e-74 246 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q40467 4.84e-74 246 37 3 380 2 None Eukaryotic initiation factor 4A-14 Nicotiana tabacum
Q4WEB4 4.88e-74 246 36 3 376 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8VDW0 4.94e-74 247 35 6 383 1 Ddx39a ATP-dependent RNA helicase DDX39A Mus musculus
A1CR32 5.04e-74 248 37 5 402 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q5GUR8 5.23e-74 251 37 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q755A5 5.52e-74 250 39 7 362 3 DBP3 ATP-dependent RNA helicase DBP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5U216 6.7e-74 246 35 6 383 2 Ddx39a ATP-dependent RNA helicase DDX39A Rattus norvegicus
Q10MH8 6.76e-74 255 41 6 358 2 Os03g0308500 DEAD-box ATP-dependent RNA helicase 24 Oryza sativa subsp. japonica
P35683 7.11e-74 246 38 2 378 2 Os06g0701100 Eukaryotic initiation factor 4A-1 Oryza sativa subsp. japonica
P20447 7.39e-74 249 39 8 378 1 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5DWJ1 7.73e-74 245 34 2 366 3 FAL1 ATP-dependent RNA helicase FAL1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A2R0B5 7.84e-74 246 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A1DL85 8.14e-74 246 36 5 369 3 sub2 ATP-dependent RNA helicase sub2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1CMQ7 8.94e-74 246 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q9C718 8.96e-74 248 37 5 366 2 RH20 DEAD-box ATP-dependent RNA helicase 20 Arabidopsis thaliana
Q5WR10 9.06e-74 246 35 6 378 3 DDX39B Spliceosome RNA helicase DDX39B Canis lupus familiaris
O00148 9.19e-74 246 35 6 383 1 DDX39A ATP-dependent RNA helicase DDX39A Homo sapiens
Q8Y755 1.03e-73 246 35 2 374 2 cshB DEAD-box ATP-dependent RNA helicase CshB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5RE47 1.07e-73 246 35 6 378 2 DDX39B Spliceosome RNA helicase DDX39B Pongo abelii
Q29024 1.07e-73 246 35 6 378 3 DDX39B Spliceosome RNA helicase DDX39B Sus scrofa
P60024 1.07e-73 246 35 6 378 3 DDX39B Spliceosome RNA helicase DDX39B Pan troglodytes
Q5TM17 1.07e-73 246 35 6 378 3 DDX39B Spliceosome RNA helicase DDX39B Macaca mulatta
Q13838 1.07e-73 246 35 6 378 1 DDX39B Spliceosome RNA helicase DDX39B Homo sapiens
Q0D1K3 1.16e-73 260 39 6 389 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q1DTB3 1.17e-73 245 35 4 386 3 FAL1 ATP-dependent RNA helicase FAL1 Coccidioides immitis (strain RS)
A6ZUA1 1.19e-73 248 39 8 378 3 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain YJM789)
Q63413 1.22e-73 246 35 6 378 2 Ddx39b Spliceosome RNA helicase Ddx39b Rattus norvegicus
Q9Z1N5 1.22e-73 246 35 6 378 1 Ddx39b Spliceosome RNA helicase Ddx39b Mus musculus
Q8SRB2 1.33e-73 248 40 4 338 3 DBP2 ATP-dependent RNA helicase DBP2 Encephalitozoon cuniculi (strain GB-M1)
A6R603 1.47e-73 246 37 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Ajellomyces capsulatus (strain NAm1 / WU24)
Q8P4D4 1.59e-73 249 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWT6 1.59e-73 249 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain B100)
Q4UPY5 1.59e-73 249 37 6 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain 8004)
A4R715 1.99e-73 248 34 2 365 3 DHH1 ATP-dependent RNA helicase DHH1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q1E1N5 2.6e-73 246 37 5 405 3 RRP3 ATP-dependent rRNA helicase RRP3 Coccidioides immitis (strain RS)
Q40465 2.63e-73 244 37 3 380 2 None Eukaryotic initiation factor 4A-11 Nicotiana tabacum
A1C6C4 2.71e-73 248 38 6 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q2U070 2.77e-73 248 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9HXE5 2.84e-73 244 36 6 387 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S21 2.84e-73 244 36 6 387 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UUT0 2.84e-73 244 36 6 387 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain LESB58)
A4RGD1 2.9e-73 248 39 5 361 3 RRP3 ATP-dependent rRNA helicase RRP3 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q1DI07 3.23e-73 245 37 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Coccidioides immitis (strain RS)
B6EPA4 3.54e-73 244 36 4 379 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio salmonicida (strain LFI1238)
Q0JM17 3.68e-73 244 36 4 368 1 AIP1 DEAD-box ATP-dependent RNA helicase 56 Oryza sativa subsp. japonica
Q7RY59 3.9e-73 247 37 5 408 3 rrp-3 ATP-dependent rRNA helicase rrp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4PHU9 4.23e-73 248 38 7 378 3 DBP2 ATP-dependent RNA helicase DBP2 Ustilago maydis (strain 521 / FGSC 9021)
A6QSQ0 4.51e-73 245 36 4 380 3 FAL1 ATP-dependent RNA helicase FAL1 Ajellomyces capsulatus (strain NAm1 / WU24)
Q5JK84 4.74e-73 244 36 4 368 1 AIP2 DEAD-box ATP-dependent RNA helicase 15 Oryza sativa subsp. japonica
Q879Y6 4.76e-73 248 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q5ZHZ0 5.46e-73 244 35 6 378 2 DDX39B Spliceosome RNA helicase DDX39B Gallus gallus
Q1DQ20 5.55e-73 243 39 2 374 3 TIF1 ATP-dependent RNA helicase eIF4A Coccidioides immitis (strain RS)
Q2GWJ5 6.05e-73 243 36 4 365 3 FAL1 ATP-dependent RNA helicase FAL1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q3T147 6.53e-73 244 35 6 378 2 DDX39B Spliceosome RNA helicase DDX39B Bos taurus
Q40468 6.57e-73 243 37 3 380 2 None Eukaryotic initiation factor 4A-15 Nicotiana tabacum
Q84UQ1 7.86e-73 256 38 8 379 2 Os08g0159900 DEAD-box ATP-dependent RNA helicase 42 Oryza sativa subsp. japonica
Q15N18 8.2e-73 243 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q6FS54 8.38e-73 247 37 8 379 3 DBP3 ATP-dependent RNA helicase DBP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9NR30 9.85e-73 252 36 7 395 1 DDX21 Nucleolar RNA helicase 2 Homo sapiens
A5DAC8 1.03e-72 246 39 7 372 3 DBP3 ATP-dependent RNA helicase DBP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
P41381 1.14e-72 243 38 3 372 2 None Eukaryotic initiation factor 4A-8 Nicotiana tabacum
Q0INC5 1.15e-72 253 39 5 363 2 Os12g0481100 DEAD-box ATP-dependent RNA helicase 28 Oryza sativa subsp. japonica
A5DDF4 1.25e-72 253 37 11 411 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q9C8J1 1.26e-72 242 35 3 372 2 RH34 DEAD-box ATP-dependent RNA helicase 34 Arabidopsis thaliana
B0UUZ9 1.27e-72 243 38 4 370 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 2336)
Q9ZRZ8 1.36e-72 252 37 7 400 2 RH28 DEAD-box ATP-dependent RNA helicase 28 Arabidopsis thaliana
P0CQ70 1.56e-72 242 37 2 374 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ71 1.56e-72 242 37 2 374 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P41379 1.69e-72 242 37 3 380 2 None Eukaryotic initiation factor 4A-2 Nicotiana plumbaginifolia
A4STJ7 1.71e-72 243 38 5 379 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas salmonicida (strain A449)
A1DGZ7 1.9e-72 246 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P21507 1.95e-72 243 40 5 352 1 srmB ATP-dependent RNA helicase SrmB Escherichia coli (strain K12)
Q3B8Q1 2.48e-72 251 36 8 395 2 Ddx21 Nucleolar RNA helicase 2 Rattus norvegicus
Q9CAI7 2.6e-72 242 37 3 372 1 TIF4A-3 Eukaryotic initiation factor 4A-3 Arabidopsis thaliana
P93008 2.8e-72 250 38 3 368 2 RH21 DEAD-box ATP-dependent RNA helicase 21 Arabidopsis thaliana
Q9JIK5 2.85e-72 252 36 8 395 1 Ddx21 Nucleolar RNA helicase 2 Mus musculus
Q9CJS1 3.09e-72 242 37 3 384 3 rhlB ATP-dependent RNA helicase RhlB Pasteurella multocida (strain Pm70)
P41377 3.16e-72 241 38 2 370 1 TIF4A-2 Eukaryotic initiation factor 4A-2 Arabidopsis thaliana
Q96GQ7 3.73e-72 251 35 7 412 1 DDX27 Probable ATP-dependent RNA helicase DDX27 Homo sapiens
Q7SH33 3.81e-72 256 39 6 370 3 prp-5 Pre-mRNA-processing ATP-dependent RNA helicase prp-5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4X195 4.04e-72 245 38 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P24782 4.29e-72 245 40 6 351 2 dbp2 ATP-dependent RNA helicase dbp2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WCW2 4.93e-72 242 36 6 376 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1A4H6 5.29e-72 250 36 7 399 2 DDX27 Probable ATP-dependent RNA helicase DDX27 Bos taurus
Q6YS30 5.3e-72 244 37 7 379 2 Os07g0301200 DEAD-box ATP-dependent RNA helicase 5 Oryza sativa subsp. japonica
A5UI36 5.34e-72 241 38 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittGG)
Q6CZD9 5.82e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2GQ93 6.26e-72 244 35 2 365 3 DHH1 ATP-dependent RNA helicase DHH1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q5B0J9 7.69e-72 245 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A7E449 7.91e-72 245 39 7 359 3 dbp2 ATP-dependent RNA helicase dbp2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q5AWA6 8.61e-72 243 38 11 402 3 dbp3 ATP-dependent RNA helicase dbp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5VQL1 8.63e-72 248 38 6 367 2 Os01g0172200 DEAD-box ATP-dependent RNA helicase 14 Oryza sativa subsp. japonica
Q4P331 8.88e-72 240 37 2 374 3 TIF1 ATP-dependent RNA helicase eIF4A Ustilago maydis (strain 521 / FGSC 9021)
A2QC74 1.02e-71 244 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q02748 1.32e-71 239 37 2 374 1 eIF4A Eukaryotic initiation factor 4A Drosophila melanogaster
A5DB98 1.34e-71 239 38 2 366 3 TIF1 ATP-dependent RNA helicase eIF4A Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A3GFI4 1.36e-71 239 38 2 365 3 TIF1 ATP-dependent RNA helicase eIF4A Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A2QQA8 1.47e-71 254 38 6 389 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A5UDI1 1.59e-71 239 38 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittEE)
C6DHF5 1.59e-71 240 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MXT4 1.9e-71 240 36 4 378 3 rhlB ATP-dependent RNA helicase RhlB Vibrio campbellii (strain ATCC BAA-1116)
Q4FZF3 2.04e-71 241 35 6 412 2 Ddx49 Probable ATP-dependent RNA helicase DDX49 Mus musculus
Q4HW67 2.04e-71 243 34 2 365 3 DHH1 ATP-dependent RNA helicase DHH1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9LFN6 2.05e-71 240 35 4 368 1 RH56 DEAD-box ATP-dependent RNA helicase 56 Arabidopsis thaliana
Q56XG6 2.05e-71 240 35 4 368 1 RH15 DEAD-box ATP-dependent RNA helicase 15 Arabidopsis thaliana
A6RY31 2.24e-71 243 34 2 372 3 dhh1 ATP-dependent RNA helicase dhh1 Botryotinia fuckeliana (strain B05.10)
Q755W0 2.25e-71 239 35 3 365 3 FAL1 ATP-dependent RNA helicase FAL1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A5E6W6 2.67e-71 242 38 9 376 3 RRP3 ATP-dependent rRNA helicase RRP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A6SFW7 3.29e-71 243 39 7 359 3 dbp2 ATP-dependent RNA helicase dbp2 Botryotinia fuckeliana (strain B05.10)
Q501J6 3.36e-71 245 37 6 379 1 Ddx17 Probable ATP-dependent RNA helicase DDX17 Mus musculus
Q4IP34 3.58e-71 253 40 6 370 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A1CQA9 3.63e-71 253 38 5 389 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A4WG30 4.39e-71 239 37 5 386 3 rhlB ATP-dependent RNA helicase RhlB Enterobacter sp. (strain 638)
A0KEG9 5.46e-71 239 37 4 378 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A3LQ55 5.55e-71 249 36 10 407 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A6R3R5 5.62e-71 237 38 2 326 3 TIF1 ATP-dependent RNA helicase eIF4A Ajellomyces capsulatus (strain NAm1 / WU24)
Q18212 5.91e-71 238 35 5 372 1 hel-1 Spliceosome RNA helicase DDX39B homolog Caenorhabditis elegans
Q4R8K5 6.31e-71 238 37 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Macaca fascicularis
Q7MYL2 6.41e-71 238 36 3 378 3 rhlB ATP-dependent RNA helicase RhlB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9PA24 6.43e-71 242 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain 9a5c)
B7VME9 6.87e-71 239 35 4 380 3 rhlB ATP-dependent RNA helicase RhlB Vibrio atlanticus (strain LGP32)
A6QXC1 7.15e-71 240 37 10 385 3 DBP3 ATP-dependent RNA helicase DBP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q921N6 7.25e-71 247 36 7 412 1 Ddx27 Probable ATP-dependent RNA helicase DDX27 Mus musculus
A1D373 7.38e-71 252 38 5 391 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q2R1M8 7.61e-71 244 38 5 388 3 Os11g0599500 DEAD-box ATP-dependent RNA helicase 52C Oryza sativa subsp. japonica
Q9P7C7 7.65e-71 251 37 5 374 1 prp11 Pre-mRNA-processing ATP-dependent RNA helicase prp11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54CE0 8.01e-71 247 39 7 359 3 ddx17 Probable ATP-dependent RNA helicase ddx17 Dictyostelium discoideum
Q0IHV9 8.06e-71 240 33 1 357 2 ddx6 Probable ATP-dependent RNA helicase ddx6 Xenopus tropicalis
Q4WT99 8.14e-71 252 38 5 391 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A6RGE3 8.32e-71 241 37 5 384 3 DBP2 ATP-dependent RNA helicase DBP2 Ajellomyces capsulatus (strain NAm1 / WU24)
A4QSS5 8.72e-71 241 36 5 383 3 DBP2 ATP-dependent RNA helicase DBP2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q6FQQ6 8.97e-71 237 37 3 365 3 TIF1 ATP-dependent RNA helicase eIF4A Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
C3LQR1 9.22e-71 238 35 3 378 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain M66-2)
Q9KV52 9.22e-71 238 35 3 378 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R4 9.22e-71 238 35 3 378 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q1DP69 9.8e-71 241 37 6 381 3 DBP2 ATP-dependent RNA helicase DBP2 Coccidioides immitis (strain RS)
P87206 9.83e-71 237 38 2 365 3 TIF1 ATP-dependent RNA helicase eIF4A Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1DZK8 1.06e-70 241 37 9 393 3 DBP3 ATP-dependent RNA helicase DBP3 Coccidioides immitis (strain RS)
P47943 1.06e-70 237 38 2 374 1 tif1 ATP-dependent RNA helicase eIF4A Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Y6V7 1.11e-70 239 37 5 381 1 DDX49 Probable ATP-dependent RNA helicase DDX49 Homo sapiens
A8G828 1.17e-70 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Serratia proteamaculans (strain 568)
Q6CDV4 1.4e-70 236 37 2 378 3 TIF1 ATP-dependent RNA helicase eIF4A Yarrowia lipolytica (strain CLIB 122 / E 150)
Q329V8 1.51e-70 237 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Shigella dysenteriae serotype 1 (strain Sd197)
Q2U2J6 1.52e-70 251 37 6 389 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
G0SFM2 1.56e-70 241 37 5 370 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q54IV3 1.6e-70 249 37 6 383 3 ddx42 Probable ATP-dependent RNA helicase ddx42 Dictyostelium discoideum
Q2H720 1.68e-70 241 36 5 384 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P60843 1.73e-70 237 37 4 381 1 Eif4a1 Eukaryotic initiation factor 4A-I Mus musculus
P60842 1.73e-70 237 37 4 381 1 EIF4A1 Eukaryotic initiation factor 4A-I Homo sapiens
Q3SZ54 1.73e-70 237 37 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Bos taurus
P29562 1.8e-70 236 37 4 381 1 EIF4A1 Eukaryotic initiation factor 4A-I (Fragment) Oryctolagus cuniculus
P0CQ96 1.81e-70 238 36 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ97 1.81e-70 238 36 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q5QYF8 1.85e-70 237 36 3 374 3 rhlB ATP-dependent RNA helicase RhlB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P46942 1.88e-70 242 38 6 357 2 None ATP-dependent RNA helicase-like protein DB10 Nicotiana sylvestris
Q5R4I9 1.92e-70 242 37 5 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pongo abelii
Q6LLL5 2.12e-70 237 36 4 380 3 rhlB ATP-dependent RNA helicase RhlB Photobacterium profundum (strain SS9)
Q6BZ77 2.35e-70 240 37 8 377 3 DBP3 ATP-dependent RNA helicase DBP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q92841 2.42e-70 245 37 6 379 1 DDX17 Probable ATP-dependent RNA helicase DDX17 Homo sapiens
P17844 2.54e-70 242 37 5 353 1 DDX5 Probable ATP-dependent RNA helicase DDX5 Homo sapiens
A3LRW2 2.77e-70 239 37 8 377 3 DBP3 ATP-dependent RNA helicase DBP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q61656 3.29e-70 242 37 5 353 1 Ddx5 Probable ATP-dependent RNA helicase DDX5 Mus musculus
Q2HAD8 3.55e-70 249 38 8 381 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
B1LLV3 3.61e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SMS-3-5 / SECEC)
Q6BRN4 3.69e-70 236 37 2 366 3 TIF1 ATP-dependent RNA helicase eIF4A Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q6CT46 3.74e-70 239 41 6 342 3 DBP3 ATP-dependent RNA helicase DBP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
B7LU75 4.18e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1CX72 4.44e-70 245 35 6 401 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q2H4D0 4.57e-70 236 35 4 369 3 SUB2 ATP-dependent RNA helicase SUB2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q53RK8 4.6e-70 244 37 3 367 2 Os03g0708600 DEAD-box ATP-dependent RNA helicase 21 Oryza sativa subsp. japonica
Q6Z4K6 4.67e-70 242 38 5 380 2 PL10B DEAD-box ATP-dependent RNA helicase 52B Oryza sativa subsp. japonica
Q5N7W4 4.86e-70 243 38 4 365 2 Os01g0911100 DEAD-box ATP-dependent RNA helicase 30 Oryza sativa subsp. japonica
Q8H136 4.88e-70 241 37 7 377 1 RH14 DEAD-box ATP-dependent RNA helicase 14 Arabidopsis thaliana
A5DIP0 4.93e-70 239 35 2 362 3 DHH1 ATP-dependent RNA helicase DHH1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
B7NTG2 5.05e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YY28 5.32e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3YVI4 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Shigella sonnei (strain Ss046)
P0A8K0 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri
Q1R4F9 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain UTI89 / UPEC)
B6I4B6 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SE11)
P0A8J8 5.49e-70 236 36 4 388 1 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12)
B1IWC0 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8J9 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU3 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHV0 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O1:K1 / APEC
A8A6N4 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O9:H4 (strain HS)
B1X9Z4 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / DH10B)
C4ZZ48 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5C7 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O8 (strain IAI1)
B7MR01 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O81 (strain ED1a)
B7L8B6 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain 55989 / EAEC)
B7MGJ1 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN5 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTY2 5.49e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NF85 5.73e-70 236 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q4WPE9 6.02e-70 245 35 6 401 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1C5V3 6.34e-70 238 36 9 384 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A5DVM3 6.5e-70 235 37 2 365 3 TIF1 ATP-dependent RNA helicase eIF4A Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A5A6N4 6.98e-70 235 37 3 375 2 EIF4A1 Eukaryotic initiation factor 4A-I Pan troglodytes
Q6C9P3 7.65e-70 239 38 10 377 3 DBP3 ATP-dependent RNA helicase DBP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8L7S8 7.66e-70 244 33 6 433 1 RH3 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Arabidopsis thaliana
Q5R5F5 7.92e-70 235 37 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Pongo abelii
Q09181 8.16e-70 237 34 2 357 3 ste13 Putative ATP-dependent RNA helicase ste13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4R6M5 8.33e-70 241 37 5 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Macaca fascicularis
Q0CGJ9 8.4e-70 236 36 6 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A3LQW7 8.62e-70 238 40 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
P54824 1.03e-69 237 33 1 357 1 ddx6 ATP-dependent RNA helicase ddx6 Xenopus laevis
Q7S5D9 1.09e-69 239 35 2 353 3 drh-10 ATP-dependent RNA helicase dhh1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4E162 1.09e-69 234 37 1 368 3 Tc00.1047053511585.190 Probable eukaryotic initiation factor 4A Trypanosoma cruzi (strain CL Brener)
Q5R6D8 1.11e-69 248 35 8 444 2 DDX46 Probable ATP-dependent RNA helicase DDX46 Pongo abelii
Q5JKF2 1.18e-69 244 39 6 366 2 Os01g0549400 DEAD-box ATP-dependent RNA helicase 40 Oryza sativa subsp. japonica
Q5ZKB9 1.18e-69 237 33 1 357 2 DDX6 Probable ATP-dependent RNA helicase DDX6 Gallus gallus
Q7L014 1.18e-69 248 35 8 444 1 DDX46 Probable ATP-dependent RNA helicase DDX46 Homo sapiens
Q8XAT4 1.3e-69 235 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7
Q810A7 1.33e-69 246 38 6 367 1 Ddx42 ATP-dependent RNA helicase DDX42 Mus musculus
P26196 1.36e-69 236 33 1 357 1 DDX6 Probable ATP-dependent RNA helicase DDX6 Homo sapiens
Q1E5R1 1.38e-69 238 33 2 365 3 DHH1 ATP-dependent RNA helicase DHH1 Coccidioides immitis (strain RS)
Q5BCU6 1.42e-69 244 34 6 406 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P54823 1.61e-69 236 33 1 357 1 Ddx6 Probable ATP-dependent RNA helicase DDX6 Mus musculus
Q31UK5 1.65e-69 234 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 4 (strain Sb227)
B2TU12 1.65e-69 234 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O62591 1.7e-69 234 37 1 367 3 LmjF.01.0770 Probable eukaryotic initiation factor 4A Leishmania major
A4HRK0 1.7e-69 234 37 1 367 3 LinJ01.0780 Probable eukaryotic initiation factor 4A Leishmania infantum
Q86XP3 1.72e-69 246 38 6 367 1 DDX42 ATP-dependent RNA helicase DDX42 Homo sapiens
A5A6J2 1.79e-69 240 37 5 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pan troglodytes
Q2NQB2 1.82e-69 234 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Sodalis glossinidius (strain morsitans)
Q569Z5 1.95e-69 247 35 8 444 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Mus musculus
A1DG51 2.04e-69 237 37 8 383 3 dbp3 ATP-dependent RNA helicase dbp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q62780 2.17e-69 247 35 8 444 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Rattus norvegicus
Q9LYJ9 2.37e-69 240 37 7 377 2 RH46 DEAD-box ATP-dependent RNA helicase 46 Arabidopsis thaliana
Q54E49 2.41e-69 234 33 2 357 3 ddx6 Probable ATP-dependent RNA helicase ddx6 Dictyostelium discoideum
Q7SBC6 2.46e-69 238 36 5 383 3 drh-1 ATP-dependent RNA helicase dbp2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5ADL0 2.48e-69 244 35 10 415 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q65RG7 2.5e-69 234 40 3 346 3 rhlB ATP-dependent RNA helicase RhlB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q26696 2.7e-69 238 38 9 383 3 HEL64 Putative DEAD-box RNA helicase HEL64 Trypanosoma brucei brucei
Q4JG17 2.79e-69 241 38 6 368 2 vasa Probable ATP-dependent RNA helicase vasa-like Penaeus vannamei
A1CJ18 2.81e-69 236 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A8ACT3 2.87e-69 234 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1D8G1 2.88e-69 236 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q1DMX8 3.04e-69 243 36 8 403 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Coccidioides immitis (strain RS)
A3LWX3 3.12e-69 236 35 2 358 3 DHH1 ATP-dependent RNA helicase DHH1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A5DS77 3.19e-69 238 40 7 377 3 DBP2 ATP-dependent RNA helicase DBP2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q8RXK6 3.24e-69 236 33 2 364 2 RH8 DEAD-box ATP-dependent RNA helicase 8 Arabidopsis thaliana
Q4WWD3 3.4e-69 236 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q25225 3.78e-69 233 37 1 367 3 LbrM01_V2.0740 Probable eukaryotic initiation factor 4A Leishmania braziliensis
B5BIS9 3.94e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi A (strain AKU_12601)
Q5BDW4 3.99e-69 247 38 6 381 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B4F1V3 4.11e-69 234 35 3 378 3 rhlB ATP-dependent RNA helicase RhlB Proteus mirabilis (strain HI4320)
Q9WTM2 4.13e-69 235 33 1 357 2 DDX6 Probable ATP-dependent RNA helicase DDX6 (Fragment) Cavia porcellus
A2QY39 4.62e-69 236 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A9MJ29 4.75e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q0CBE1 5.3e-69 236 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A4RBS3 5.64e-69 234 35 4 369 3 SUB2 ATP-dependent RNA helicase SUB2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P0A2P0 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P1 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhi
B4TNT3 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella schwarzengrund (strain CVM19633)
C0Q2V9 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi C (strain RKS4594)
A9MXF3 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ26 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella newport (strain SL254)
B4TB13 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella heidelberg (strain SL476)
B5RFS3 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVH2 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella enteritidis PT4 (strain P125109)
Q57HT6 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella choleraesuis (strain SC-B67)
B5EZ40 5.92e-69 233 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Salmonella agona (strain SL483)
A1CHL3 6.43e-69 242 35 6 401 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q2U5A2 8.09e-69 235 33 2 365 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q0SYX0 8.45e-69 233 37 3 355 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri serotype 5b (strain 8401)
Q4WH83 8.93e-69 235 37 8 383 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9DBN9 9.03e-69 238 35 5 389 1 Ddx59 Probable ATP-dependent RNA helicase DDX59 Mus musculus
Q4TVV3 1.05e-68 244 36 4 370 2 ddx46 Probable ATP-dependent RNA helicase DDX46 Danio rerio
A7TK55 1.06e-68 231 36 3 374 3 TIF1 ATP-dependent RNA helicase eIF4A Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A5DQS0 1.08e-68 238 39 4 354 3 DED1 ATP-dependent RNA helicase DED1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q3MSQ8 1.1e-68 240 37 6 383 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Pelophylax lessonae
Q7ZY47 1.12e-68 244 38 9 395 2 ddx42 ATP-dependent RNA helicase DDX42 Xenopus laevis
A7MQI2 1.13e-68 232 36 4 386 3 rhlB ATP-dependent RNA helicase RhlB Cronobacter sakazakii (strain ATCC BAA-894)
P16381 1.16e-68 239 38 6 377 1 D1Pas1 Putative ATP-dependent RNA helicase Pl10 Mus musculus
P44922 1.18e-68 232 38 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6TGG9 1.19e-68 232 36 4 388 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9M2F9 1.32e-68 238 37 5 386 1 RH52 DEAD-box ATP-dependent RNA helicase 52 Arabidopsis thaliana
P0CQ80 1.38e-68 238 35 1 354 3 DHH1 ATP-dependent RNA helicase DHH1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ81 1.38e-68 238 35 1 354 3 DHH1 ATP-dependent RNA helicase DHH1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q95YF3 1.46e-68 232 31 3 382 1 cgh-1 ATP-dependent RNA helicase cgh-1 Caenorhabditis elegans
Q1DHB2 1.47e-68 246 38 7 384 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Coccidioides immitis (strain RS)
B2VG58 1.49e-68 232 38 4 355 3 rhlB ATP-dependent RNA helicase RhlB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08710
Feature type CDS
Gene srmB
Product DEAD/DEAH family ATP-dependent RNA helicase
Location 122544 - 124451 (strand: 1)
Length 1908 (nucleotides) / 635 (amino acids)

Contig

Accession contig_9
Length 163724 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1410
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain
PF03880 DbpA RNA binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0513 Replication, recombination and repair (L) L Superfamily II DNA and RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05592 ATP-dependent RNA helicase DeaD [EC:3.6.4.13] RNA degradation -

Protein Sequence

MTTETEISFADIGLSADILTALDDLGYEKPSPIQQQCIPHLLAGRDVLGMAQTGSGKTAAFGLPLLNNIDPNLRAPQILVLAPTRELAVQVAEACTDFSKHMRNVNVVALYGGQRYDVQLRALRQGPQVVVGTPGRLLDHLKRGTLDLSNLKGLVLDEADEMLRMGFIEDVETIMSQIPAEHQTALFSATMPEAIRRITRRFMKDPQEVRIQTSVTTRPDISQSYWTAYGARKSEALVRFLEAEDFDAAIIFVRTKNATLEVAETLERNGYNSAALNGDMNQALREQTLERLKDGRLDILIATDVAARGLDVERISLVVNYDIPMDAESYVHRIGRTGRAGRAGRALLFVENRERRLLRNIERTMKLTIPEVELPDAEMISQRRQEKFAATIHAEMESSNLDQYRALLKKLVPADSDESDADIDMETLAAVLLKMAEGERKLILPPDAPRRPRREFNDRDDRRRNDRNDRFGDRPERGDRPRRERRDVGDMELYRIEVGRTDGVEVRHIVGAIANEGDINSRYIGNIKLFDTHSTIELPKGMPTDLLQHFTRTRVMNKPMNMTLVGDAKPFNRERRSGGNDRGGNGGRSFGGGNRRDGERSDRGNSDRRPQGERRSFRREEGGNSAPRRRSNNDA

Flanking regions ( +/- flanking 50bp)

TTCCGATGGGTTGTGTAGACTGGCCGCCATTTTGTATGAGGCACCTTTACATGACCACTGAGACTGAAATCTCTTTTGCTGACATTGGTTTATCAGCTGATATTTTGACTGCACTGGACGACCTGGGCTACGAAAAGCCGTCCCCGATCCAGCAACAATGTATTCCGCACCTGCTTGCCGGACGTGATGTCCTGGGTATGGCACAGACAGGTAGTGGTAAAACGGCGGCATTCGGCCTGCCGTTACTGAACAATATTGATCCGAACCTGAGAGCACCACAGATTCTGGTGCTGGCACCGACCCGCGAATTAGCGGTCCAGGTTGCGGAAGCCTGTACTGATTTCTCCAAACATATGCGTAACGTGAATGTGGTCGCCCTGTACGGCGGTCAGCGTTATGACGTCCAGTTACGCGCTCTGCGTCAGGGGCCACAGGTGGTTGTCGGGACTCCGGGCCGTCTGCTGGATCACTTAAAACGCGGCACCCTGGATTTATCCAACCTGAAAGGTCTGGTACTGGACGAAGCAGATGAAATGCTGCGCATGGGCTTCATCGAAGACGTTGAAACCATCATGAGCCAGATCCCGGCAGAGCATCAGACAGCTCTGTTCTCTGCAACTATGCCGGAAGCTATCCGCCGCATTACCCGTCGTTTCATGAAAGATCCGCAGGAAGTGCGCATTCAGACCAGCGTCACTACCCGTCCGGACATCAGCCAGAGCTACTGGACTGCTTACGGCGCACGTAAGAGCGAAGCACTGGTCCGTTTCCTGGAAGCGGAAGATTTTGATGCGGCGATTATCTTCGTCCGTACCAAAAACGCAACCCTGGAAGTGGCAGAAACTCTGGAGCGTAACGGCTACAACAGCGCTGCACTGAACGGTGACATGAACCAGGCACTGCGTGAGCAGACACTGGAGCGCCTGAAAGACGGTCGTCTGGATATCCTGATTGCAACCGACGTTGCAGCCCGTGGTCTGGACGTTGAGCGTATCAGCCTGGTTGTTAACTACGATATCCCGATGGATGCGGAATCTTATGTTCACCGTATCGGCCGTACCGGTCGTGCGGGCCGCGCCGGCCGCGCTCTGCTGTTCGTTGAAAACCGCGAACGCCGCCTGCTGCGCAACATTGAACGCACCATGAAACTGACCATCCCTGAGGTAGAATTACCGGATGCAGAGATGATCAGCCAGCGCCGCCAGGAAAAATTCGCTGCCACTATCCATGCAGAAATGGAAAGCAGCAACCTGGATCAGTACCGTGCACTGCTGAAAAAACTGGTTCCGGCAGACAGCGATGAGTCTGACGCAGATATCGATATGGAAACTCTGGCTGCTGTTCTGCTGAAAATGGCAGAAGGTGAGCGCAAACTGATCCTGCCACCGGATGCACCACGCCGTCCGCGCCGTGAGTTCAATGATCGTGATGATCGCCGCCGCAATGATCGCAACGACCGTTTCGGTGATCGCCCTGAGCGTGGTGATCGTCCGCGCCGTGAACGCCGTGACGTGGGTGATATGGAACTGTACCGCATTGAAGTGGGCCGTACCGATGGTGTTGAAGTCCGTCACATTGTGGGCGCGATTGCTAACGAAGGTGATATCAACAGCCGTTACATCGGTAACATCAAACTGTTTGATACTCACTCAACTATCGAATTACCGAAAGGTATGCCGACTGACCTGTTACAGCACTTCACCCGTACCCGTGTGATGAACAAACCAATGAACATGACATTAGTCGGTGATGCGAAGCCGTTCAACCGTGAACGCCGCAGCGGTGGTAATGACCGTGGTGGTAACGGTGGCCGCAGTTTCGGTGGTGGTAACCGCCGTGACGGTGAGCGTTCTGACCGTGGCAACAGCGATCGCCGTCCGCAGGGCGAGCGCCGCAGCTTCCGCCGCGAAGAAGGCGGAAACTCCGCACCACGTCGTCGTAGCAATAATGATGCATAATTGATTCTCTGAATCATAAAAAGCCCGGCCGGGGATATCCCTGCCGGGCT